Stenography is another name for shorthand. I guess you could take dictation into your arm with DNA stenography... -----BEG PGP SIGNATURE---- Version: Petty Genetic Privacy v -1 GATCGATCGACGCATGACTGCATGACGTACGTTGACT GTACGACTGTGACTGATCTTACGCAGTTGACTGACTG ACACTGAGCTGCACATCTGCATCTGATGCATGACTTC GTCAACATCG -----END PGP SIGNATURE-----
Stenography is another name for shorthand. I guess you could take dictation into your arm with DNA stenography... -----BEG PGP SIGNATURE---- Version: Petty Genetic Privacy v -1 GATCGATCGACGCATGACTGCATGACGTACGTTGACT GTACGACTGTGACTGATCTTACGCAGTTGACTGACTG ACACTGAGCTGCACATCTGCATCTGATGCATGACTTC GTCAACATCG -----END PGP SIGNATURE-----