Slashdot Mirror


User: WickedScorp

WickedScorp's activity in the archive.

Stories
0
Comments
10
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 10

  1. Re:Wonder how this affects... on Identical Twins Not Identical After All · · Score: 2, Interesting

    It is also important to note mosaic trisomy 21 is reported to be a vast minority in the literature. Certainly there seems to be a correlation between % trisomic cells and clinical phenotype / degree of mental retardation. However, perhaps even more interestingly is the huge variation in associated phenotypes complete trisomies. The number of associated phenotypes is huge, and two individuals with Down syndrome likely only share a small subset.

    More importantly, this idea of genetic heterogeneity should be expanded to all diseases. Not just in the way of copy number variants, but also causative alleles. No two individuals have exactly the same course of any genetic disease. Furthermore, there are cell to cell differences throughout the body that differ in mutation content and copy number variation. You might have a cell in your thumb deleted for a colon cancer tumor suppressor, but if that gene doesn't perform that function in your thumb it doesn't matter.

  2. Re:Ah yes... on Human Genome Sequencing Completed · · Score: 2, Interesting
    Say I tell you that gene XXXX is located at YYYY. It doesn't necessarily mean that we know anything about the controlling sequences. I'll use a standard protein coding gene. We would know where all the exons are, including the upstream part of the transcript that is made into RNA but isn't translated into protein, the protein coding sequence, and the downstream region that is made into RNA but not made into protein. Also in between the exons of the gene are the introns that are made into RNA with the rest of the gene, but are cut out before the RNA is used. For many genes we have at least a fuzzy idea what *characterized* promoters are in the region. This is where it gets tricky. Enhancers and insulators, that increase and decrease the efficiency of making RNA from DNA, can be at *considerable* distance from the gene they control. They can even be within an intron of the gene AND they can function from either strand of a double stranded DNA molecule pointing in any direction (toward OR away from the sequence of interest). We don't know much about the control most of the time. Let me put it this way. There is evidence that 5% of the genome is under purifying selection i.e. very important to not tinker much with. 1.5% of that is gene coding space. What's the other 3.5%? At least a good fraction of it has to be controller sequences. But the beyond that, we don't know. They are probably going to end up being elements we've never seen and don't understand how they work. Entirely new classes of DNA control sequences.

    Viral Gene Therapy

    I don't know as much about this topic, so be forgiving. The idea with viral mediated gene therapy is that someone is missing a gene entirely or the copy they have is basically defunct. One way to fix it is to target the broken sequence and paste what you want into it. Like a word search and replace. Viruses that integrate into our genes are good at that. The problem is targeting. Most viruses that we can get to integrate do so RANDOMLY. Not a problem, you'll still be pasting a functional sequence into the DNA so they can at least make some of the protein. But what if you land it at a place far away from the uncharacterized control elements that say when to turn on and when turn off? Maybe the small amount of basal transcription will produce enough protein to correct the defect, maybe not. What if it lands in an area that is always very highly expressed? Overexpression of the gene product can be bad too. Then a third problem to look out for is what if this thing randomly integrates and hits the middle of a good gene, killing it. Then you've got a whole other problem entirely. For the sequence to go into the vector what you have to do is really going to be dependent on the sequence. If the gene is very small, maybe you want to put in exons, introns and everything else. Otherwise, if it is too big, maybe you take the introns out and put just the exons in (remember that the exons are cut out of RNA anyway and the exons are spliced together). Some are so big that even just the exons can't all go in. Dystrophin for example is mutated in Duchenne and Becker's Muscular Dystrophy. It would be great for gene therapy but it is *huge* and I mean huge compared to most genes. Maybe there you can only put part of the sequence in, so you try to guess what parts of the protein are the most functionally important. Gene therapy is something that has the potential to be very valuable. It just really hasn't had any success over a pretty big period of time that people have worked on it. One good example is Severe Combined Immune Deficiency (SCID). These are the people that have to live in a bubble because their immune system doesn't work. But if you reconstitute the mutated genes, they would be fine. There were some trials in France of Gene Therapy to fix the problem and in several people they did. Those individuals went from living in sterile conditions to basically a normal life. Then the side effects came in. Where the gene landed in a few of them basically gave some of the patients leukemia!!! So they

  3. Re:Genes make proteins. on Human Genome Sequencing Completed · · Score: 2, Insightful

    Many genes make proteins, but not all. Genes are expressed into RNA. Ribosomal RNA genes don't make protein; instead they make RNA contribution to the ribosome.

  4. Re:Ah yes... on Human Genome Sequencing Completed · · Score: 3, Informative

    The basic idea is this. Our cells need a program that tells them what to do. That's the genome. There are a total of 46 chromosomes consisting of two sets of 23 independent chromosomes (1 - 22 and X or Y). DNA makes up the chromsomes. It's just a chemical structure that stores information; the four chemicals that make up DNA are Adenine (A), Thymidine (T), Cytosine (C) and Guanine (G). Every DNA molecule is actually two pieces of DNA that pair together as A binding to T and C binding to G. Sequencing is a chemical reaction that will tell you what the sequences of these four nitrogenous bases are. For example you may end up getting a read of AGTATTACGTATGCATAGGTCCGATG from a sequencing reaction (usu you'll get about 500 - 700 bases in one reaction). This tells you the sequence of ONE of the TWO strands of the DNA molecule. BUT since they pair in a predictable way, you know the sequence of the opposite strand (A-T and C-G). Our genomes are composed of approximately 3.2 billion total As, Cs, Ts and Gs. The goal of the genome project was just to tell us what the sequence of those bases are. That's it. Finding genes and things of that nature are really things that come about from having the primary sequence to reference. If you want to find a mutation you have to know what the sequence is SUPPOSED to be and WHERE IT IS before you can say it is different. That's your quick answer: the genome project sought to determine (1) what the sequence of bases in human chromosomes where and (2) the physical position of these sequences within the chromosomes. They did some other interesting things to prepare for it along the way, but that is a separate matter.

  5. Re:I thought... on Human Genome Sequencing Completed · · Score: 1

    No, I wouldn't say that. We're talking about the vast VAST majority of the 3 billion some odd base pairs of sequence being completed. Sure, there were some gaps. But they are gaps on the order of "We only have 65% of the genome done". I would call it fair to say that the announcement was right. Since then it's all been refinement. Even now there are some regions that we just can't sequence. Repetitive regions for instance. There are some regions just made up of a ton of repetitive sequence that you can't put together into coherent sequences. But with those regions aside, it's pretty useful to have almost all of the bases out of the whole genome. The gaps typically aren't in areas where you would expect genes or control elements. In summary: No, I wouldn't say it's premature and we've got most of the important stuff.

  6. Re:I thought... on Human Genome Sequencing Completed · · Score: 1

    Both right and wrong. In 2003 both the public effort and the effort at Celera released a "Finished" sequence that was basically 99% complete. It was as much of the genome as could be easily cloned and sequenced. But there have been gaps in the sequence. Since the release of the finished sequence the remaining gaps have slowly been resolved. I suppose by "finishing" chr 1 they are saying that all of the DNA that can be cloned and sequenced with current technology has been done.

  7. Re:A simple question on Human Genome Sequencing Completed · · Score: 1

    Absolutely. Both size and density are important. For example, three copies of a chromosome are generally incompatible with life. But we see people with Down Syndrome all the time. One reason is that Chromosome 21 is both the shortest chromsome AND relatively gene poor compared to the rest of the genome.

  8. Re:SNPs on Human Genome Sequencing Completed · · Score: 1

    Don't forget large scale copy number polymorphims. Wigler, Iafrate, etc. If you concur that the data is really there. I'm disposed to believe them.

  9. Re:Ah yes... on Human Genome Sequencing Completed · · Score: 3, Interesting

    I'm forced to agree with QuantumG. I'm a Human Geneticist and the genome project is an invaluable tool in the study of human disease. I can understand the fear of the misuse of the technology, but do you think that part of the genome should have been left unsequenced? If so which parts? What would be the benefit of such and action? This technology has allowed for the development of the ability to rapidly screen for the many know disease mutations to assess risk for "genetic" disease. It has also had practical medical impact in daily life. Screen cancer samples for chromosomal abnormalities and mutations has led to the development of rational therapy for specific cancer types. Where everything is leading is rational therapy overall. Individualized medicine and preventative medicine are the goals. I do agree with you that there are dangers associated with such knowledge. The question is whether we can use it to benefit the everyday man or woman to improve the quality of life for everyone.

  10. Re:A simple question on Human Genome Sequencing Completed · · Score: 3, Informative

    They are all different sizes. Chromosomes are numbered from largest to smallest 1 - 22 (except 21 and 22; 21 is actually the shortest and 22 is slightly bigger; the mistake was made in early cytogenetics because they couldn't distinguish the sizes well enough and those two were named incorrectly) + X and or Y. So chr 1, being very large, has a very large number of genes just because it's huge. It isn't the most gene dense, however, which is chromosome 19 with more genes / Mb than elsewhere in the genome.