Slashdot Mirror
Japan to Allow Human-Nonhuman Mixed Cloning
Sara Chan writes: "Japan has decided to allow combined human-animal embryos to be produced through cloning, which could result in mixed-species creatures. The intended purpose is to permit transplant organs to be produced in specially-bred animals. The original story is in a Japanese newspaper, but you can get an English summary here."
Yomiuri Shimbun has an excellent English edition, which has an English version of the article in the Science section.
I think this is the scariest frontline documentary I've ever seen:
Organ Farm
Humand have been eating monkeys in that part of the world for millenia. What changed to cause HIV to hop from one species to another?
Maybe it has before and the conditions were not right for it to spread. You jump to conclusions without considering a simple possibility.
These issues are vastly more complex than the glib statements made by the genetics industry would have people believe.
They're also far more complex than your child like treatment of them.
Yes. Typically it's not done with human genes, as it's easier to get non-human cells and non-human genes, but alot of experiments involve rescueing null mutants (where a protein of importance has been disabled in the mutant) with exogenous or xenobiotic protein or DNA. This is typically used as a demonstration of the ability of a specific model to be used as an abstraction of the equivalent human system (or higher organism). [I haven't done this work in my lab, as we don't deal with whole cells, but there are researchers around me who have...]
In the near future, the most likely thing that is going to happen is the cloning of pigs with exact copies of human immunospecific proteins for the human who needs an organ transplant. Then the donor animal will have an exact match immunologically with the human patient, and the human patient will not have to be subjected to an arduous immunosuppressent regimin. So you'll have a chimeric pig expressing the patient's immunological markers, and won't have to wait for a compatible human donor to die or sign consent forms.
Beyond that is mere conjecture, but I don't expect we'll be seeing anything resembling the mythical chimeras of olde, as a work like that would involve a gargantuan effort and (in my mind at least) would have little to no scientific validity and usefullness.
http://www.donarmstrong.com
I have a PhD in Nuclear physics and I am a chartered engineer.
Three mile island came within seconds of a melt down. It demonstrates conclusively that the nuclear industry was nowhere near as safe as it had claimed. I don't accept the spin from the PR flaks of the nuclear industry that we have to trust them until they kill 5,000 people for real.
If the dice had rolled only slightly differently, the operators at Cherobyl might have succeeded in shutting down the reactor, had the three mile island operators not been lucky the reactor might have gone. The design flaw at Chernobyl was one that could not have been predicted with the design tools available in the USSR or the US when the plants were built. It was an area of positive feedback in the control regime that could only be detected using 3d modelling. That did not become possible until the introduction of the first CRAY series - and even then it took quite a long time for the simulation software to appear.
Moreover, the placement of any potentially hazardous industrial complex on three mile island should never have been allowed, let alone a nuclear plant. The bridges to the island simply cannot support an evacuation in an acceptable time. Building a nuclear plant that close to manhattan was gross negligence.
I used the term 'intrinsicaly safe' in a technical sense, no light water design is intrinsically safe, there is a critical mass that is damped down to prevent runnaway. If the safety systems fail and do not fail safe as planned you get a heck of a bang.
The Canadian CANDU heavy water system is intrinsically safe. It employs heavy water as the moderator, if there is a failure of the pressure vessel etc, etc the glass containers shatter and the moderator drains away shutting down the reaction. In pebble bed each fuel element is encapsulated in a moderator shell, again no critical mass, no chance of a big bang.
Do not assume that because there are some ignorant critics of nuclear power that all critics are ignorant. If the nuclear industry had not told so many blatant and deliberate lies in the 60s and 70s there might have been fewer ignorant critics today.
Jim Cramer (The Street.com) has a rule - financial irregularities means sell. Basically when ypou have been lied to by the management of a company it is time to take the exit door (e.g. Enron). In the UK the Thatcher govt. discovered during their privatization of the electricity industry that far from being low cost, the nuclear stations were barely economic on an operating basis - there was no possibility of paying of the original capital costs or eventual decommissioning costs. As a result a government that started ideologically committed to nuclear power discovered that the books had been cooked and they could not sell the plants to anyone at any price.
Further, the irrational fear of nuclear-anything means that most Americans miss out on some important technologies: for example, all of the E coli outbreaks of the last decade could have been prevented through irradiation.
Irradiation is banned for good reason. If you irradiate food you kill off the bugs but not the toxins they create. If technology allows food that is unfit for human consumption to be passed of as fresh you can be 100% sure that it will happen in the US.
Looking for an Information Security student project suggestion?
Try http://dotcrimeManifesto.com/
here's a link saying why that's crap. Basically, the vaccine makers never used chimps in their research (there's no chimp DNA in the results). There is no SIV in the results.
The most telling line is this one though: Hooper argues that that theory lacks scientific proof and that no one has as yet produced scientific evidence to contradict his theory
In other words, "no one can disprove this, so it must be true!", or, in other words "It's total crap!". No legitimate scientist would ever say that, Its the same kind of crap spouted by people who don't believe in evolution or global warming.
autopr0n is like, down and stuff.
In genetics we use somatic cell hybridization for genetic analysis and chromosome mapping. It is the process of fusing human mouse cells and culturing them in a lab.
Transgenic animals have already been created in many countries. Pigs with human genes to prevent rejection of heart valves come to mind.
In my opinion, the article was poorly translated and the initial post was misleading. People are having images of werewolves and such. At this point in time it would be impossible to successfully create a hybrid of this type. In 10 or 20 years this might actually be a problem. Until then, it's science fiction.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
DMT1 is thought to be an autoimmunedisease in which case you'd have to recieve a pancreas with non-immunogenic beta-islet cells, considering they don't even know why they're immunogenic (ie which protien, but their best guess is it's a pre-insulin product in the pathway to insulin production, which of course is bad) i, unfortunately, wouldn't expect a foolproof pancreas in your lifetime... but if we could "cure" DMT1 in our grand-children's generation then i would consider it a battle won.
it's unfortunate that religion must so often stand in the way of actually helping people in the name of ethics, seems a bit of an oxymoron to me...
With a few exceptions, secrecy is deeply incompatible with democracy and with science. --Carl Sagan
Genetically Engineered...
Bansai Anime Pleasure Drones.
I bet there's some species of animal where the female copulates and then leaves immediately. (without killing the mate, if you please)
Once again, I'm looking to the porn industry to lead the way into this new technological realm.
My opinions are my own, and do not necessarily represent those of my employer.
Human-chimp/gorilla/etc cross breed is impossible because they have a different number of chromosomes(human 23 gorilla/chimp 24). When the first cell division is supposed to happen, one of the chromosomes would not find a pair and the process self-destructs.