Slashdot Mirror


3rd Chromosome Deciphered

veeoh writes: "Another chapter in the human book of life has been published. Scientists working as part of the Human Genome Project(including some from the Wellcome Trust) have deciphered the complete genetic instructions of a third chromosome, one of the 24 bundles of DNA that carry our genetic material. The BBC has an article about the discovery"

16 of 194 comments (clear)

  1. 3rd chromosome eh? by redhairedneo · · Score: 0, Offtopic

    Maybe they can cure my muscle deficincy now?

    1. Re:3rd chromosome eh? by Anonymous Coward · · Score: -1, Offtopic
      I've dislocated my brain.

      I went out drinking and now I'm blind drunk.

      Goddamn I'm a lsoer.

  2. Chromosomes. by Fecal+Troll+Matter · · Score: -1, Offtopic

    46 and 2 are just ahead of me...

  3. =( by Andorion · · Score: -1, Offtopic

    RIP Douglas Adams.

  4. 3d Chromosome by Anonymous Coward · · Score: -1, Offtopic
    ATTTAACCGAATATGGTTAAGAGCCCTCTTCTCGAGACTAGATCA
    TAAGAGCCCTCTTCTCGAGACTAGATCAATTTAACCGAATATGGT
    ATTTAACCGAATATGGTAYBABTUATTTAACCGAATATGGTCCGC
    CCGAGAGTTCATTTAACCGAATATGGTAGTTCATTAGTTCATTCC
    CCGGAGATTTACAGTTCATTGTTCATTTAACCGAATTAGTTTTAG

    Important Stuff: Please try to keep posts on topic. Try to reply to other people comments instead of starting new threads. Read other people's messages before posting your own to avoid simply duplicating what has already been said. Use a clear subject that describes what your message is about. Offtopic, Inflammatory, Inappropriate, Illegal, or Offensive comments might be moderated. (You can read everything, even moderated posts, by adjusting your threshold on the User Preferences Page)

  5. so yesterday by gkbarr · · Score: -1, Offtopic
    Thanks /. but this is YESTERDAY'S news. Slash needs to start looking into providing up-to-date coverage, not that it matters in this case.

    Got troll?

    --
    Sapere Aude - Homer
  6. YAAD by Anonymous Coward · · Score: -1, Offtopic

    stfu

  7. Re:What does this say about us? by Anonymous Coward · · Score: -1, Offtopic

    YOU ARE A FUCKING IDIOT!!!

    YOU HAVE ALMOST no control ON WHETHER YOU GET DIABETES!!!

    OBESITY IS usually A DEFECT IN THE ABILITY OF ONE'S BODY TO digest FOOD!!!

    excema is not PURELY due to DIRTY SKIN!!!

    'nuff said

  8. Hrmmm by Anonymous Coward · · Score: -1, Offtopic

    Wouldn't this be a violation of DMCA?

  9. Re:What does this say about us? by Anonymous Coward · · Score: -1, Offtopic

    *ahem* diabetes is caused by your body developing 'tolerances' to things that break down sugars caused by eating too much sugars.

    Genetics can help determine where that tolerance lies, but in the end, someone that doesn't have sugars in great quantity can't get 98% of the diabetes cases in the world.

  10. Re:Genetic engineering & the media by Anonymous Coward · · Score: -1, Offtopic

    a) What if we are God? What if God is only the collective unconcious of all mankind?

    Then that would be God. Your point?

    b) Chaos theory implies that ANYTHING on earth affects the Earth. You know, the butterfly flapping its wings thing.

    If I take a shit in Morocco does it effect the price of tea in China?

    c) We have no technology to "wipe out" the Earth. We could very easily wipe ourselves off the earth but the very large mass that is Earth will keep on ticking (and probably heal very nicely without us).

    What about Win Xp? That's pretty devastating!

  11. Re:24? by Anonymous Coward · · Score: -1, Offtopic

    Ah, but the Y is MUCH MUCH shorter than the X. Men have less DNA than women, and are hence inferior

  12. Re:Comparison to mice chromosomes? by dillon_rinker · · Score: 2, Offtopic

    And this is where the animal rights activists do not get it...many have suggested that science has progressed to the point where test tube or computer models suffice, and animals do not need to be used. This completely ignores the fact that computers have not yet progressed to the state where we can model a single protein, and test tubes are not complete living systems.

    Though I'll grant that we don't need to pump rabbits full of mascara just to see HOW MUCH is toxic...

  13. Re:Quantum computing will simplify this stuff by renehollan · · Score: 1, Offtopic
    Organic computers dump their core?

    What a stinky way to crack encryption. But, I suppose someone has to do the dirty jobs.

    OffTopic: In Czech, "shit" is "hovono" (phonetically), and "to suck" is "tzUtzit" [hard U]. The machine that cleans out septic tanks, therefore, is colloquialy called a "hovono-tzUtz".

    --
    You could've hired me.
  14. Obligatory Dolphin Post by Anonymous Coward · · Score: -1, Offtopic

    Humans rule! Dolphins can suck it.

  15. And then what? by bluenirve · · Score: 0, Offtopic

    After they spend a ton of money (probably it'll be a ton in $100 bills) what's next? I've seen shows about a superior race... where they make a human how they want it. It would be very tall, strong, cute, smart, etc etc. But, what's the point? Will being turned into a race within a race with a superior race included also be good? Anyway, if this knowledge is used in the right way, what is there to do?