Slashdot Mirror

← Back to Stories (view on slashdot.org)

Celera Opens Up DNA Database

Posted by timothy on from the time-to-meet-the-ceo dept.

greenplato writes "Thirty billion base pairs from the sequences of humans, mice, and rats that were available only by subscription to Celera's DNA database are being put into the public domain. Celera will donate this information to a 'federally run database,' presumably GenBank. Francis Collins, head of the National Human Genome Research Institute, notes that 'data just wants to be public.' Stories in BusinessWeek and The New York Times."

3 of 181 comments (clear)

  1. from the summary by Anonymous Coward · · Score: 5, Funny

    Francis Collins, head of the National Human Genome Research Institute, notes that 'data just wants to be public.'

    Data hates when you anthropomorphize it.

  2. Oh No! by Anonymous Coward · · Score: 5, Funny

    They've open sourced me! Does this mean I have to call myself GNU/Steve?

  3. In case it gets slashdotted.... by MagicDude · · Score: 4, Funny

    Here's a copy of the data

    acgcggcgatgcgtacatagctagcgctgcatagatcgactatgacgatt atgactgatcggtagcatatattatgctatagctagcgtgtagctagtat cacatcagctactatgtagctacgatcgagcacactgactacgtagctag tagcggatcgatagctgatctgactgactatatatagcgcgcgatatata gcgcgtagatcgtagccgcgcgatgatatataaggagactgactagc...