Celera Opens Up DNA Database
greenplato writes "Thirty billion base pairs from the sequences of humans, mice, and rats that were available only by subscription to Celera's DNA database are being put into the public domain. Celera will donate this information to a 'federally run database,' presumably GenBank. Francis Collins, head of the National Human Genome Research Institute, notes that 'data just wants to be public.' Stories in BusinessWeek and The New York Times."
Francis Collins, head of the National Human Genome Research Institute, notes that 'data just wants to be public.'
Data hates when you anthropomorphize it.
They've open sourced me! Does this mean I have to call myself GNU/Steve?
Here's a copy of the data
t atgactgatcggtagcatatattatgctatagctagcgtgtagctagtat cacatcagctactatgtagctacgatcgagcacactgactacgtagctag tagcggatcgatagctgatctgactgactatatatagcgcgcgatatata gcgcgtagatcgtagccgcgcgatgatatataaggagactgactagc...
acgcggcgatgcgtacatagctagcgctgcatagatcgactatgacgat