Genetic Database Hits One Billion Entries

ChocSnorfler writes to tell us that the Sanger Institute is reporting that their Genetic Record Database has hit one billion entries, making it the world's largest. From the announcement: "The Trace Archive is a store of all the sequence data produced and published by the world scientific community, including the Sanger Institute's own prodigious output as a world-leading genomics institution. To grasp how much data is in the Archive, if it were printed out as a single line of text, it would stretch around the world more than 250 times. Printing it out on pages of A4 would produce a stack of paper two-and-a-half times as high as Mount Everest. The Archive is 22 Terabytes in size and doubling every ten months."

Comments

For God's sake, don't print it!

[BadAnalogyGuy]

Some dumbass is always printing 300 pages of documents and hogging the printer. Forchrissakes, just figure out what pages you need and print those! Asshole.

The amount of data here is really enormous. To put it in perspective, if you lined up 7143 blondes, the number of strands of hair present would approximately equal the number of entries in this database.

Re:For God's sake, don't print it!

[Anonymous Coward]

I love those things: "To put this in perspective, here's another image or figure that won't fit in the human mind either." They always clear those huge numbers right up for me.

At least your name is "BadAnalogyGuy", which gives you a better excuse than the story submitter.

Re:For God's sake, don't print it!

[margaret]

Some dumbass is always printing 300 pages of documents and hogging the printer. Forchrissakes, just figure out what pages you need and print those! Asshole.

Like when I was in grad school, I remember our IT guy was hopping mad because he had to come in on a sunday to reboot the server because some dumbass decided to print the entire mouse chromomome 22 sequence. Something about a spool file and crashing his server...

i love meaningless data

[JeanBaptiste]

"To grasp how much data is in the Archive, if it were printed out as a single line of text, it would stretch around the world more than 250 times. Printing it out on pages of A4 would produce a stack of paper two-and-a-half times as high as Mount Everest. "

I have twice that much data on my 128k thumbdrive, if printed out in 72 point font size.

Anyone care to translate this into volkswagens, or libraries of congress?

Re:i love meaningless data

[Snarfangel]

Anyone care to translate this into volkswagens, or libraries of congress?

I keep forgetting, how many Volkswagens to the Ferrari?

Re:i love meaningless data

[Frogbert]

No, but to put it in some perspective. It would take over 6 minutes for a japanese school girl to type it all out on her phone.

Re:i love meaningless data

[Brent Spiner]

If you choose a fixed-width font such as 12 point Courier about 75 letters fit on a single line with half inch margins. This means that each letter is about 2.54 millimeters in length. The earth is 24900 miles in circumference that means that it would take 15776640000 letters to stretch around the earth.

If we take a 1967 Volkswagen to be a measuremeant of length then it is 1606.01 times larger than a single letter so it would take 9823500.48 Volkswagi to tailgate around the earth. Multiply that by 250 and you get ~ 2.455875x10^9 Volkswagens.

Since it is quite easy to convert Volkswagens to Library of Congresses I won't go into further detail.

If printed out...

[MarkusQ]

if it were printed out as a single line of text, it would stretch around the world more than 250 times. Printing it out on pages of A4 would produce a stack of paper two-and-a-half times as high as Mount Everest

Did anybody else think "Wow, I've got a great idea for a mural for the space elevator!"

Anybody?

Uh, well, it's late...

--MarkusQ

Torrent?

[mendaliv]

Would somebody please torrent it?

A4 paper wouldn't work.

[suso]

Printing it out on pages of A4 would produce a stack of paper two-and-a-half times as high as Mount Everest.

You can't do that with ordinary A4 paper. You need to reinforce it on the sides at least so it won't tumble over. Plus, I doubt the paper would sit still with the high winds once it gets above a few thousand feet. Sheesh.

Re:22TB is nothing.

[TheSpoom]

I'm pretty sure storing humans on your hard drive is illegal.

Re:So tired. So very, very tired. Of that.

[jmv]

More nerdly examples, please.

- It would require 100,000 liters of ink to write down all the 1's and 0's
- It would take 400 years to transmit it over a 14.4 kbps modem
    * Requiring about 10 Giga Joules
- If each bit was encoded on a single hydrogen atom, the whold db would weight about 0.1 mg
- If ones are transmitted as a single (infrared) photon, it would take 0.01 Joules to transmit the whole db
    * You could transmit it 100 times with the energy of a mouse trap
- It would require about one year for a million monkeys to type it in (without having to guess)

So what?

[Anon.Pedant]

I'm not impressed. I already have genetic material all over my computer.

(Oops, did I just admit something bad?)

I've read the whole thing..

[tinrobot]

I won't give away the ending, but my favorite part is:

ctattggacttggaatcggatattggacacttggaatcggata

This could only be..

[musakko]

The Archive is 22 Terabytes in size and doubling every ten months.

Go FoxPro!

in other words...

[avi33]

All your base (pairs) belong to us.

Re:22TB is nothing.

[roesti]

I'm pretty sure storing humans on your hard drive is illegal.

Well, the HIAA keeps saying that, but the Digital Human Copyright Act (DHCA) is pretty vague.

In the meantime, you can still get the genetic layouts of other animals on eDonkey. (groan)