Genetic Database Hits One Billion Entries
ChocSnorfler writes to tell us that the Sanger Institute is reporting that their Genetic Record Database has hit one billion entries, making it the world's largest. From the announcement: "The Trace Archive is a store of all the sequence data produced and published by the world scientific community, including the Sanger Institute's own prodigious output as a world-leading genomics institution. To grasp how much data is in the Archive, if it were printed out as a single line of text, it would stretch around the world more than 250 times. Printing it out on pages of A4 would produce a stack of paper two-and-a-half times as high as Mount Everest. The Archive is 22 Terabytes in size and doubling every ten months."
Some dumbass is always printing 300 pages of documents and hogging the printer. Forchrissakes, just figure out what pages you need and print those! Asshole.
The amount of data here is really enormous. To put it in perspective, if you lined up 7143 blondes, the number of strands of hair present would approximately equal the number of entries in this database.
"To grasp how much data is in the Archive, if it were printed out as a single line of text, it would stretch around the world more than 250 times. Printing it out on pages of A4 would produce a stack of paper two-and-a-half times as high as Mount Everest. "
I have twice that much data on my 128k thumbdrive, if printed out in 72 point font size.
Anyone care to translate this into volkswagens, or libraries of congress?
if it were printed out as a single line of text, it would stretch around the world more than 250 times. Printing it out on pages of A4 would produce a stack of paper two-and-a-half times as high as Mount Everest
Did anybody else think "Wow, I've got a great idea for a mural for the space elevator!"
Anybody?
Uh, well, it's late...
--MarkusQ
Would somebody please torrent it?
I'm pretty sure storing humans on your hard drive is illegal.
It's better to vote for what you want and not get it than to vote for what you don't want and get it.
- E. Debs
More nerdly examples, please.
- It would require 100,000 liters of ink to write down all the 1's and 0's
- It would take 400 years to transmit it over a 14.4 kbps modem
* Requiring about 10 Giga Joules
- If each bit was encoded on a single hydrogen atom, the whold db would weight about 0.1 mg
- If ones are transmitted as a single (infrared) photon, it would take 0.01 Joules to transmit the whole db
* You could transmit it 100 times with the energy of a mouse trap
- It would require about one year for a million monkeys to type it in (without having to guess)
Opus: the Swiss army knife of audio codec
I'm not impressed. I already have genetic material all over my computer.
(Oops, did I just admit something bad?)
I won't give away the ending, but my favorite part is:
ctattggacttggaatcggatattggacacttggaatcggata