Slashdot Mirror


Encyclopedia of Life Launches First 30,000 Pages

An anonymous reader writes to let us know that the Encyclopedia of Life opened up to the public today with its first 30,000 pages in place — and, according to the AP, promptly crumbled even before being Slashdotted. (The site seems fine now.) We discussed this project last year when it was announced. The Telegraph has an overview of the launch, and reports that only 25 "exemplar" pages on the site are fully fleshed out to the extent scientists hope eventually to attain for all species; the other few tens of thousands are expanded placeholders. The project hopes to begin taking input from citizen-scientists late this year.

5 of 87 comments (clear)

  1. 30000 pages... by joaommp · · Score: 3, Interesting

    now that's going to take a long time to fill...

    I can see it now, like in wikipedia... about 1/10 of the articles are stubs... they mark it as stubs and no one ever remembers to fill them. I would fill them, problem is, I only found the stubs because I was actually searching for that information... not because I had it.

  2. ONLY 30000? by polar+red · · Score: 3, Interesting

    Only 30000?
    There are Tens of millions of different species on earth - Flowering plants ALONE are numbering 250000!
    there is another similar project called tree of life

    --
    Yes, I'm left. You have a problem with that?
    1. Re:ONLY 30000? by rucs_hack · · Score: 2, Interesting

      Well, I can cover several tens of millions of those species in one sentence:

      GGCAGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGC

      Specifically, a Core Promoter as shared by almost all Eukaryotes.

      Where each species differs by one or two characters. I guess you could work it out in terms of Hamming Distance..

  3. Download and license by oever · · Score: 5, Interesting

    So where can we download this data and what is the license?

    The data from tolweb.org are downloadable under a Creative Commons license.

    --
    DNA is the ultimate spaghetti code.
  4. citizen-scientists? by sm62704 · · Score: 2, Interesting

    WTF is a "citizen-scientist"? Isn't this encyclopedia on the internet? Then what country are these citizen-scientists citizens of? Aren't all scientists citizens of some country or another?

    Do you mean amateur scientists? Some people refuse to call a spade a spade, referring to it as a "pointy shovel", but you're calling it a "bonk-digger".

    --
    mcgrew's razor: Never attribute to stupidity that which can be explained by greedy self-interest