Slashdot Mirror

← Back to Stories (view on slashdot.org)

Wikipedia To Host Human Gene Repository

Posted by CmdrTaco on from the hope-i-can-anonymously-edit-it dept.

schliz writes "US scientists are developing a 'Gene Wiki' with the aim of fostering a flexible, organic archive of human genetic information. The project exists within Wikipedia, and is expected to speed up the process of deciphering genome sequences."

11 of 73 comments (clear)

  1. I saw it on Wikipedia by omnichad · · Score: 5, Funny

    It says that gene #45A79 controls glowing in the dark! It must be true!

    1. Re:I saw it on Wikipedia by voltel · · Score: 1, Funny

      It says that gene #45A79 controls glowing in the dark! It must be true!

      I for one welcome our new phosphorescent, dna-engineered overlords!

    2. Re:I saw it on Wikipedia by Anonymous Coward · · Score: 0, Funny

      Wow, how the hell did you ever come up with that one? Was it all on your own, by your lonesome? Genius, man. Pure fucking genius! I don't know how you do it. No one ever expects a "I for one welcome our $ADJECTIVES overlords" on Slashdot of all places! Ha ha ha, what a laugh riot! You douchebag.

    3. Re:I saw it on Wikipedia by voltel · · Score: 4, Funny

      Like we're fooled Anonymous Coward! Your just trying to make yourself look good after that epic fail!

  2. GATTA by BadAnalogyGuy · · Score: 3, Funny

    TAGGATTACACCT

    Yo Yo I gots my GAT
    rat a tat tat anotha nigga on his BAAACK

    Steve W sucks cock! lol!!!1

    16:04, 10 July 2008 86.75.30.9 (Talk) (3,808 bytes) (undo vandalism... maybe this shouldn't be a wiki)

  3. Re:Original research? by omnichad · · Score: 3, Funny

    Well...anyone can post a gene. That means more information, right? I've already made up 50.

  4. Re:Original research? by Dunbal · · Score: 1, Funny

    This is all backwards and wiki should know better. The site will be more popular with less jeans.

    --
    Seven puppies were harmed during the making of this post.
  5. Editing the Human Genome by D+Ninja · · Score: 5, Funny

    Heh. The type of graffiti that will be put on these sites should be good. I can see it now...

    Title: Bill Gates Genome
    ATATCGGCGCGCTAVISTASUCKSATGCGCCGCGCG

    Title: Linus Torvalds Genome
    ATTATATACGYAYOPENSOURCETAGCCGCGATCG

    Title: Cowboy Neal Genome
    ATATCGGCCGGCGCGCATTATATATAIVOTEDFORNEALCGTAATAT

  6. Re:What could possibly go wrong? by jesdynf · · Score: 3, Funny

    Well -- when you get right down to it, the human genome itself is full of errors, sloppiness, and outright sabotage, so I can't really think of a better host for it.

    --
    Yahoo! Pipes are awesome. How awesome? http://pipes.yahoo.com/jesdynf/slashdot
  7. Oh, no you don't! by Illbay · · Score: 3, Funny

    I just KNOW that every time I post my genetic information up there, some wise-a** leftist is gonna "correct" it to give me more "compassion," "understanding," and "desire to eat foreign cuisine."

    I'll be sitting there in my recliner watching The History Channel's week-long series on "Hitler's Secret Weapons" when I'm seized with an overwhelming desire to change the channel to "Oprah."

    The Left rules Wikipedia; I'll be d*mned if there gonna get at MY genome!

    --
    Any technology distinguishable from magic is insufficiently advanced.
  8. Re:Original research? by Insightfill · · Score: 4, Funny

    Should we start a pool on how quickly the project is tagged for speedy deletion due to lack of noteability?

    Should we perhaps call it a gene pool?