Slashdot Mirror

← Back to Stories (view on slashdot.org)

Wikipedia To Host Human Gene Repository

Posted by CmdrTaco on from the hope-i-can-anonymously-edit-it dept.

schliz writes "US scientists are developing a 'Gene Wiki' with the aim of fostering a flexible, organic archive of human genetic information. The project exists within Wikipedia, and is expected to speed up the process of deciphering genome sequences."

4 of 73 comments (clear)

  1. I saw it on Wikipedia by omnichad · · Score: 5, Funny

    It says that gene #45A79 controls glowing in the dark! It must be true!

    1. Re:I saw it on Wikipedia by voltel · · Score: 4, Funny

      Like we're fooled Anonymous Coward! Your just trying to make yourself look good after that epic fail!

  2. Editing the Human Genome by D+Ninja · · Score: 5, Funny

    Heh. The type of graffiti that will be put on these sites should be good. I can see it now...

    Title: Bill Gates Genome
    ATATCGGCGCGCTAVISTASUCKSATGCGCCGCGCG

    Title: Linus Torvalds Genome
    ATTATATACGYAYOPENSOURCETAGCCGCGATCG

    Title: Cowboy Neal Genome
    ATATCGGCCGGCGCGCATTATATATAIVOTEDFORNEALCGTAATAT

  3. Re:Original research? by Insightfill · · Score: 4, Funny

    Should we start a pool on how quickly the project is tagged for speedy deletion due to lack of noteability?

    Should we perhaps call it a gene pool?