Slashdot Mirror
Review of Discovery Institute's Evolution Textbook
Darwinned writes "Intelligent Design is still a hot topic, as evidenced by recent legislation mandating that it be taught in school. Pro-ID group Discovery Institute has released an evolution textbook for use in schools, but a review shows it to be chock full of bad science and questionable reasoning. 'The book doesn't only promote stupidity, it demands it. In every way except its use of the actual term, this is a creationist book, but its authors are expecting that legislators and the courts will be too stupid to notice that, or to remember that the Supreme Court has declared teaching creationism an unconstitutional imposition of religion.'"
The grandparent was probably referring to Edwards v. Aguillard.
I read the internet for the articles.
Darwin's Black Box was shown to be wrong in the Dover trial. Behe's central premise that things are irreducibly complex was proven wrong both with hard scientific data (about the flagella being irreduceably complex, but the bacterial Type III secretory system has a subset of the parts, though they serve a different function) and logically (Behe says a mousetrap is irreducibly complex, but it is useful as a tie clip if you remove two key parts).
The judge in the Dover trial summed it up by saying:
WTF are you talking about? ... ? Random number generators? Do you have an alternate explanation for Polymerase Chain Reaction? Well then, if you agree with DNA sequencing, how do you explain that everything we sequence fits just right with evolutionary theory?
Why do you think Evolution is on less solid grounds than, say, quantum theory or heliocentrism?
For heliocentrism, we have probes and satellites taking nice pictures.
For evolution, we have fossils backed by geology, chemistry, atomic physics and so on; we also have ****DNA*** fucking SEQUENCING. Where do you think biologist get those ATTAACGGGCGTGTAAGGCGTGAAA
Evolution is much more obvious than most of quantum physics or relativity. Do you also have an opinion about frame dragging or black body radiation? What about tunnel effect?
What does your bible (or whatever source of superstition is it you use) say about the wave-particle duality? Isn't THAT weirder than natural selection? C'm'on, genes mutate and unfit individuals don't get to reproduce. That's straightforward. But Hawking's radiation? The Standard Model? Is more or less problematic to you than the evolution of species by the means of natural selection?
And we both agree that alchemy shouldn't be taught in the classroom, are you going to ask that chemistry, too, be withheld? What about astrology and astronomy?
The Riddle of Epicurus
~~~~~~~~~~~~~
If God is willing to prevent evil, but is not able to
Then He is not omnipotent.
If He is able, but not willing
Then He is malevolent.
If He is both able and willing
Then whence cometh evil?
If He is neither able nor willing
Then why call Him God?
~~~~~~~~~~~~~~
Back on topic, the Discovery institute is dedicated solely to enriching its members, any other claim is nonsense.
A learning experience is one of those things that say, 'You know that thing you just did? Don't do that.' - D. Adams
Just like gravity
False
Citation needed
What's unconstitutional is putting it into the science curriculum at public schools (violating the establishment clause of the first amendment). As far as "forcing people to teach ____," all public school curriculum is "forced" on teachers in the sense that it is established at the state and local government level.
Piyush Jinda, Governor of Louisiana (George Bush with a funny name, if you ask me) is trying to sneak this shit right back in.
Louisiana: Last on the good lists, first on the bad lists, and determined to keep it that way.
I can say that because I'm a rare escapee from that temple to ignorance. Still, it's a lot of fun to visit the Bayou State.
From the summary:
It's only a hot topic here in the United States. In the rest of the civilized world, ID is dismissed as the nonsense it is.
This ain't rocket surgery.
I'm not sure how best to explain it so I'll try with a simple example.
Let's say the structure you're trying to evolve can be represented as ABC. The letters are different parts. Together, ABC performs some useful function. Maybe it senses light, or moves the organism, or converts energy. Doesn't matter.
Now imagine that AB and BC are both useless constructs. The stance of the IDers is that ABC would have to evolve from constituent parts, by starting with one letter and adding more until ABC is achieved. But, they claim, since both AB and BC are useless, they would never evolve, and so ABC could never come to be. Therefore, the existence of ABC in an organism is, essentially, proof that God Did It.
However, imagine if C is some sort of useful construct all by itself. The actual function of C could be completely different from the function of ABC, it just has to be useful in some fashion. Then we add D, another part which is not part of ABC, to form CD. Imagine that CD is also useful in some manner, potentially related to C, potentially not. Then B is added which gives it more of a useful function, so organisms have the useful construct BCD. Then A is added to give the final functionality in the more complex form of ABCD. Then D, being redundant, is eventually dropped from the organism. Therefore you have evolved the useful and "irreducibly complex" construct ABC from parts.
If you mod me Overrated, you are admitting that you have no penis.
All the YEC apologists I've encountered believe in a deity who is incapable of deception. Their deity didn't make the world appear old even though it was young, they believe the earth IS young and all the science we rely upon is flawed.
The Pastafarians are the ones who claim the earth is young, but the FSM made it appear old.
Learn something new.
> Now think about what happened when they let the conservative religious crazies take control.
Methinks history betrays you.
The Wahabbi extremists (Islamic versions of the US fundamentalist extremists) came to power with ibn Saud, in the 18th century.
Economic power (and scientific luminance) seeped away from the Caliphates and kingdoms of the Levant when the sea routes were broken open, most notably and astoundingly at Lepanto.
If memory serves me correct, Behe's books were completely and utterly shredded in the recent Kansas court case.
I doubt you will, but you can start your reading here:
http://www.talkorigins.org/faqs/behe.html
.there is enough of everything for everyone.