DNA-Radio, Tune In To Your Chromosomes

An anonymous reader writes "The folks behind the DNA-Rainbow project (discussed on Slashdot before) apparently have some time to play around with genome data. After creating amazing pictures from the human DNA code they are now transforming all chromosomes to audio and streaming them to the Internet. Every base is read and broadcasted instead converting it to a color. Seemingly this artistic project will last a while. After some math they found out that it will take them more than 23.5 years to air the whole human genome sequence."

Comments

CCCCCAGCAAGCCCA

[Praedon]

I for one welcome our robotic chromosome reader overlord. Cause it's going to know everything about our DNA, so it's important to n... CCCCCCAAGGCCCCAACCCAAAACCCCGGCCGGTCCATTCAA

Re:CCCCCAGCAAGCCCA

[gravos]

Your comments are pure CACA you GAT! You have as much TACT and a rubber CAT with a GATTACA TAT.

Re:Nice.

[dwywit]

Hence - all your base are belong to us!

Re:This project is overrated. - Modem hacked genes

[Anonymous Coward]

Bring the 14.4 modem out of the closet and demodulate the audio sequence data.

Then, when you've got the entire code backed up locally, sue them for releasing
sensitive medical data over the internet without authorization.

Step 4: profit.

Little do we know...

[gsmalleus]

It is actually just some kid with a broken Speak & Spell.

Re:This project is overrated.

[Anonymous Coward]

Do you realize that the value in those patterns enables you to use a computer and write that?

Seriously, I heard a great pattern

CCAAAAA
CCCTAGT
TCAGTCA
GATTACA
GATTACA
GATTACA
GATTACA
CGAAACT

Re:This project is overrated.

[zygotic mitosis]

This sounded great on my guitar until I came to the T chord.