New Antibody Attacks 99% of HIV Strains (bbc.com)
An anonymous reader quotes a report from BBC: Scientists have engineered an antibody that attacks 99% of HIV strains and can prevent infection in primates. It is built to attack three critical parts of the virus -- making it harder for HIV to resist its effects. The work is a collaboration between the US National Institutes of Health and the pharmaceutical company Sanofi. Our bodies struggle to fight HIV because of the virus' incredible ability to mutate and change its appearance. These varieties of HIV -- or strains -- in a single patient are comparable to those of influenza during a worldwide flu season. So the immune system finds itself in a fight against an insurmountable number of strains of HIV. But after years of infection, a small number of patients develop powerful weapons called "broadly neutralizing antibodies" that attack something fundamental to HIV and can kill large swathes of HIV strains. Researchers have been trying to use broadly neutralizing antibodies as a way to treat HIV, or prevent infection in the first place. The study, published in the journal Science, combines three such antibodies into an even more powerful "tri-specific antibody." The experiments conducted on 24 monkeys showed none of those given the tri-specific antibody developed an infection when they were later injected with the virus. "We're getting 99% coverage, and getting coverage at very low concentrations of the antibody," said Dr Gary Nabel, the chief scientific officer at Sanofi and one of the report authors.
If it doesnâ(TM)t have 100% coverage that means escape mutations are feasible and therefore it will be useless. Basically the antibody needs to be effective against any 6 simultaneous SNPs in the viral genome.
That means if the initial virus DNA sequence is (for example) tgagcagattcgctggtacgatgacgtactaa
if the virus can escape with a sequence of
tgaccagattcgcaggtacgatgacggactaa (five letters have been changed in specific locations). That is no good, because HIV usually has a mutation every few times it copies itself. Since there are trillions of HIV replicating every few seconds in an infected person, it is not mathematically infeasible for one of the HIV replicants to get lucky and have the required 6 mutations for it to escape.
I know a couple of people who have lived for decades with HIV. Both are hemophiliacs and got the virus before there was testing of the blood supply. They both lived in the same region of the US and caught the virus about the same time. They have to take tons of medicines to stay alive and they're already being treated for hemophilia, so it sucks for them. If they can finally get cured, that would be great. They're really good people.
It sounds like this new antibody works a little bit like the various treatments they have for Hepatitis C. There are multiple genotypes of HepC and not all the drugs work for all the genotypes, but the medicines interfere with some protein or something and causes the HepC virus to not be able to "hide" from the immune system and it just ends up getting killed off. Completely. A disease that until 2014 couldn't be cured now has a treatment that is 90% effective. One pill a day for 12 to 24 weeks and virtually no side effects. And done. Cure. Completely. Unfortunately it costs like a quarter-million dollars so insurance companies won't let you have the treatment without a fight. They will first say no unless you have at least Stage 4 fibrosis (the stage before your liver starts dying), and then they make you jump through hoops and get multiple blood tests and ultrasounds and sometimes even liver needle biopsies (which actually damage the liver). Then, they'll deny you one more time hoping to run out the clock until you die. But if you have a good GI doctor, he'll go to bat for you and keep sending the prescription until it gets approved.
To give you an idea how stupid our insurance-based system is, it's not even the insurance company that's denying you. It's a company that the insurance company hires called a "Pharmacy Benefits Manager" who are even harder to deal with than the insurance company. Then, they'll do completely random things like force you to use a different specialty pharmacy to get the meds (because you can't get these meds at your regular Walgreens, you have to go through a specialty pharmacy who will deliver the drugs to you, because every bottle of 30 pills is worth like $60,000. It's all really stupid. In Canada, the treatment is a small fraction of the cost. In India, it costs about $400 (but medical tourism doesn't work because the pharma companies have cut a deal with the Indian government to require people to show an Indian passport before they can receive the medication).
I know all this because a musician I play with on a regular basis had HepC. He was getting sicker and sicker and my wife and I helped him a lot dealing with the insurance companies and pharmacy benefits managers and special pharmacies. The freaking medicine acted remarkably fast. Within 4 weeks, a guy who had been positive for HepC for 25 years was coming up negative for the virus on his blood tests. He felt better after only a few weeks. After 24 weeks, he was done. After another few months, he was tested, still negative. Since the liver regenerates, within 8 months, his fibrosis had gone from level 4 to level 3 to 2 and is now at level 1. Yes, it cost the insurance company a couple hundred grand (although it really didn't because the pharma companies make special deals with them where it only really costs a few grand) but it's still a LOT less than a liver transplant, which he would have needed eventually, or liver cancer treatment, which sucks really bad.
I'm sorry to write this long story, but a cure is a cure. I hope eventually they can cure HIV as easily as they can now cure HCV. And if you're a baby boomer or Gen Xer, you should get tested for HepC the next time you get blood drawn. You don't want to wait until your symptomatic to find out you got it.
You are welcome on my lawn.
So the first reports of AIDS started coming in a bit over 30 years ago. Ever since it was identified, and linked strongly with homosexual males, we've heard one preacher, imam and rabbi after another tell us how AIDS is a punishment from god visited upon a segment of humanity that richly deserves to die.
Well, I guess we've got some bad news for god. In just two generations...less time than a lot of the punishments god metes out (remember "even unto the third generation"?), we've pretty much got AIDS under control, maybe even cured.
So two possibilities: either god doesn't really care all that much about a mutual dick-sucking every now and again, or maybe...just maybe...god doesn't exist.
Either way, it's all good for rational people. I'll be waiting with bated breath to hear Pat Robertson explain how just a few people working for much less than a human lifetime managed to take this god-mandated death sentence for gays and turn it into a non-issue.
I can't help but wonder what the next failure of religion will be when it attempts to contradict science.
I've calculated my velocity with such exquisite precision that I have no idea where I am.
The major problem with HIV is that it's a retrovirus. It inserts itself into the DNA of immune cells and then stays dormant (sometimes for years) until the cells are stressed, so simply clearing the virus from blood plasma is not enough. Modern anti-retrovirals can eliminate every single live virus particle but they can't touch the reservoir of dormant virus.
Scientists are now looking at various gene-editing tools to get after it, like RNAi- or CRISPR-based therapies. It's not easy because the virus mutates easily but there's some hope.
If these guys cure HIV they must surely get the Nobel prize for medicine.
== Jez ==
Do you miss Firefox? Try Pale Moon.