Slashdot Mirror
New Antibody Attacks 99% of HIV Strains (bbc.com)
An anonymous reader quotes a report from BBC: Scientists have engineered an antibody that attacks 99% of HIV strains and can prevent infection in primates. It is built to attack three critical parts of the virus -- making it harder for HIV to resist its effects. The work is a collaboration between the US National Institutes of Health and the pharmaceutical company Sanofi. Our bodies struggle to fight HIV because of the virus' incredible ability to mutate and change its appearance. These varieties of HIV -- or strains -- in a single patient are comparable to those of influenza during a worldwide flu season. So the immune system finds itself in a fight against an insurmountable number of strains of HIV. But after years of infection, a small number of patients develop powerful weapons called "broadly neutralizing antibodies" that attack something fundamental to HIV and can kill large swathes of HIV strains. Researchers have been trying to use broadly neutralizing antibodies as a way to treat HIV, or prevent infection in the first place. The study, published in the journal Science, combines three such antibodies into an even more powerful "tri-specific antibody." The experiments conducted on 24 monkeys showed none of those given the tri-specific antibody developed an infection when they were later injected with the virus. "We're getting 99% coverage, and getting coverage at very low concentrations of the antibody," said Dr Gary Nabel, the chief scientific officer at Sanofi and one of the report authors.
Woohoo!
This will be buried and never heard of again
Back in the day I could look forward to interesting comments discussing how this works, its shortcomings and how we might overcome them. Today I expect to see nothing but racist and political trolls.
Prove me wrong. Please.
Welcome to common core math, folks!
Still waiting on Serviscope_minor to wake up to fucking reality and realize that Jessica Price isn't going to fuck him.
If it doesnâ(TM)t have 100% coverage that means escape mutations are feasible and therefore it will be useless. Basically the antibody needs to be effective against any 6 simultaneous SNPs in the viral genome.
That means if the initial virus DNA sequence is (for example) tgagcagattcgctggtacgatgacgtactaa
if the virus can escape with a sequence of
tgaccagattcgcaggtacgatgacggactaa (five letters have been changed in specific locations). That is no good, because HIV usually has a mutation every few times it copies itself. Since there are trillions of HIV replicating every few seconds in an infected person, it is not mathematically infeasible for one of the HIV replicants to get lucky and have the required 6 mutations for it to escape.
of the strains they tried, but due either to lack of access to a sample, or other known factors, that 1% of HIV virus types would not be affected be these particular antibodies.
I don't remember exact amounts, but there are as many or more kinds of HIV than there are HPV, which is to say there are a lot of variations, not all of which may attack the same binding points.
HA take that aids
The antibodies are GMOs - engineered, get it? And GMOs are bad, right?
will never allow this to be approved since it cuts into profits. I have IBS, and I've read about probably a dozen different promising treatments, but none of them have been approved for use in the US. Our entire system is centered around making money for doctors instead of helping the people.
Another story about the one-percenters.
#DeleteChrome
I know a couple of people who have lived for decades with HIV. Both are hemophiliacs and got the virus before there was testing of the blood supply. They both lived in the same region of the US and caught the virus about the same time. They have to take tons of medicines to stay alive and they're already being treated for hemophilia, so it sucks for them. If they can finally get cured, that would be great. They're really good people.
It sounds like this new antibody works a little bit like the various treatments they have for Hepatitis C. There are multiple genotypes of HepC and not all the drugs work for all the genotypes, but the medicines interfere with some protein or something and causes the HepC virus to not be able to "hide" from the immune system and it just ends up getting killed off. Completely. A disease that until 2014 couldn't be cured now has a treatment that is 90% effective. One pill a day for 12 to 24 weeks and virtually no side effects. And done. Cure. Completely. Unfortunately it costs like a quarter-million dollars so insurance companies won't let you have the treatment without a fight. They will first say no unless you have at least Stage 4 fibrosis (the stage before your liver starts dying), and then they make you jump through hoops and get multiple blood tests and ultrasounds and sometimes even liver needle biopsies (which actually damage the liver). Then, they'll deny you one more time hoping to run out the clock until you die. But if you have a good GI doctor, he'll go to bat for you and keep sending the prescription until it gets approved.
To give you an idea how stupid our insurance-based system is, it's not even the insurance company that's denying you. It's a company that the insurance company hires called a "Pharmacy Benefits Manager" who are even harder to deal with than the insurance company. Then, they'll do completely random things like force you to use a different specialty pharmacy to get the meds (because you can't get these meds at your regular Walgreens, you have to go through a specialty pharmacy who will deliver the drugs to you, because every bottle of 30 pills is worth like $60,000. It's all really stupid. In Canada, the treatment is a small fraction of the cost. In India, it costs about $400 (but medical tourism doesn't work because the pharma companies have cut a deal with the Indian government to require people to show an Indian passport before they can receive the medication).
I know all this because a musician I play with on a regular basis had HepC. He was getting sicker and sicker and my wife and I helped him a lot dealing with the insurance companies and pharmacy benefits managers and special pharmacies. The freaking medicine acted remarkably fast. Within 4 weeks, a guy who had been positive for HepC for 25 years was coming up negative for the virus on his blood tests. He felt better after only a few weeks. After 24 weeks, he was done. After another few months, he was tested, still negative. Since the liver regenerates, within 8 months, his fibrosis had gone from level 4 to level 3 to 2 and is now at level 1. Yes, it cost the insurance company a couple hundred grand (although it really didn't because the pharma companies make special deals with them where it only really costs a few grand) but it's still a LOT less than a liver transplant, which he would have needed eventually, or liver cancer treatment, which sucks really bad.
I'm sorry to write this long story, but a cure is a cure. I hope eventually they can cure HIV as easily as they can now cure HCV. And if you're a baby boomer or Gen Xer, you should get tested for HepC the next time you get blood drawn. You don't want to wait until your symptomatic to find out you got it.
You are welcome on my lawn.
Our medical system has plenty of faults, but crazy conspiracy theories are not involved. If there was a conspiracy by big medical companies to hide cures because they make more money treating, then explain the following:
[a] The elites ALWAYS carve-out exscape hatches for themselves. Just look at Al Gore and friends who rant about Climate Change and demand the public change their use of energy etc - while THEY sail super-yachts, fly private jets to conferences at exotic vacation spots, own many glorious power and resource-sucking mansions and so forth and claim to be making up for it by buying "offsets" (google: indulgences and corrupt popes). Rich elite lawmakes put taxes on sodas and limit table salt (which affect middle-class and poor folks) but they do nothing about their expensive and fattening and salt and sugar-laden foods and beverages. Somehow, however, executives of big medical firms and their family members suffer the same diseases and unhappy demises as the rest of us.
[b] Big entities cannot keep secrets. There are always insiders who are opposed to a policy, or who see an injustice, or are personally affected, or see a hypocrisy they despise, or who want to puff-up their credentials with friends or relatives who end-up leaking stuff. Where are the current or former "insiders" who are publicly outraged to be ill or dying or have sick or dying family members who are blowing the whistle on the particular executives who are hiding these magical mystery cures while making sure they themselves and their kin have access to those cures?
The simple FACT is that human beings are remarkably complex biological machines. An individual blood cell is frighteningly complicated and not fully-understood nor human-engineerable. Bone cells, kidney cells, liver cells etc are all similarly brain-bending in complexity and when you gang all of these together into a complex creature and then add-in a virus - well I personally am impressed by ANY drug advance. When you consider how difficult it is to find ANY new medicine, add-in the idea that we have probably discovered all the "easy" to discover drugs, then consider the enourmous resources to find a new drug and clear the massive pile of government regulations to get a drug approved, it's even more amazing ANY drug advance is possible.
Oh, I personally have a chronic illness and have experienced the annoyance of hearing about "breakthroughs" periodically and seeing nothing that helps ME, while also having a family member with a very serious illness who is currently involved as a subject in a drug trial program. If you ever find yourself in that tough spot and are a good candidate to be a test subject, DO IT. It may be very unpleasant and painful and embarassing and lots of other stuff and my do nothing for YOU but your participation could eventually contribute to a new drug or a better understanding and thus save or improve the lives of an uncountable number of people. Imagining conspiracies that do not exist only makes people hostile and bitter; it does NOTHING to improve the condition of any human being and is a completely self-centered non-productive waste of human energy.
It is included
It's included for blood donation, but what I'm saying is it should be included in regular blood work. I've heard that as many as 10% of certain age groups might be infected.
You are welcome on my lawn.
Not saying I know fuck-all. Isn't there a good chance that the 1 percent that isn't finished off will become the new 99 percent?
So the first reports of AIDS started coming in a bit over 30 years ago. Ever since it was identified, and linked strongly with homosexual males, we've heard one preacher, imam and rabbi after another tell us how AIDS is a punishment from god visited upon a segment of humanity that richly deserves to die.
Well, I guess we've got some bad news for god. In just two generations...less time than a lot of the punishments god metes out (remember "even unto the third generation"?), we've pretty much got AIDS under control, maybe even cured.
So two possibilities: either god doesn't really care all that much about a mutual dick-sucking every now and again, or maybe...just maybe...god doesn't exist.
Either way, it's all good for rational people. I'll be waiting with bated breath to hear Pat Robertson explain how just a few people working for much less than a human lifetime managed to take this god-mandated death sentence for gays and turn it into a non-issue.
I can't help but wonder what the next failure of religion will be when it attempts to contradict science.
I've calculated my velocity with such exquisite precision that I have no idea where I am.
The Great Dr.OLIHA herbal medicine is a good or perfect cure remedy for HIV Virus, I was diagnose of HIV for almost 5 years, everyday i am always on research looking for a perfect way to get rid of this terrible disease as i always knew that what we need for our health is right here on earth though the scientist say there is know cure for this disease,on my search I saw some different testimony on how Dr. OLIHA has been able to cure HIV with is herbal medicine. I decided to contact this man, I contacted him and he guided me on how to purchase for the medicine. I asked him for solutions and he started the remedies for my health. Thank God, now everything is fine, I’m cured by Dr. OLIHA herbal med icine, I’m very grateful to Dr. OLIHA, reach him now on (oliha.miraclemedicine@gmail.com ) or you can also call him on +2349038382931. Dr. OLIHA Also Cures: 1. HIV/AIDS 2. HERPES 1/2 3. CANCER 4. ALS (Lou Gehrig’s disease) 5. Hepatitis B 6. chronic pancreatic 7. Emphysema 8. COPD (Chronic Obstructive Pulmonary Disease) 9. Asthma 10.Acute angle-closure Glaucoma 11. Diabetes 12.CHRONIC PANCREATIC 13.CHLAMYDIA 14.ZIKA VIRUS
it's FREE!
There is literally NO OTHER nasty human disease we can as easily wipe out in any one single generation.
We could have ended the AIDS epidem in in the eighties for free and before MILLIONS of human beings DIED from it.
All we need is for ONE GENERATION to not use IV-Drugs recreationally and not engage in sex with anybody other than their heterosexual spouse.
That's it. Save millions of future lives for FREE. Hell, after HIV/AIDS would be eliminated, even the drug use and reckless sex could come back probably for a few decades before some idiot stumbled upon another source in some isolated corner of the planet and dragged it back into the general population. This is not some puritanical plan - it's the ONE known and guaranteed and free solution. In the '80s, sadly, we found out that bath houses (which health officials begged to temporarily close) and irresponsible promiscuity were more important to certain poltitical groups than the lives of millions.
The alternative is to keep hoping for a cure to a virus - something human being have never yet achieved.
I had to specifically ask for HepC in my std screening. If you go into a Dr and just ask to get full std screening, they more than likely won't include HepC. I've had quite a few by this point in my life.. it wasn't in any of them unless asked. I realize that's slightly off topic since the OP was referring to blood donations but it really should be in std screening.
Now we can get back to unprotected sex, needle sharing and no blood screens.
The major problem with HIV is that it's a retrovirus. It inserts itself into the DNA of immune cells and then stays dormant (sometimes for years) until the cells are stressed, so simply clearing the virus from blood plasma is not enough. Modern anti-retrovirals can eliminate every single live virus particle but they can't touch the reservoir of dormant virus.
Scientists are now looking at various gene-editing tools to get after it, like RNAi- or CRISPR-based therapies. It's not easy because the virus mutates easily but there's some hope.
You are remembering a Slashdot that never existed. This site has an undercurrent of trolls since the late 1990's. It's been a part of this site for perhaps longer than you've been lurking here. If you haven't figured out what sort of back alley graffiti we typically get here yet stuck around for years to reminiscence about the good old days, then shame on you.
If these guys cure HIV they must surely get the Nobel prize for medicine.
== Jez ==
Do you miss Firefox? Try Pale Moon.
This is about the 10th time they've cured AIDS/HIV just in Slashdot's reporting. This is solar panel and battery efficiency all over again. I think both are at about 105% efficiency cumulatively. Why is HIV still a thing now?
Just like anything else that 'cures'. It seems like this same kind of thing happens.
Some research comes up with something that attacks aids/hiv/cancer/whatever... shows to be a promising treatment/potential cure... and then... nothing. We never hear anything further about it. It never reaches human trials. It just, vanishes from all news.
They can proceed to buttfuck each other with impunity.
God will now not only punish them there Qeeeayars, but the people who took away God's divine and loving punishment for them.
But seriously, this is pretty good news.
The shepherds did so well protecting the flock that the sheep no longer believed that wolves existed.
...at what point does a man just stop and say "you know, I think I'd like to have a dick up my ass!"
buy now
And guess what, I'm glad I'm not a faggot.
How great to see this news. I am really hopeful about this https://williamreview.com/3-ma...
http://williamreview.com/