Slashdot Mirror


New Antibody Attacks 99% of HIV Strains (bbc.com)

An anonymous reader quotes a report from BBC: Scientists have engineered an antibody that attacks 99% of HIV strains and can prevent infection in primates. It is built to attack three critical parts of the virus -- making it harder for HIV to resist its effects. The work is a collaboration between the US National Institutes of Health and the pharmaceutical company Sanofi. Our bodies struggle to fight HIV because of the virus' incredible ability to mutate and change its appearance. These varieties of HIV -- or strains -- in a single patient are comparable to those of influenza during a worldwide flu season. So the immune system finds itself in a fight against an insurmountable number of strains of HIV. But after years of infection, a small number of patients develop powerful weapons called "broadly neutralizing antibodies" that attack something fundamental to HIV and can kill large swathes of HIV strains. Researchers have been trying to use broadly neutralizing antibodies as a way to treat HIV, or prevent infection in the first place. The study, published in the journal Science, combines three such antibodies into an even more powerful "tri-specific antibody." The experiments conducted on 24 monkeys showed none of those given the tri-specific antibody developed an infection when they were later injected with the virus. "We're getting 99% coverage, and getting coverage at very low concentrations of the antibody," said Dr Gary Nabel, the chief scientific officer at Sanofi and one of the report authors.

149 comments

  1. With cautious optimism by Anonymous Coward · · Score: 1

    Woohoo!

  2. This will be buried and never heard of again by Anonymous Coward · · Score: -1

    This will be buried and never heard of again

    1. Re:This will be buried and never heard of again by jellomizer · · Score: 1

      Being that AIDS in wealthier countries is no longer the epidemic that it use to be, this is due to a lot of advancements in medical technology, where the HIV virus can be managed. Shows there has been progress in fighting the virus.
      Dating myself a bit, but I remember when the Basketball Star Magic Johnson was reported to have HIV back in the early 1990's people assumed he had only a few years left to live, and countries boycotted playing against him during the Olympics. He is still around and healthy except for the HIV Virus which he will need to manage.

      Back in the 1980's and 1990's HIV was mostly considered a death sentence, now it is more of a chronic condition which needs to be managed and safeguards to prevent it from spreading. This is progress, However we are past the Polio and Small Pox phases of medicine where you can just take a pill or get a shot and you are protected. So the progress now is incremental, and chances this drug may be effective but not for all people, and perhaps not forever.
       

      --
      If something is so important that you feel the need to post it on the internet... It probably isn't that important.
    2. Re:This will be buried and never heard of again by Hognoxious · · Score: 1

      Dating myself a bit

      That's pretty common round here.

      Good thing too - you're unlikely to catch anything that way.

      --
      Confucius say, "Find worm in apple - bad. Find half a worm - worse."
    3. Re:This will be buried and never heard of again by Anonymous Coward · · Score: 0

      Friction burns can get infected.

    4. Re:This will be buried and never heard of again by Moblaster · · Score: 1

      "we are past the Polio and Small Pox phases of medicine" Not following here... medicine is only getting more powerful and advanced. Medical science barely knew what bacteria were let alone viruses were when cures for these diseases were developed. Progress may appear incremental now but these diseases are being targeted at the microbiological level, which involves a whole new set of techniques. It looks incremental but the quantum leap of complete eradication of transmissible disease is around the corner, based on advanced techniques that were impossible even two decades ago. Might be a decade or two but soon it will effectively be impossible for transmissible diseases to escape the jaws of technological progress.

    5. Re:This will be buried and never heard of again by lessthan · · Score: 1

      He just meant that the low hanging apples have been picked. You, of course, are talking about designing ladders.

      --
      Space Shuttle was a program that strapped humans to an explosion and tried to stab through the sky with fire and math
    6. Re:This will be buried and never heard of again by MercTech · · Score: 1

      Back in the 80s when the military was being told that HIV was 100 percent fatal in ten years and had a 25% transmission rate (much higher than the common cold); I was told to sit down and shut up when I opined that we would more likely find a portion of the population would be found to be carriers but asymptomatic and some people would have a natural immunity and the fatality rate would taper off when information was in hand.
              A vaccine for a rapidly modifying virus, such as HIV or influenza, is quite problematic. I'm glad to see someone is making some progress.
              As to the "it's a faggot disease" crowd; I was happy to find out the Dental Technician I served with in the Navy was still around and on his 26th year of antivirals to keep his HIV infection under control. He was bitten by a patient. No longer able to care for patients, he works in a prosthodontic lab making crowns and dentures. He made the crown I had put in last year and sent a note for me to call along with the tooth sent to my dentist. I had a sphincter tightening 18 months after responding to an accident and getting blood all the way up to my elbows and sprayed into my face from a girl we later found was HIV positive. Back in the 80s; they wouldn't declare you free of infection until they had three tests negative taken six months apart in addition to an initial negative test. A nurse I knew in the service died of HIV contracted by an inadvertent needle stick caused by a recalcitrant ER patient. Even if the majority of documented cases are from gay men; it ain't a faggot disease.

      --
      NRRPT/RCT
  3. Slashdot is Dead by Anonymous Coward · · Score: -1

    Back in the day I could look forward to interesting comments discussing how this works, its shortcomings and how we might overcome them. Today I expect to see nothing but racist and political trolls.

    Prove me wrong. Please.

    1. Re:Slashdot is Dead by phantomfive · · Score: 2

      The summary is very understandable......I know it's uncomfortable to read the summary, though. Would you like me to copy and past it down in a comment so you don't have to make the effort to scroll up a bit?

      --
      "First they came for the slanderers and i said nothing."
    2. Re:Slashdot is Dead by Anonymous Coward · · Score: -1

      These new antibodies won't bring headphone jacks back to the iPhone, so I'm not interested.

    3. Re:Slashdot is Dead by Anonymous Coward · · Score: -1

      Faggots will still die from AIDS so at least something good will happen.

  4. 0 out of 24 = 99% by Khyber · · Score: -1, Flamebait

    Welcome to common core math, folks!

    --
    Still waiting on Serviscope_minor to wake up to fucking reality and realize that Jessica Price isn't going to fuck him.
    1. Re:0 out of 24 = 99% by msauve · · Score: 4, Funny

      "The experiments conducted on 24 monkeys"

      When did that movie sequel come out?

      --
      "National Security is the chief cause of national insecurity." - Celine's First Law
    2. Re:0 out of 24 = 99% by Anonymous Coward · · Score: -1

      Speaking of monkeys with AIDS, it's Khyber everybody!

    3. Re:0 out of 24 = 99% by PerlPunk · · Score: 4, Informative

      Welcome to core Statistics.

      This would have to be a randomized controlled experiment, and the confidence interval being tested would be 99%. What this means in frequentist statistical terms is that if you had 100 test subjects, and out of those you would expect for whatever reason one of those would somehow turn up positive, then you would still be within your 99% confidence interval. More formally stated, the true population mean is somewhere greater than the 2.5th percentile and less than the 99.5th percentile of the the distribution of the values in your samples.

      So, because they are working with statistical sampling methods, they never say that they are 100% confident.

    4. Re:0 out of 24 = 99% by Anonymous Coward · · Score: 2, Insightful

      No, the 99% refers to the % of HIV strains it kills. The 0/24 monkeys is an animal experiment. Totally different things.

    5. Re:0 out of 24 = 99% by Anonymous Coward · · Score: 0

      Too busy foaming at the mouth over shit you don't understand to actually read shit and understand it? Even the SAT has a reading test, should you be required to take it before commenting?

    6. Re:0 out of 24 = 99% by Anonymous Coward · · Score: -1

      You don't expect Khyber to care ... or understand? He's a corrosively stupid person, I wonder why Slashdot's antibodies haven't done a creimer on him.

    7. Re:0 out of 24 = 99% by Anonymous Coward · · Score: 0

      ISIS claimed responsibility for AIDS. ae911truth dot org

    8. Re:0 out of 24 = 99% by Anonymous Coward · · Score: -1

      "Welcome to core Statistics"

      Lies, damn lies, and statistics.

      Wake me when they can do straight math without needing to fudge numbers.

    9. Re:0 out of 24 = 99% by naubol · · Score: 1

      "Welcome to core Statistics"

      Lies, damn lies, and statistics.

      Wake me when they can do straight math without needing to fudge numbers.

      I believe another term for permanent sleep is death? It's definitely a sign of brain death not to recognize the value of statistics to our world.

      --
      Reality is a slackware box running on a 386 tucked away in god's sock drawer.
    10. Re:0 out of 24 = 99% by quonset · · Score: 0

      It's definitely a sign of brain death not to recognize the value of statistics to our world.

      There was a county in my state which had a 400% increase in the number of reported cases of a certain STD (can't remember which one) in one year. That's a massive statistic.

      They went from 1 reported case to 4 reported cases.

      It's like when the news reports the Dow or S&P 500 were up 0.3 percent for the day. 0.3 percent of what figure? From 100? 1000? 10,000? Giving that statistic is meaningless without a reference.

    11. Re:0 out of 24 = 99% by Anonymous Coward · · Score: 1

      Uh, that's a 300% increase.

    12. Re:0 out of 24 = 99% by tepples · · Score: 1

      It's like when the news reports the Dow or S&P 500 were up 0.3 percent for the day. 0.3 percent of what figure? From 100? 1000? 10,000?

      0.3 percent of the price at the previous trading day's close.

      Giving that statistic is meaningless without a reference.

      The reference is how invested you are in the market. A portfolio containing one unit of the basket for any particular index will be worth 0.3 percent more than it was worth yesterday. (The DJIA basket is currently 6.89 shares of each of 30 companies; S&P's is 112 trillionths of 500 companies' market cap.) Or if you had a $20,000 in an exchange traded fund (ETF) that tracks that index, such as DIA or SPY, it'll be worth $20,060.*

      * Minus expenses, which tend to run lower for an ETF than for an actively managed mutual fund.

    13. Re:0 out of 24 = 99% by quonset · · Score: 0

      Percentage calculator.

      What is four hundred percent of one? Four.

      Four is what percent of one? Four hundred.

    14. Re:0 out of 24 = 99% by quonset · · Score: 1

      The point is, they're meaningless statistics. Obviously the closing prices are based on the previous day closing price, but without a reference, simply saying X percent increase is worthless. As I showed above, you can have a huge increase but the raw number of change is small.

      Further, as you demonstrated, you need to know what you're basing the increase (or decrease) on.If you don't know that number, everything else is irrelevant.

    15. Re: 0 out of 24 = 99% by Anonymous Coward · · Score: 1

      The increase was 3 though. Not 4. A 300% increase on 1

    16. Re:0 out of 24 = 99% by naubol · · Score: 1

      It is not meaningless. It just doesn't mean something that you value.

      They gave you the derivative and you're recognizing that derivative is only interesting to you if the absolute value (which cannot be inferred from the derivative) is interesting to you. If someone doesn't understand how to interpret statistics, they may not understand the limitations implied in the statement "there was a 400% increase in reported cases of the clap in Jackson County," but I assure you I immediately understood and anyone who regularly uses statistics to make inferences for business purposes would have inferred immediately. This doesn't mean the stats are useless just because a politician can hijack them to mislead the ignorant.

      Your data point only shows that misunderstanding the statistic is dangerous and not useful. On the other hand, if we discover that the rate of HIV infection is dramatically correlated with number of sexual partners, have we not used statistics to infer a hypothesis for causality that is bloody useful? Or, if a business wants to determine how many units to make when entering some market so that it doesn't sink too much capital too early and limit its cash flow (and hence its profitability), then it can use stats in a highly profitable way. Stats was also extensively used to track the inbound progress of a storm which probably saved lives in Florida and Houston, recently. Do you really want to take the position that statistics is useless?

      People who blame stats for being "lies" are like people who hear a politician lie to them using English and blame English. In nearly all cases, you should either blame your ignorance, the person trying to leverage your ignorance of statistics to inject an understanding that isn't useful, or both.

      Statistics is a triumph of modernity which is increasing our quality and length of life.

      --
      Reality is a slackware box running on a 386 tucked away in god's sock drawer.
    17. Re:0 out of 24 = 99% by naubol · · Score: 1

      If you're invested in an all-market fund, the rate of change in the market is meaningful to you. This is the point you're calling "meaningless". Do you not understand it?

      How do you acquire an answer to the question "what is the change in my all-market shares since yesterday?" There is no way to answer this question without the information you call meaningless.

      --
      Reality is a slackware box running on a 386 tucked away in god's sock drawer.
    18. Re:0 out of 24 = 99% by Anonymous Coward · · Score: 0

      Speaking of monkeys with AIDS, it's Khyber everybody!

      Sounds more like níggers to me. Like níggers, AIDS came out of Africa. So did killer bees (Africanized bees!). So do blood diamonds.

      Black is the color of evil for a reason! If it's black it's bad! If it's from Africa it's bad! For safety! For the children!

    19. Re:0 out of 24 = 99% by david_thornley · · Score: 1

      Suppose I invest $10K in a market fund. 0.3% means I've made 0.3%, or thirty bucks. It doesn't matter what the market is at in the first place, because that affects only the number of market units I bought, and I really don't care about that. The number I'm interested in (how much is my investment worth today) is directly derivable from the statistic you call irrelevant, and I don't care about the one you consider necessary for relevance.

      --
      "When you have eliminated the unacceptable, whatever is left, however improbable, must be the truthiness" - Holmes
    20. Re:0 out of 24 = 99% by david_thornley · · Score: 1

      There's an old saying, "Figures don't lie but liars figure."

      --
      "When you have eliminated the unacceptable, whatever is left, however improbable, must be the truthiness" - Holmes
    21. Re:0 out of 24 = 99% by Anonymous Coward · · Score: 0

      Hello let me give this testimony to the public about a great man who help me out in serious illness I have HIV AID for good 5year and I was almost going to the end of my life due to the way my skin look like all I have in my mind is let me just give up because life is not interesting to me any longer but I just pray for God every day to accept my soul when ever I’m gone lucky to me my kids sister run to me that she found a doctor in the internet who can cure HIV AID he help me out on everything the man ask for my picture, so he can cast a spell on me from his temple after all he ask is done 45mins later I started getting more stronger my blood start flow normally for 4 to 5 days I start getting Wight before a month my body start developing my skin start coming up after 2month I went for HIV test and I was tested negative I’m so happy that I can say I’m not a HIV patient if you have HIV AID or any sickness please for your save contact him via peterwiseherbalhome@gmail.comor add him up on whats app +2349051208634

  5. Evolution by Anonymous Coward · · Score: 1, Interesting

    If it doesnâ(TM)t have 100% coverage that means escape mutations are feasible and therefore it will be useless. Basically the antibody needs to be effective against any 6 simultaneous SNPs in the viral genome.

    That means if the initial virus DNA sequence is (for example) tgagcagattcgctggtacgatgacgtactaa
    if the virus can escape with a sequence of
    tgaccagattcgcaggtacgatgacggactaa (five letters have been changed in specific locations). That is no good, because HIV usually has a mutation every few times it copies itself. Since there are trillions of HIV replicating every few seconds in an infected person, it is not mathematically infeasible for one of the HIV replicants to get lucky and have the required 6 mutations for it to escape.

    1. Re:Evolution by Anonymous Coward · · Score: -1

      If it doesnâ(TM)t have 100% coverage that means escape mutations are feasible and therefore it will be useless. Basically the antibody needs to be effective against any 6 simultaneous SNPs in the viral genome.

      That means if the initial virus DNA sequence is (for example) tgagcagattcgctggtacgatgacgtactaa
      if the virus can escape with a sequence of
      tgaccagattcgcaggtacgatgacggactaa (five letters have been changed in specific locations). That is no good, because HIV usually has a mutation every few times it copies itself. Since there are trillions of HIV replicating every few seconds in an infected person, it is not mathematically infeasible for one of the HIV replicants to get lucky and have the required 6 mutations for it to escape.

      You really do know a lot about HIV. Are you some kind of fag?

    2. Re:Evolution by EzInKy · · Score: 0, Troll

      You are right, the only way to be sure to not catch a STD to is never to have sex. I'm sure your prodigy will benefit from your wisdom.

      --
      Time is what keeps everything from happening all at once.
    3. Re:Evolution by Anonymous Coward · · Score: 5, Insightful

      If 24/24 of the subjects managed to survive without infection, then it's clearly not useless.

    4. Re:Evolution by boudie2 · · Score: 2

      Tyrell: The facts of life... to make an alteration in the evolvement of an organic life system is fatal. A coding sequence cannot be revised once it's been established. Batty: Why not? Tyrell: Because by the second day of incubation, any cells that have undergone reversion mutation give rise to revertant colonies, like rats leaving a sinking ship; then the ship... sinks. Batty: What about EMS-3 recombination? Tyrell: We've already tried it - ethyl, methane, sulfinate as an alkylating agent and potent mutagen; it created a virus so lethal the subject was dead before it even left the table. Batty: Then a repressor protein, that would block the operating cells. Tyrell: Wouldn't obstruct replication; but it does give rise to an error in replication, so that the newly formed DNA strand carries with it a mutation - and you've got a virus again... but this, all of this is academic. You were made as well as we could make you. Batty: But not to last. Tyrell: The light that burns twice as bright burns half as long - and you have burned so very, very brightly, Roy. Look at you: you're the Prodigal Son; you're quite a prize! Batty: I've done... questionable things. Tyrell: Also extraordinary things; revel in your time. Batty: Nothing the God of biomechanics wouldn't let you into heaven for.

    5. Re:Evolution by Pseudonym · · Score: 3, Interesting

      99% of strains killed is better than most vaccines. Gardisil is only good for about 70% of HPV strains.

      --
      sub f{($f)=@_;print"$f(q{$f});";}f(q{sub f{($f)=@_;print"$f(q{$f});";}f});
    6. Re:Evolution by TimothyHollins · · Score: 1

      That is like comparing buttsex to different quantum mechanics models. They aren't comparable in any reasonable sense, and they do completely different things with different purposes.

    7. Re:Evolution by TimothyHollins · · Score: 3, Informative

      I was about to mod this down, but perhaps explaining all the things that are wrong with this is a better way to go.

      You are correct in that 100% coverage would be needed to kill off the virus. HIV is notorious for repopulating a system if even as much as a single virion is alive. What is completely off is that 6 SNPs would protect against antibody recognition when there are 3 of them, all broadly neutralizing. The antibodies can very well have overlapping epitopes for different patterns resulting in recognition regardless of any variation, as has already been shown to be the case by TFA. Ignoring the entire purpose of the broadly neutralizing antibodies is necessary for your analysis to seem accurate.

      Next, the matters of genomics. If the antibodies recognize any specific phenotype in the viral episome, and that phenotype is conserved, it is quite tricky for the virus to produce an immunity without altering a core protein of itself. Usually, that would not be a problem for a virus such as HIV as there is lots and lots of variation possible within a protein without changing its function, but when dealing with broadly neutralizing antibodies the change must be significant or it will still get caught in a broad recognition. Hence, it is not enough to change a nucleotide or two, that change must result in a significantly different phenotype which means the expressed protein would function differently (or not at all). That is why these antibodies have already been proven to work efficiently.

      In short: no, your interpretation does not represent how it works at all.

    8. Re: Evolution by Anonymous Coward · · Score: 0

      There should be concern about creating resistance if some strains are not killed. However, knocking out 99% of germs is good enough for Lysol and other cleaners.

      In this case, it is a good start. There may be another antibody that can provide the rest of the coverage.

    9. Re: Evolution by Anonymous Coward · · Score: 0

      Assuming you are speaking the truth: mic drop man.

    10. Re:Evolution by show+me+altoids · · Score: 1

      You are right, the only way to be sure to not catch a STD to is never to have sex. I'm sure your prodigy will benefit from your wisdom.

      I think you mean "progeny."

      --
      I feel sorry for people that don't drink, because when they get up in the morning, that's as good as they're gonna feel
    11. Re:Evolution by denzacar · · Score: 2

      I was once considered a child progeny, but I kinda lost it with age.

      --
      Mit der Dummheit kämpfen Götter selbst vergebens
    12. Re:Evolution by angel'o'sphere · · Score: 1

      Idiot very much?

      You are infected by HIV.

      An antibody is "killing" 99% of the virus, and you think: therefore it will be useless, you seem to be a bit retarded.

      every few times it copies itself. Hint:no virus is copying itself.

      Perhaps you want to read the article again to grasp that the antibodies attack "fixed structures" in the virus?

      --
      Cost free eBook I read (by iBook/Kobo/Amazon/ObookO/Gutenberg etc.): "The Green Odyssey" by Philip Jose Farmer.
    13. Re:Evolution by angel'o'sphere · · Score: 1

      An antibody is not a vaccine, unless you call a passive vaccination "with antibodies" a vaccine.

      --
      Cost free eBook I read (by iBook/Kobo/Amazon/ObookO/Gutenberg etc.): "The Green Odyssey" by Philip Jose Farmer.
    14. Re:Evolution by epine · · Score: 1

      If it doesn't have 100% coverage that means escape mutations are feasible and therefore it will be useless. Basically the antibody needs to be effective against any 6 simultaneous SNPs in the viral genome.

      You're advancing a fallacy that all mutations are cost free to the resultant super bug.

      Back in reality, the non-mutated forms where chosen by a selective pressure, and it stands to reason that many of these conveyed a selective advantage (which is sacrificed when a new selection pressure causes it to flip in a different direction).

      There are thus two ways to win the war: either by the spannering the Infinite Improbability Drive (the story everyone loves to tell the foolish children), or by a gradual process of nickel and diming the aspiring super bug to clad itself in Mad Max bandoliers filled with hollow-point bullets whose helium cores do not fully counteract their depleted uranium sheathings.

      Moral of the story: The quick way to take out Mad Max in Thunderdome would have involved just a few wags of a simple garden hose to loosen the hardened soil beneath his 400 lb loaded-for-bear curb mass.

    15. Re:Evolution by Anonymous Coward · · Score: 0

      Evolution is actually why this antibody works. Your assumption that mutations that will allow the virus to escape the antibody are likely is false. There are parts of the virus which cannot evolve as rapidly, because they are required for attaching to specific molecules on the host (us) which are evolving in much slower rate. In fact it is evolution that brought us this antibody. The antibody sequences (three different sequences interacting with different and completely unrelated targets on HIV) have been isolated from patients that have developed resistance to the virus and the reason for this resistance. The work described in the original article is to engineer a single antibody that caries the three sequences. This further impedes the ability of the virus to escape - now it needs to escape not one, but three different traps simultaneously. The difficulty of this task increases exponentially with every additional change that needs to be evolved. It is not impossible for a virus to escape (certain viruses may already be resistant to one or two of the antibodies and require just one more change), but it is very unlikely to happen in all infected patients. It will be even more effective if used as preventative, because in this case the virus will not have a chance to evolve resistance. So while this antibody may not cure HIV once and for all, it will dramatically cut the current pandemic. There are over 36 million people infected with HIV as of 2016. Even if the antibody is effective for 50% of the cases as opposed to the 99% claim, this is still an unprecedented success.

    16. Re:Evolution by Neuronwelder · · Score: 1

      Regarding HPV: I'm pretty sure Gardisil is still made to only go after the cancer causing viruses. It would explain 70%. Hmm,. looks like they got some new stuff. https://www.cancer.gov/types/c...

    17. Re:Evolution by Pseudonym · · Score: 1

      Oh, absolutely. Just for the record, I was comparing this potential treatment with vaccines because it was the first "percentage of STI strains" figure that came to mind.

      --
      sub f{($f)=@_;print"$f(q{$f});";}f(q{sub f{($f)=@_;print"$f(q{$f});";}f});
    18. Re:Evolution by Pseudonym · · Score: 1

      To clarify my original claim, the original Gardisil protected against the strains that cause 70% of cervical cancers.

      And yes, there's a new one.

      --
      sub f{($f)=@_;print"$f(q{$f});";}f(q{sub f{($f)=@_;print"$f(q{$f});";}f});
  6. That may mean 100 percent... by Anonymous Coward · · Score: 0

    of the strains they tried, but due either to lack of access to a sample, or other known factors, that 1% of HIV virus types would not be affected be these particular antibodies.

    I don't remember exact amounts, but there are as many or more kinds of HIV than there are HPV, which is to say there are a lot of variations, not all of which may attack the same binding points.

  7. Sucks to be AIDS by Anonymous Coward · · Score: 0

    HA take that aids

  8. Doesn't Matter by Anonymous Coward · · Score: -1

    The antibodies are GMOs - engineered, get it? And GMOs are bad, right?

    1. Re:Doesn't Matter by Boronx · · Score: 1

      Antibodies are Os?

    2. Re:Doesn't Matter by Anonymous Coward · · Score: 0

      And they have G?

    3. Re:Doesn't Matter by jellomizer · · Score: 1

      You can have the All Natural GMO Organic HIV Virus munch away at your Immune system until you are dead.
      Poison Ivy is all natural, and Organic and GMO Free, and it is still bad for you, hence why it is called POISON ivy.

      --
      If something is so important that you feel the need to post it on the internet... It probably isn't that important.
    4. Re:Doesn't Matter by tepples · · Score: 1

      No, but the mice they're made in are. Humira (adalimumab) and other monoclonal antibodies are produced inside mice with human immunoglobulin genes, which are genetically modified organisms.

  9. The medical cartel... by Anonymous Coward · · Score: -1

    will never allow this to be approved since it cuts into profits. I have IBS, and I've read about probably a dozen different promising treatments, but none of them have been approved for use in the US. Our entire system is centered around making money for doctors instead of helping the people.

    1. Re: The medical cartel... by Anonymous Coward · · Score: 0

      It's incredibly expensive to do human trials and get approval from fda. Many drugs never make it through process. These costs are recouped through high non generic drug prices.

      If you want cheaper and more diverse treatments, fix the fda incentive structure. Bring down the cost to innovate. Heavy regulatory environments make it hard for small businesses who can't afford huge legal teams.

      They have every incentive to say no, because it's hard to point at specific people who aren't being helped by a drug which doesn't exist. If they say yes, and people die, they get in trouble because it's very easy to point at dead people and no one gives a fuck about the potentially many more people who don't die.

    2. Re: The medical cartel... by bigfinger76 · · Score: 1

      It's far more expensive to market those drugs, apparently.
      Gotta recoup those costs too.

    3. Re:The medical cartel... by jellomizer · · Score: 1

      Have you read why the FDA had rejected them?
      There are a lot of ways to cure problems, but often the side effects are worse then the illness they are causing.
      So it cures IBS so you don't need to go to the bathroom as often and less pain from gas... However you now need to get a new kidney or liver. Is that really better?

      --
      If something is so important that you feel the need to post it on the internet... It probably isn't that important.
    4. Re: The medical cartel... by Anonymous Coward · · Score: 1

      IBS is not a disease, it's a symptom, and a lazy hand-waive excuse. Find the real defect or disease, then you'll be on the path to a cure.

      A comprehensive food allergy test might be a nice start for your IBS. Don't eat anything that causes an immune system response for you. Don't be surprised if this includes eggs, a specific type of nut, dairy, and gluten. If you cannot or will not completely avoid all of your allergy foods, then you'll just stay sick forever.

      Whenever someone says "they'll never let ...", it's generally followed by the rantings of an uneducated conspiracy theory nut. So, stop ranting and begin educating yourself.

      Yes, big pharma wants your money. Yes, doctors also want your money and can make mistakes in the process of getting your money. Some can even be dangerously incompetent.

      They're doctors, not deities. If one doesn't deliver clear results in a timely fashion, fire him and move on.

    5. Re: The medical cartel... by Anonymous Coward · · Score: 0

      A comprehensive food allergy test might be a nice start for your IBS.

      Don't limit yourself to food allergies. Excess nasal secretion can cause many of the same problems.

  10. Here we go again by 93+Escort+Wagon · · Score: 3, Funny

    Another story about the one-percenters.

    --
    #DeleteChrome
  11. AIDS is bad by PopeRatzo · · Score: 5, Interesting

    I know a couple of people who have lived for decades with HIV. Both are hemophiliacs and got the virus before there was testing of the blood supply. They both lived in the same region of the US and caught the virus about the same time. They have to take tons of medicines to stay alive and they're already being treated for hemophilia, so it sucks for them. If they can finally get cured, that would be great. They're really good people.

    It sounds like this new antibody works a little bit like the various treatments they have for Hepatitis C. There are multiple genotypes of HepC and not all the drugs work for all the genotypes, but the medicines interfere with some protein or something and causes the HepC virus to not be able to "hide" from the immune system and it just ends up getting killed off. Completely. A disease that until 2014 couldn't be cured now has a treatment that is 90% effective. One pill a day for 12 to 24 weeks and virtually no side effects. And done. Cure. Completely. Unfortunately it costs like a quarter-million dollars so insurance companies won't let you have the treatment without a fight. They will first say no unless you have at least Stage 4 fibrosis (the stage before your liver starts dying), and then they make you jump through hoops and get multiple blood tests and ultrasounds and sometimes even liver needle biopsies (which actually damage the liver). Then, they'll deny you one more time hoping to run out the clock until you die. But if you have a good GI doctor, he'll go to bat for you and keep sending the prescription until it gets approved.

    To give you an idea how stupid our insurance-based system is, it's not even the insurance company that's denying you. It's a company that the insurance company hires called a "Pharmacy Benefits Manager" who are even harder to deal with than the insurance company. Then, they'll do completely random things like force you to use a different specialty pharmacy to get the meds (because you can't get these meds at your regular Walgreens, you have to go through a specialty pharmacy who will deliver the drugs to you, because every bottle of 30 pills is worth like $60,000. It's all really stupid. In Canada, the treatment is a small fraction of the cost. In India, it costs about $400 (but medical tourism doesn't work because the pharma companies have cut a deal with the Indian government to require people to show an Indian passport before they can receive the medication).

    I know all this because a musician I play with on a regular basis had HepC. He was getting sicker and sicker and my wife and I helped him a lot dealing with the insurance companies and pharmacy benefits managers and special pharmacies. The freaking medicine acted remarkably fast. Within 4 weeks, a guy who had been positive for HepC for 25 years was coming up negative for the virus on his blood tests. He felt better after only a few weeks. After 24 weeks, he was done. After another few months, he was tested, still negative. Since the liver regenerates, within 8 months, his fibrosis had gone from level 4 to level 3 to 2 and is now at level 1. Yes, it cost the insurance company a couple hundred grand (although it really didn't because the pharma companies make special deals with them where it only really costs a few grand) but it's still a LOT less than a liver transplant, which he would have needed eventually, or liver cancer treatment, which sucks really bad.

    I'm sorry to write this long story, but a cure is a cure. I hope eventually they can cure HIV as easily as they can now cure HCV. And if you're a baby boomer or Gen Xer, you should get tested for HepC the next time you get blood drawn. You don't want to wait until your symptomatic to find out you got it.

    --
    You are welcome on my lawn.
    1. Re: AIDS is bad by MattKeith · · Score: 1

      Maybe now they'll include hepc in standard testing. They haven't because there was nothing to be done about it

    2. Re:AIDS is bad by Anonymous Coward · · Score: 0

      I saw an news report from the UK some time ago where people pool to shop the HepC pills from the Internet sources for 1k ($,£,€?). In that report it was said that the treatment costs 50k in the UK, over 40k in France and 80k in the US. People suffer for years needlessly from the decease and burden the tax payers with the reduced economic output. The report mentioned that the health care systems in UK and France might do something about the situation soon.

    3. Re: AIDS is bad by Anonymous Coward · · Score: 0

      Here is the solution.
      Take a tourist visa in France.
      Let it expire.
      Then as an illegal you go to your nearer CPAM, and ask to register for AME.
      Once it is validated, you can go to the best hospital you can and describe your HepC symptoms. If they are reluctant, go to the Emergency where they are forbidden to reject people. They will treat you then find a room for you.

    4. Re:AIDS is bad by 140Mandak262Jamuna · · Score: 1
      Indian government may be in cahoots with the pharma companies. But Indian people will help you

      Find an Indian friend who does not have HepC who will get his physician to prescribe that HepC meds for him and he will hand them over to you. Some will do it out of kindness and lot more will do it for a little baksheesh.

      Work with the system at personal level. Fight it collectively.

      --
      sed -e 's/Chuck Norris/Rajnikant/g' joke > fact
    5. Re:AIDS is bad by Anonymous Coward · · Score: 0

      Bad people deserve to be cured too.

    6. Re:AIDS is bad by angel'o'sphere · · Score: 1

      If you have an illness like this, fly to Europe and exploit the european system.
      You get treatment and they sue the american health insurance to get the money back (if they don't comply voluntarily).

      --
      Cost free eBook I read (by iBook/Kobo/Amazon/ObookO/Gutenberg etc.): "The Green Odyssey" by Philip Jose Farmer.
  12. Put away the foil hat by Anonymous Coward · · Score: 5, Insightful

    Our medical system has plenty of faults, but crazy conspiracy theories are not involved. If there was a conspiracy by big medical companies to hide cures because they make more money treating, then explain the following:

    [a] The elites ALWAYS carve-out exscape hatches for themselves. Just look at Al Gore and friends who rant about Climate Change and demand the public change their use of energy etc - while THEY sail super-yachts, fly private jets to conferences at exotic vacation spots, own many glorious power and resource-sucking mansions and so forth and claim to be making up for it by buying "offsets" (google: indulgences and corrupt popes). Rich elite lawmakes put taxes on sodas and limit table salt (which affect middle-class and poor folks) but they do nothing about their expensive and fattening and salt and sugar-laden foods and beverages. Somehow, however, executives of big medical firms and their family members suffer the same diseases and unhappy demises as the rest of us.

    [b] Big entities cannot keep secrets. There are always insiders who are opposed to a policy, or who see an injustice, or are personally affected, or see a hypocrisy they despise, or who want to puff-up their credentials with friends or relatives who end-up leaking stuff. Where are the current or former "insiders" who are publicly outraged to be ill or dying or have sick or dying family members who are blowing the whistle on the particular executives who are hiding these magical mystery cures while making sure they themselves and their kin have access to those cures?

    The simple FACT is that human beings are remarkably complex biological machines. An individual blood cell is frighteningly complicated and not fully-understood nor human-engineerable. Bone cells, kidney cells, liver cells etc are all similarly brain-bending in complexity and when you gang all of these together into a complex creature and then add-in a virus - well I personally am impressed by ANY drug advance. When you consider how difficult it is to find ANY new medicine, add-in the idea that we have probably discovered all the "easy" to discover drugs, then consider the enourmous resources to find a new drug and clear the massive pile of government regulations to get a drug approved, it's even more amazing ANY drug advance is possible.

    Oh, I personally have a chronic illness and have experienced the annoyance of hearing about "breakthroughs" periodically and seeing nothing that helps ME, while also having a family member with a very serious illness who is currently involved as a subject in a drug trial program. If you ever find yourself in that tough spot and are a good candidate to be a test subject, DO IT. It may be very unpleasant and painful and embarassing and lots of other stuff and my do nothing for YOU but your participation could eventually contribute to a new drug or a better understanding and thus save or improve the lives of an uncountable number of people. Imagining conspiracies that do not exist only makes people hostile and bitter; it does NOTHING to improve the condition of any human being and is a completely self-centered non-productive waste of human energy.

    1. Re:Put away the foil hat by JoshuaZ · · Score: 4, Insightful

      While I agree with some of your points, buying carbon offsets is not one of them. The key moral distinction is that there's nothing wrong intrinsically morally wrong with producing CO2, so as wrong as long as the total net CO2 is lower one is acting reasonably. This is distinct from say murdering a person and donating enough money to save two people from malaria; murder is bad at an absolute level. CO2 is only bad because of what high levels of it lead to.

    2. Re:Put away the foil hat by naubol · · Score: 1

      It does not require a conspiracy theory for it to be true that a pharmaceutical company is unlikely to pump money into looking for a cure. At every level of a company, people will be thinking about how to make money, not how to save the world. If they happened upon a cure, maybe they would share it and work to get it approved. If they have an expensive drug that must be taken for life, why would they spend money looking for a cure? This is why little ole liberal me thinks we should always be doing some government funding of basic research in universities.

      It is also not true that every large organization with big secrets eventually loses control over those secrets. At least, not in the real time. We know plenty of secrets now that were kept for decades until they no longer mattered. Nobody knows the formula for coke outside of Coca Cola. There are no whistle blowers behind the strategies that big pharmaceuticals take to avoid their drugs becoming generic. Conspiracies without evidence are inane, yet so is thinking companies are not capable of doing dastardly things in secret.

      --
      Reality is a slackware box running on a 386 tucked away in god's sock drawer.
    3. Re:Put away the foil hat by Anubis+IV · · Score: 1

      I’ve told the story here before, but I knew a professor at a university who discovered a means for curing yeast infections in a single day, back when the industry standard was still a one-week treatment. A large pharmaceutical company approached him, bought him out, and then proceeded to do nothing with his work for the next several years. Their three-day treatment was about to launch and was already ahead of the competition, so they wanted to milk it for all they could before bringing the one-day treatment to market later.

      I too doubt that anyone is holding back cures for major illnesses, but they absolutely do hold back better treatments when there are financial advantages to doing so.

    4. Re:Put away the foil hat by blind+biker · · Score: 1

      Our medical system has plenty of faults, but crazy conspiracy theories are not involved.

      The whole Shkreli case proves that yes, there is a conspiracy going on in the US medical system, and it is fueled by lobbying from big pharma, bio-med, and insurance companies.

      --
      "The agriculture ministry is not in charge of Gundam" - Japanese ministry official.
    5. Re:Put away the foil hat by Neuronwelder · · Score: 1

      Thank you for acknowledging that the human body is immensely complicated. Few people really realize the depth of it.

    6. Re:Put away the foil hat by angel'o'sphere · · Score: 1

      What about the "gastritis conspiracy"?
      For decades the MIC tried to suppress the finding that gastritis is caused by "Helicobacter pylori", selling billions of worthless medicals that only "calmed down" the lining of the stomach, but curing nothing.

      --
      Cost free eBook I read (by iBook/Kobo/Amazon/ObookO/Gutenberg etc.): "The Green Odyssey" by Philip Jose Farmer.
  13. Blood donation Hep C by Anonymous Coward · · Score: 0
  14. Re:Blood donation Hep C by PopeRatzo · · Score: 1

    It's included for blood donation, but what I'm saying is it should be included in regular blood work. I've heard that as many as 10% of certain age groups might be infected.

    --
    You are welcome on my lawn.
  15. Just wondering by Anonymous Coward · · Score: 0

    Not saying I know fuck-all. Isn't there a good chance that the 1 percent that isn't finished off will become the new 99 percent?

    1. Re:Just wondering by Boronx · · Score: 1

      Yes, but the same technique will probably work on the rest.

  16. We're improving... by hyades1 · · Score: 1, Interesting

    So the first reports of AIDS started coming in a bit over 30 years ago. Ever since it was identified, and linked strongly with homosexual males, we've heard one preacher, imam and rabbi after another tell us how AIDS is a punishment from god visited upon a segment of humanity that richly deserves to die.

    Well, I guess we've got some bad news for god. In just two generations...less time than a lot of the punishments god metes out (remember "even unto the third generation"?), we've pretty much got AIDS under control, maybe even cured.

    So two possibilities: either god doesn't really care all that much about a mutual dick-sucking every now and again, or maybe...just maybe...god doesn't exist.

    Either way, it's all good for rational people. I'll be waiting with bated breath to hear Pat Robertson explain how just a few people working for much less than a human lifetime managed to take this god-mandated death sentence for gays and turn it into a non-issue.

    I can't help but wonder what the next failure of religion will be when it attempts to contradict science.

    --
    I've calculated my velocity with such exquisite precision that I have no idea where I am.
    1. Re: We're improving... by Anonymous Coward · · Score: 0

      So edgy it cuts bro.
      Not sure why you're even bringing up religion in the first place.

    2. Re: We're improving... by Boronx · · Score: 2

      Why aren't you sure? Do you doubt his explanation?

    3. Re: We're improving... by Opportunist · · Score: 3, Insightful

      Because religion is one of the reasons AIDS could spread like it did in the US.

      The first cases were reported in late 1980/early 1981. It took researchers (at least those who did actually bother to give a shit) almost a year to trace it back to their "patient 0" who passed on the virus often years before, with reports reaching back into the 1970s. No later than this moment it was a given that this is a time bomb the population needs to be warned of. What they learned was they're dealing with an incurable, nearly unknown infection with an incubation time of years, and they even understood the infection route: Body fluids. I.e. mainly unprotected sexual intercourse and swapping of needles of drug addicts.

      The Reagan administration did ... NOTHING AT ALL. It only affects the fags and druggies? Great! Issue a warning? Are you nuts, the less of those two scourges, the better!

      Only when they noticed that it does affect people who need blood transfusions and, guess what, drug addicts need money and sell blood, only then they slowly and VERY reluctantly started attempts to fight it.

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    4. Re:We're improving... by Anonymous Coward · · Score: 0

      So two possibilities: either god doesn't really care all that much about a mutual dick-sucking every now and again, or maybe...just maybe...god doesn't exist.

      Lots more possibilities - like maybe the religious authorities are wrong.

    5. Re: We're improving... by Anonymous Coward · · Score: 1

      The Reagan administration did ... NOTHING AT ALL.

      Don't be a whiny ignoramus who learned all about the Reagan's because he watched a movie starring Barbara Streisand's husband. The federal budget for AIDS research was $8 million in 1982, increased to $44 million in 1983, then doubled every year for the remainder of Reagan's presidency. Just because Reagan didn't react to the crisis as fast as you wished doesn't make him a monster.

    6. Re:We're improving... by Anonymous Coward · · Score: 0

      There's Science as the unabated application of the scientific method in search of truth, and then there's your comment; science as a religion.

      it's only after you've gone through significant tragedy that you can fully appreciate that your sentiment is effectively the same as "your religion sucks mine is better". It has no place in a scientific or engineering discussion.

    7. Re: We're improving... by Anonymous Coward · · Score: 0

      no jerkoff. because you can't keep your dick in your pants long enough to keep one partner.

      sexually transmitted diseases, require sex.

      speed of transmission, requires promiscuity.

      same goes for shooting up. if you used your own needles, you'ld be fine.

      you know who wasn't fine, despite being responsible? people who contracted it from the blood supply.

      so Reagan, was right.

    8. Re:We're improving... by Anonymous Coward · · Score: 0

      it's only after you've gone through significant tragedy that you can fully appreciate

      Only if you're hard-headed. I've spent most of my own life hard-headed. Once you stop doing that, it's great. You learn to take a hint when one is presented and you can stop investing so often in failure. Tragedy still happens but it becomes less and less necessary.

    9. Re: We're improving... by hyades1 · · Score: 1

      Interesting. I never actually thought about the Reagan administration's silence on the matter. Your idea makes sense.

      --
      I've calculated my velocity with such exquisite precision that I have no idea where I am.
    10. Re: We're improving... by MercTech · · Score: 1

      Harumph.... you expect an actor to run a public health treatment campaign?

      Reagan did what the leader of a large organization does when he is effective... "Hey Koop! Yeah, you Mr. Surgeon General. Get us a plan on this HIV thing." Now, how many Surgeon Generals have had press conferences since C. Everett Koop? I know I can't remember any. Koop totally pissed off the reporters because he refused to be intimidated in saying anything he couldn't back up with data. Meanwhile the yellow press reporters were trying to increase ad revenue by convincing the masses that we are all gonna die within a decade.

      Reagan delegated to his expert on public health serving in the cabinet.

      --
      NRRPT/RCT
  17. HIV CURE by LisaNaynaTumelo · · Score: -1, Troll

    The Great Dr.OLIHA herbal medicine is a good or perfect cure remedy for HIV Virus, I was diagnose of HIV for almost 5 years, everyday i am always on research looking for a perfect way to get rid of this terrible disease as i always knew that what we need for our health is right here on earth though the scientist say there is know cure for this disease,on my search I saw some different testimony on how Dr. OLIHA has been able to cure HIV with is herbal medicine. I decided to contact this man, I contacted him and he guided me on how to purchase for the medicine. I asked him for solutions and he started the remedies for my health. Thank God, now everything is fine, I’m cured by Dr. OLIHA herbal med icine, I’m very grateful to Dr. OLIHA, reach him now on (oliha.miraclemedicine@gmail.com ) or you can also call him on +2349038382931. Dr. OLIHA Also Cures: 1. HIV/AIDS 2. HERPES 1/2 3. CANCER 4. ALS (Lou Gehrig’s disease) 5. Hepatitis B 6. chronic pancreatic 7. Emphysema 8. COPD (Chronic Obstructive Pulmonary Disease) 9. Asthma 10.Acute angle-closure Glaucoma 11. Diabetes 12.CHRONIC PANCREATIC 13.CHLAMYDIA 14.ZIKA VIRUS

    1. Re:HIV CURE by TheZeitgeist · · Score: 2

      But can the herb cure pancreatic zika chlamydia? Um, asking for a friend.

  18. We've always had the cure for HIV, and... by Anonymous Coward · · Score: -1

    it's FREE!

    There is literally NO OTHER nasty human disease we can as easily wipe out in any one single generation.

    We could have ended the AIDS epidem in in the eighties for free and before MILLIONS of human beings DIED from it.

    All we need is for ONE GENERATION to not use IV-Drugs recreationally and not engage in sex with anybody other than their heterosexual spouse.

    That's it. Save millions of future lives for FREE. Hell, after HIV/AIDS would be eliminated, even the drug use and reckless sex could come back probably for a few decades before some idiot stumbled upon another source in some isolated corner of the planet and dragged it back into the general population. This is not some puritanical plan - it's the ONE known and guaranteed and free solution. In the '80s, sadly, we found out that bath houses (which health officials begged to temporarily close) and irresponsible promiscuity were more important to certain poltitical groups than the lives of millions.

    The alternative is to keep hoping for a cure to a virus - something human being have never yet achieved.

    1. Re: We've always had the cure for HIV, and... by Anonymous Coward · · Score: 0

      24 monkeys? Is this worse than the army of 12 monkeys?

    2. Re:We've always had the cure for HIV, and... by Anonymous Coward · · Score: 1

      The alternative is to keep hoping for a cure to a virus - something human being have never yet achieved.

      We've eradicated smallpox in the wild, and barring any lab accidents or foul play at the few places holding samples, it should stay that way.

    3. Re:We've always had the cure for HIV, and... by Anonymous Coward · · Score: 1

      it's FREE!

      You have a strange definition of free

      In my book – and many people's books – when you have to give up something, e.g. money, time, things you like to do, it's no longer free.

      And I dunno, why could it only be hetero spouses? How would a monogamous gay couple spread HIV? Answer: they can't, not if they're truly monogamous. I think you just have a thing about homosexuality and you couldn't help but take a pot shot at gays.

      And while recreational drug use isn't my thing, there are, and were, safe ways to use IV drugs. All we needed to do was make sure there was a clean supply of needles; you know, to control the spread of disease. But I know you don't like that because someone else (you perhaps?) probably would have had to pay for it. Why not, you don't like the idea of controlling the spread of disease? Oh, you're only happy when other people have to pay for it, is that right?

      Yeah, so there is no Free solution, and there never was.

    4. Re:We've always had the cure for HIV, and... by Opportunist · · Score: 3, Insightful

      Yup, that's what the Reagan administration thought, too. They, too, forgot about blood donations and people who need them. Who then in turn infect their spouses and future kids.

      Even they back then eventually understood why this is not going to work out, so I am confident you'll eventually see it, too.

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    5. Re:We've always had the cure for HIV, and... by DanDD · · Score: 1

      The dangerously ignorant zealotry in your post can be countered by smallpox

      Since you aren't likely to read the article or anything that contradicts with your myopic world view, I'll quote the first two words for you:

                          "Smallpox was ..."

      --
      "Every time I see an adult on a bicycle, I no longer despair for the future of the human race." - H. G. Wells
    6. Re: We've always had the cure for HIV, and... by dunkelfalke · · Score: 1

      That took the Soviets and the USA working together for the common good. Nowadays the USSR is gone and the Americans stopped trying to even appear as the good ones.

      --
      "It's such a fine line between stupid and clever" -- David St. Hubbins, Spinal Tap
    7. Re: We've always had the cure for HIV, and... by Anonymous Coward · · Score: 0

      We've *almost* finished off polio as well - the yearly infected total has been below 100 for a while, and two out of three strains are probably exterminated.

  19. Re:Blood donation Hep C by MattKeith · · Score: 1

    I had to specifically ask for HepC in my std screening. If you go into a Dr and just ask to get full std screening, they more than likely won't include HepC. I've had quite a few by this point in my life.. it wasn't in any of them unless asked. I realize that's slightly off topic since the OP was referring to blood donations but it really should be in std screening.

  20. Yay! by Anonymous Coward · · Score: 0

    Now we can get back to unprotected sex, needle sharing and no blood screens.

  21. HepC isn't a retrovirus, though by Cyberax · · Score: 4, Interesting

    The major problem with HIV is that it's a retrovirus. It inserts itself into the DNA of immune cells and then stays dormant (sometimes for years) until the cells are stressed, so simply clearing the virus from blood plasma is not enough. Modern anti-retrovirals can eliminate every single live virus particle but they can't touch the reservoir of dormant virus.

    Scientists are now looking at various gene-editing tools to get after it, like RNAi- or CRISPR-based therapies. It's not easy because the virus mutates easily but there's some hope.

    1. Re:HepC isn't a retrovirus, though by Anonymous Coward · · Score: 1

      If you have a constant supply of these antibodies though, wouldn't they render the dormant HIV moot?

    2. Re: HepC isn't a retrovirus, though by emil · · Score: 3, Informative

      No. Very few people ("long term non-progressors") create effective antibodies that can successfully control the infection. These new antibodies are actually tweaked and did not emerge from any person. The antibodies are manufactured and shipped for injection, and they must be refrigerated. Assuming they are human-derrived, they will last in the blood for a month. These are likely "monoclonal antibodies," and drugs that use this technique have names that usually end in -MAB. They're quite expensive.

    3. Re:HepC isn't a retrovirus, though by PopeRatzo · · Score: 1

      The major problem with HIV is that it's a retrovirus.

      HCV, like HIV is an RNA virus. HCV can also stay dormant for decades. They used to think that HCV only attacked liver cells, but now they're learning it can "hide" in other organs and structures.

      The difference between a retrovirus and flavivirus is less than you think.

      --
      You are welcome on my lawn.
    4. Re:HepC isn't a retrovirus, though by Cyberax · · Score: 2

      HCV is not capable of true dormancy, it's either infective or not. "Dormant" period simply means that the immune system and the HCV virus are at a stalemate ( http://www.nature.com/nm/journ... ). It happens because the HCV virus has unusually low activity inside infected cells, a typical virus replicates itself furiously and causes cells to lyse (explode) quickly but HCV only produces around 50 copies of virus per day. So you can have situation where a fairly small amount of viral particles in blood are efficiently controlled by antibodies but they can't do anything with the actual virus-producing cells, until the virus eventually evolves a subtype that evades the immune system...

    5. Re:HepC isn't a retrovirus, though by PopeRatzo · · Score: 1

      Thanks, I didn't know all of that. Does this also have something to do with HCV's ability to "hide" in organs other than the liver? I've been active with the American Liver Foundation and I'm hearing that doctors are starting to prescribe the anti-HCV drugs for longer terms than originally prescribed, as well as combining drugs (like Sovaldi and Daklinza) because of this "stickiness".

      --
      You are welcome on my lawn.
    6. Re:HepC isn't a retrovirus, though by Cyberax · · Score: 1

      HCV apparently sometimes infects other cell types, but the same behavior applies - it still can't be truly dormant. It's possible that the existing drugs are not as effective for them. Several HEPC drugs are also prodrugs, so it's possible that other cell types don't metabolize them as efficiently.

      I'm an investor in a private company that is developing HCV and Zika treatments, so I have more than usual familiarity with these topics.

    7. Re:HepC isn't a retrovirus, though by PopeRatzo · · Score: 1

      Thanks for the information and I wish you the best of luck.

      --
      You are welcome on my lawn.
  22. We're dead inside by Anonymous Coward · · Score: -1

    You are remembering a Slashdot that never existed. This site has an undercurrent of trolls since the late 1990's. It's been a part of this site for perhaps longer than you've been lurking here. If you haven't figured out what sort of back alley graffiti we typically get here yet stuck around for years to reminiscence about the good old days, then shame on you.

  23. Cure for HIV??? by jez9999 · · Score: 1, Interesting

    If these guys cure HIV they must surely get the Nobel prize for medicine.

  24. Seriously though by slashmydots · · Score: 0

    This is about the 10th time they've cured AIDS/HIV just in Slashdot's reporting. This is solar panel and battery efficiency all over again. I think both are at about 105% efficiency cumulatively. Why is HIV still a thing now?

    1. Re:Seriously though by BlackPignouf · · Score: 1

      A function can be increasing but bounded : 1-1/x for example.
      It means that solar panel efficiency can always keep on improving while still being stuck below 50% forever. No need to achieve 105% ;)

    2. Re:Seriously though by jellomizer · · Score: 1

      Because they had milked the Transparent Aluminum threads a decade ago.

      --
      If something is so important that you feel the need to post it on the internet... It probably isn't that important.
    3. Re:Seriously though by MercTech · · Score: 1

      Transparent aluminum? Isn't that called "sapphire"?
      Oh, you want it both transparent and ductile? Good luck.

      --
      NRRPT/RCT
  25. And then it will be hidden from the world. by Anonymous Coward · · Score: 0

    Just like anything else that 'cures'. It seems like this same kind of thing happens.

    Some research comes up with something that attacks aids/hiv/cancer/whatever... shows to be a promising treatment/potential cure... and then... nothing. We never hear anything further about it. It never reaches human trials. It just, vanishes from all news.

    1. Re:And then it will be hidden from the world. by jellomizer · · Score: 1

      This is often due to poor science reporting in the news.
      They like to jump on the newest Hypothesis or a few early experiments. But rarely do they cover the full process of the Scientific Method.

      We have climate deniers, anti-vaxer, GMO fearing people because as a kid the TV shows all the wonders of what science can bring, because of the latest cure for Cancer, New forms of power that is clean, The band new microchip that is 10 times as fast.... These were all in the early phases of the process.
      That Cure for cancer was found would kill patients after 3 years,
      That new form of power is extremely dangerous to generate.
      That microchip just cannot be mass produced or is just in one area of calculation that isn't really used.

      It is easy to feel that the Scientist are always getting it wrong, the truth is, the scientists are actually usually getting it wrong, it is part of the process, however what normally goes threw the full process and is shown a positive is actually darn close to being right most of the time.

      Because now we are able to treat and reverse some cancers. (Due to ideas from those early failed trials)
      We have clean effective power options available to us now. (After looking why such dangers appeared)
      Processors are still following Mores Law. (Using many of the ideas from that chip design, it took more time for it to be manufactured and needed other technologies to catch up too)

      However science is a process, and sometimes it is a long one. The media doesn't the whole process of discovery. They want the blip of the day. It if turns out true they can brag that they had covered it first. If it failed, then it is just those crazy scientist taking our tax money to spend on useless grants.

      --
      If something is so important that you feel the need to post it on the internet... It probably isn't that important.
    2. Re:And then it will be hidden from the world. by peragrin · · Score: 1

      It isnâ(TM)t one reason I like Apple. They keep their products under wraps and mostly secret until it is available in the mass market. I would love it if more products did that as opposed to driving up hype and then disappointing when the final processes reveal fundamental flaws in their hype.

      Works for drugs, science, electronics, sports etc.

      --
      i thought once I was found, but it was only a dream.
  26. This is good news for faggots. by Anonymous Coward · · Score: 0

    They can proceed to buttfuck each other with impunity.

    1. Re:This is good news for faggots. by Opportunist · · Score: 0

      It's also good news for the children of crack hoes that were infected while not born yet.

      The attitude you display here is exactly what made AIDS the problem it is today. In the 80s, we could probably have found a way to stop it. But it only hits the fags, so who gives a shit, let the wrath of god hit the fags.

      Fucking religious, kill the damn lot with fire and we'll all be better off!

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    2. Re: This is good news for faggots. by Anonymous Coward · · Score: 2, Insightful

      That attitude comes from snarky atheists as well. Maybe focus on the attitude?

      (Snarky atheist here )

    3. Re: This is good news for faggots. by Anonymous Coward · · Score: -1

      You have to admit, the main reason the fags want a vaccine is so they can go back to acting like two dogs in the park again.

      The reason why it exploded in the fag population to begin with was due to their disgusting sexual perversions. Strangely enough, lesbians were not struck down in their thousands from it. I wonder why ?

    4. Re: This is good news for faggots. by Anonymous Coward · · Score: 1

      The CDC reports that 87% of new cases each year are in fags.

      It very much is a fag disease.

    5. Re:This is good news for faggots. by Applehu+Akbar · · Score: 1

      Except for the ones who oppose GMOs. They will have to fatalistically die because that is the will of Mother Gaia.

    6. Re: This is good news for faggots. by Anonymous Coward · · Score: 0

      Jesus Christ.

      The level of retardation here is insane.

      Please describe for us the many methods lesbians can use to produce blood to blood contact.

      Answer that and you might just start to question the rest of your logic.

    7. Re: This is good news for faggots. by Anonymous Coward · · Score: 0

      Lesbians dont feltch each other anonymously in filthy public toilet blocks at 3am.

      Fags routinely fuck anything that moves. This is the exact reason why the fags started dying off in droves well before anyone else did. Their promiscuity and sexual perversions resulting in rectal tearing.

      Remember, AIDS was originally called GRID until the fag activist groups put pressure on the medical community to change the name, while the fruits were still the main source and pool of infections.

      Even the explosion through the IV drug using population can be traced back to fags and needles.

      Just think.... if we'd used a Final Solution to the fag and junkie HIV problem back in the 80's then millions of people would have been saved. I'm not saying gas them, but quarantine them and shut down their places of promiscious faggotry.

      Would you inconvenience thousands to save millions ?? I would. Then again, I am moral and ethical.

    8. Re: This is good news for faggots. by Opportunist · · Score: 1

      Explain again how it's in any way your business how two (or whatever number) of people fuck?

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    9. Re: This is good news for faggots. by Anonymous Coward · · Score: 0

      Even if they were felching at 3am there's no way for BLOOD TO MEET BLOOD. MORON.

    10. Re: This is good news for faggots. by Anonymous Coward · · Score: 0

      Dude, if the thought of gay sex disgusts then why are you thinking about it so much? It never crosses my mind, apparently it's a frequent flyer in yours. Just saying...

    11. Re: This is good news for faggots. by KingBenny · · Score: 1

      please don't encourage them ... they do have the right to speak
      sounds good to me, one more percent and i can fuck whatever the fuck i want without baby jesus racist nig--was that the lameness filter, ai ?-- ger bullshit freaks giving me aids or worse up my mommas arse

      --
      Free speech was meant to be free for all... how can anyone grow up in a nanny state ?
    12. Re: This is good news for faggots. by KingBenny · · Score: 1

      it clearly was

      --
      Free speech was meant to be free for all... how can anyone grow up in a nanny state ?
    13. Re:This is good news for faggots. by ebvwfbw · · Score: 1

      I was in College when that hit. I remember saying it was an epidemic, while the crazy left kept saying - no it's not, never can be. They said some BS about being against gays, I reminded them that the vast majority of patients were not gay. They happened to be black,however so it was a black/gay thing then. A year or so later the CDC announced it was an epidemic, which I took the paper and shoved it in their faces saying - see, told you so. Didn't they feel stupid? They said no. In fact I turned out to be right on the money.

      I don't think there is anything else that could have been done back then. I personally know some of the people that worked on those projects. We threw everything we could at it. In fact I'd say because it effected gay people and they were very vocal. Science today is way beyond where we were back then. It's like Cancer, we can do something about most forms now. Still can't cure the common cold.

  27. Oh Noes! by Ol+Olsoc · · Score: 1
    Fundamentalist Christians are going to be pissed! http://www.rightwingwatch.org/...

    God will now not only punish them there Qeeeayars, but the people who took away God's divine and loving punishment for them.

    But seriously, this is pretty good news.

    --
    The shepherds did so well protecting the flock that the sheep no longer believed that wolves existed.
    1. Re:Oh Noes! by Anonymous Coward · · Score: 0

      Fundamentalist Christians are going to be pissed! http://www.rightwingwatch.org/...

      God will now not only punish them there Qeeeayars, but the people who took away God's divine and loving punishment for them.

      But seriously, this is pretty good news.

      Haha cherrypicking the most extreme and retarded forms of religion and making fun of them is so easy. It's a guaranteed slam dunk! I mean, arguing with you would be like defending extreme religion, amirite?? Oh how very clever and original you are! As for your spirit of condemnation and patting yourself on the back for being so much smarter, at least all of that is intact. Whew! That was a close one. You barely managed: now you're on equal footing with those extreme religious types!

    2. Re:Oh Noes! by dave420 · · Score: 1

      Who'd have thought adults believing in sky deities would be fruitful grounds for humour? It's amazing! Don't these people understand that believing in a god because someone told you they exist and because it makes you feel good is the exact same as said god being demonstrated to exist?

    3. Re:Oh Noes! by Ol+Olsoc · · Score: 1

      Fundamentalist Christians are going to be pissed! http://www.rightwingwatch.org/...

      God will now not only punish them there Qeeeayars, but the people who took away God's divine and loving punishment for them.

      But seriously, this is pretty good news.

      Haha cherrypicking the most extreme and retarded forms of religion and making fun of them is so easy.

      Almost as easy as picking on those who defend them.

      It's a guaranteed slam dunk! I mean, arguing with you would be like defending extreme religion, amirite??

      Depends on the argument. If you argue if people have the right to believe anything they want to believe, nope, because that is a person's right. You on the other had, are making a weird defense of them, so I'm assuming you are defending their actions.

      Oh how very clever and original you are!

      Oh pshaw, you're making me blush! But thanks, I try to entertain people. But I couldn't do it without your help, so don't sell yourself short.

      As for your spirit of condemnation and patting yourself on the back for being so much smarter, at least all of that is intact. Whew! That was a close one. You barely managed: now you're on equal footing with those extreme religious types!

      I've always wondered when I get a post like this. Do you have these majickal conversations in your head where you have your enemy say outlandish things for you to skewer with your rapier wit and devastating riposts?

      As for equal footing with the far -right religious fundamentalists, it is the difference between people who actually take pleasure in other's illnesses, and people who don't, and find such poor examples of humanity as ripe targets for ridicule.

      Ya might consider that at some point, because you are in the ripe target group there me hearty AC.

      --
      The shepherds did so well protecting the flock that the sheep no longer believed that wolves existed.
    4. Re:Oh Noes! by Ol+Olsoc · · Score: 1

      Who'd have thought adults believing in sky deities would be fruitful grounds for humour? It's amazing! Don't these people understand that believing in a god because someone told you they exist and because it makes you feel good is the exact same as said god being demonstrated to exist?

      It is written that gawd made man in his own image, when it fact it is just the opposite. Some people who profess to be piously following their gawd's wishes are merely following the own hate in their minds.

      Because if your gawd just so happens to hate everything that you do, it is a sure sign you have created gawd in your own image.

      As I've noted before, people can have any superstition they want. I'll fight vigorously them trying to impose their faith on me, and any who profess that their gawd punishes people who don't follow his will, like visiting AIDS on the devotees of the bunghole, while allowing obvious grifters to reap huge benefits and health and wealth while fleecing people who thing they are following him, sorry, I shall ridicule that sort of asshattery until they kill me in the name of whoever the fuck they are claiming wants them to kill me.

      World without end, Amen.

      --
      The shepherds did so well protecting the flock that the sheep no longer believed that wolves existed.
  28. I want a to know... by Anonymous Coward · · Score: 1

    ...at what point does a man just stop and say "you know, I think I'd like to have a dick up my ass!"

    1. Re:I want a to know... by Anonymous Coward · · Score: 0

      I know a lot of idiots who can't be bothered with using turn signals...

      Which pretty much tells me that they have a subconscious desire for a huge chunk of steel and glass to ram them in the ass.

  29. the start of a war of a lot of sex by Anonymous Coward · · Score: 0

    buy now

  30. I'm not religious, I'm an atheist. by Anonymous Coward · · Score: 0

    And guess what, I'm glad I'm not a faggot.

  31. Great! by williamreview1 · · Score: -1

    How great to see this news. I am really hopeful about this https://williamreview.com/3-ma...

    --
    http://williamreview.com/