Slashdot Mirror


User: Guppy

Guppy's activity in the archive.

Stories
0
Comments
1,416
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 1,416

  1. Re:What exactly this Human Genome is at this point on Human Genome Project Believed Complete · · Score: 5
    That's funny, I tried looking at Celera's sequence, and got the following...

    >gi|8134254|ref|NT_001039|Hs22_451| Homo sapiens 22q11.2 sequence /len=1790785
    FIRSTPOSTAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAG GGAGATCTTATG
    AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGC TGTATTTTAGGT
    TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTG TACCCTTCT...
  2. The Genome actually has Five bases. Sort of... on Human Genome Project Believed Complete · · Score: 5

    As the HGP and Celera finish up the first draft of the human genome, I thought I'd mention a second interesting mapping project that's just starting up now.

    All life as we know it uses the same four bases in its genetic code, A, T, C, and G. However, there is a chemical modification known as methylation, which changes the structure and behavior of the base C, cytosine. Methylated cytosine is considered by some to be a "fifth" base. (Note--Adenosine can also be methylated, but mostly in prokaryotes only, I think). In mammals, about 2-5% of cytosine have this modification.

    The thing about methylation is that it doesn't affect base pairing, so G's will bind with either normal or methylated C's. The pattern of methylation can be preserved as DNA replicates, though, by the action of enzymes can methylate and de-methylate cytosines. The pattern isn't static, though. In some places it varies at different times, and sometimes may be altered in different kinds of tissues. So you get a changes which sometimes can be inherited, and sometimes not, all depending on how the patterns shift.

    Just recently, a European consortium known as the Human Epigenome Consortium (HEC) was announced to identify these methylation patterns. It's a task which is on the same scale as the HGP, but it's not as well known so I don't know if they'll be able to attract as much funding. Here's a link to an article on the HEC.

  3. Re:RAMBUS Sucks on Hidden Consequences: Rambus And DDR SDRAM Prices · · Score: 2

    "DDR memory, let alone QDR memory, will outperform RAMBUS to such an extent that all their billions will be wasted. -And I think that's pretty cool."

    Um, no. The recent patent developments mean that RAMBUS stands to earn even more from DDR (And possibly QDR) if it becomes the standard.

  4. Whatever happened to ESDRAM and SLDRAM? on Hidden Consequences: Rambus And DDR SDRAM Prices · · Score: 3

    There used to be several other types of memory under development for the next industry standard, some of which showed a great deal of promise. Two of these were ESDRAM and SLDRAM.

    ESDRAM was a type of SDRAM-like memory that included a small amount of SRAM cache on each chip which lowered latency, allowed for greater utilization, and also could boost bandwidth by allowing wider buses and moderately higher speeds. Here's an ESDRAM article at Lost Circuits.

    SLDRAM was, like RDRAM, a protocol based memory. Unlike Rambus, it was developed by an industry consortium, and was to be royalty free. It allowed for a faster bus, and could also be operated at a double data rate. Supposedly, in some situations it might have actually been faster than RDRAM. Here's a link to the SLDRAM Corporation.

  5. Rambus royalty rates? on Hitachi Folds, Rambus Keeps On Rolling · · Score: 3
    A Rambus investor claims that the rates listed below are typical (With some variation from company to company). This came from an investing bulletin board, so take it with a grain of salt.

    Controllers/Chipsets: 2-5%
    DDR: 2-3%
    RDRAM: 1-2%
    SDRAM: 0.5 - 1%

  6. Chasing paint flecks... on Nanosatellite Takes Out The Trash · · Score: 1

    The problem with this satellite is that it needs to go out, chase junk, match velocities, and then latch on and bring it down. With such a small satellite, I can't imagine it being able to carry much propellant.

    How many satellites are you going to need to bring down all those thousands of paint flecks and loose bolts? How many more bits do you think would be released if just one nanosatellite screwed up and got beaned by an orbiting wing nut?

    There are a bunch of other ideas out there that (at least on the surface) sound like they could be much more economical. For instance, a satllite that was just a giant block of aerogel. It would weight at most just a few pounds, and it would do nothing more than just sit out there for a few years, letting all those little particles embed themselves in the block until it was ready to be de-orbited.

  7. Safety Tip -- use a spotter with weights on Under-the-Desk Exercise Equipment? · · Score: 2

    "The fastest way to loose weight, and gain muscle is to lift weight. Preferably free weights..."

    For safety reasons, you should try to have a spotter watch over you when working with free weights, in case you lose control or get a cramp. It's really easy to hurt yourself, especially when you're first starting out.

    If you don't someone who can serve as a spotter around, a machine may be a little bit better because of the limited range of motion. I've also been wondering about machines like the Bowflex -- the lack of actual weights looks like it might make it a little safer, but I've never actually used one of those.

  8. Warning: Ethidium Bromide on Recombinant DNA For The Home Hobbyist · · Score: 5
    Before anyone here tries actually running this, note that (as stated in the article), Ethidium Bromide is toxic and mutagenic. Ethidium Bromide is an intercalator, which means it binds itself to DNA in the spaces between base pairs (thus gumming up DNA replication). Small amounts can be disposed of down the drain, but you probably should neutralize it instead.

    Incineration: Ethidium Bromide can be destroyed by burning. I wouldn't advise you to just chuck it on a fire, though, but an incinerator should probably be fine.

    Adsorption: You can adsorb Ethidium Bromide with activated carbon (Like the kind you use for aquariums). I've heard that 100mg of activated carbon is sufficient for 100mL of Ethidium Bromide staining solution.


    Here are also two ways to destroy Ethidium Bromide chemically. One is uses reagents that are harder to get (but does a better job), while the second uses ordinary bleach (but the destruction is less complete).

    Lunn and Sansone method:
    Dilute solutions containing EtBr to concentration less than 0.05% w/v (50mg/100mL). Add 20mL of fresh 5% hypophosphorous acid and 12mL of fresh 0.5M sodium nitrite solution per 100mL of EtBr solution. After at least 20 hours, neutralize with sodium bicarbonate, then dispose of down the drain. Note that the sample will give off poisonous nitrogen dioxide during neutralization.

    Armour Method: Dilute solutions containing EtBr to concentrations less than 0.034% w/v (34mg/100mL). Add 10mL of fresh bleach for every 1mg EtBr. Stir at room temperature for at least 4 hours. The EtBr is converted to the physiologically inactive product 2-carboxybenzophenone, and the solution should then be rinsed down the sanitary sewer with water.


  9. Re:Bad boys, bad boys, whatcha gonna do? on Recombinant DNA For The Home Hobbyist · · Score: 2

    Mommy! Mommy! I just sequenced my DNA, and it doesn't look anything like Daddy's!

  10. Money saving tip for Amateur Scientists on Recombinant DNA For The Home Hobbyist · · Score: 3

    For those of you who might actually be compelled to try this at hope, here's a tip to save a little money. Scientific supply companies will frequently provide free samples for disposable equipment, like pipette tips or eppendorf tubes -- and there are a lot of scientific supply companies out there, so lather, rinse, repeat.

    I had a (poorly funded) professor who kept her lab going for weeks with freebies. Sometimes she even managed to weasel out some more expensive items, like a free sample of Taq polymerase.

  11. Are we all just gear makers? on Gears, Computers And Number Theory · · Score: 3
    "Working through examples of Brocot's process by hand, and leafing through the pages of the printed Brocot table, leaves me feeling wistful and uneasy. The ingenuity and diligence on exhibit here are certainly admirable, and yet from a modern point of view they are also tinged with a horrifying futility. I am reminded of those prodigies who spent years of their lives calculating digits of the decimal expansion of pi--a task that is now a mere warmup exercise for computer software..."


    After reading through the Scientific American article, I suddenly found I wanted to re-read The Story of Mel again, the tale of a programmer's programmer from an era gone by. Our old-timers often lament the extinction of code laboriously hand-tuned to run tight and fast on elegant machines from days gone by -- and those days have been gone only a few decades. The gear makers worked their craft a century or more ago.

    Today, sometimes I wonder, what was the point? Why not just shovel in and ship out the first thing that works? A year and a half from now, the hardware will be twice as fast, and probably cost half as much. The software we wrote will be obsolete, as will be the hardware it ran on.

    But maybe it does matter. It would be a terrible thing if our decendants did not surpass us. But even as they gaze back upon us from those lofty, distant heights, maybe we can give them a reason to listen to how it was done in the Good Old Days.



    "Lest a whole new generation of programmers
    grow up in ignorance of this glorious past,
    I feel duty-bound to describe,
    as best I can through the generation gap,
    how a Real Programmer wrote code..."

  12. Re:What's the limit on gear trains? on Gears, Computers And Number Theory · · Score: 2

    "...Many years ago, I remember having a set of Lego Technics..."

    After reading your post, I could only wonder... How would Legoland history be different if Mindstorms had never been invented? Imagine an alternate future, in which the Lego Babbagestorm basic kit comes with 10,000 pieces (9,900 of which go into the differential engine).

  13. Imagine this scenario... on Watch Le Mans From Inside Le Car · · Score: 2

    [Long-distance shot of cars going around a racetrack, while the soundtrack plays a groovy wocka-chika beat. The camera zooms in to follow a beat-up station wagon on the track, its hood emblazoned with the "Intel Inside" logo. Behind the wheel is a geeky looking middle-aged guy.]

    [The Intel driver accelerates up to a pack of formula-one race cars, emblazoned with AMD symbol and "Athlon 1 GHz" logos. The guy cracks a goofy grin and gives a thumbs up to the other drivers, who frown, peel rubber, and leave the station wagon in the dust. The station wagon begins sputtering, the hubcaps fall off, and the car breaks down in the middle of the racetrack.]


    Announcer: "Can't do it in real life? Do it on the web." [Intel theme plays]

  14. I'll watch this for the same reason... on Watch Le Mans From Inside Le Car · · Score: 1

    ...that I watch every other race. In the hopes that I'll catch a glimpse of a flaming crash, of course, this time from a first-person-view.

    I swear, you could loop a few minutes of tape, occasionally edit in a fiery pile-up once in a while. It would look just the same, and you wouldn't have to pay for all those expensive racecars. Yeah, it would be fake, but so is Pro Wrestling, which I imagine will share a good portion of the target demographic.

  15. Power Consumption info for notebook components on New Power-Sipping Chips From Intel · · Score: 3

    Here's a chart I put together from Intel's Mobile Power Guidelines Rev. 1.00, which lists target power consumption values for notebooks. I've included Intel's numbers for the Maximum, Minimum, and Average (when running Winbench 3D) power consumptions, in watts.

    Please excuse the formatting, Slashdot seems to strip out extra spaces, so I put in underscores. Plus, I'm also having trouble with the lameness filter.

    _____________________ Mini Notebook_______ Full Size
    _____________________ Max__Min___Ave___ Max___Min___Ave

    CPU & L2 Cache ______ 6____0.36__5_____ 12____0.36__9.5
    Memory Controller ___ 2.1__0.05__1.4____ 2.4__0.3___1.6
    System Memory _______ 1.3__0.35__0.7____ 2.5__0.35__1.3
    Graphics Subsystem __ 1.4__0.2___1.0____ 3.0__0.8___2.4
    IO Subsystem ________ 2.0__0.04__0.5____ 2.68_0.4___0.6
    Audio _______________ --___0.7___--_____ --___1.6___--
    Modem _______________ --___0.3___--_____ --___0.4___--
    Hard Drive __________ 6____0.1___1.4____ 6____0.1___1.3
    DVD Drive/CD ________ --___--____--_____ 6____0.2___1.4
    1394 Controller _____ --___--____--_____ 1.2__0.003_--
    CardBus _____________ 2.5__0.67__--_____ 5.0__0.67__--
    USB _________________ 2.5__0.0125--_____ 2.5__0.0125--
    LAN _________________ 0.6__0.4___--_____ 0.6__0.4___--
    Power Supply ________ --___1.5___--_____ --___2.6___--
    Cooling _____________ --___--____--_____ --___0.5___--
    Other _______________ --___0.8___--_____ --___1.0___--
    LCD _________________ 3.05_--____2.8____ 4.75_--____4.3

    SYSTEM Average____________16.7_______________29.1

    The high maximum value for the hard drive comes from the power required for the initial spin-up. I didn't see a listing for separate L2 and CPU power consumptions, but as you can see, together they take up about 1/3 of the average power consumption in a full-sized notebook, with the graphics system (chip plus screen) being one of the components that takes up another big chunk.

  16. OT: The TRGPro Palm clone and music? on Pilot Synthesis · · Score: 2

    Just curious, would any of the midi-based solutions be capable of playing back using the speaker on a TRGPro? It's a clone that licenses the PalmOS (Kind of like the Handspring Visor), but it claims to have some nifty extras, including "enhanced audio".

    It also comes with a slot for compact flash cards. Hmmm... TRGPro + 340MB IBM Microdrive + Dragonball processor + "Enhanced Audio"... mp3s?

  17. Toshiba and the floppy drive lawsuit... on Rambus Gets Toshiba To Sign Patent Concession · · Score: 5

    I'm not surprised that, of all the memory manufacturers out there, Toshiba settled first. Back in Nov '99, they settled a $2.1 Billion dollar class-action lawsuit over a minor floppy drive problem.

    I recall that some analysts explained that Toshiba settled because they were, afraid of the potential of a runaway lawsuit that could have produced far greater losses (which boggles the imagination). The same lawyers (who walked away with an obscene pile in this case) have also gone after other companies (Such as Compaq) that had similar floppy drive problems, but in these cases the accused companies have decided to fight it out.

  18. Re:iMarketing on Linux On iPAQ 3600 Handheld · · Score: 1

    Does any of that actually make sense? I especially like "Touch it, Feel it, Believe it".

    I especially like the line, "Fit in, Standout". Huh? That's the sort statement I think would go over great with teen fashion sheep, the kind that go for Tommy Hilfiger. Express yourself by mixing-and-matching consumer goods from the same selection of mass-produced, mass-marketed items all your other friends have.

  19. When is Intel going to start following Microsoft? on Is The x86 Obsolete? · · Score: 2

    Of course the x86 is obsolete, but Intel hasn't yet figured out it could make buckets of money following Microsoft's lead, by making PC users upgrade -- first to x95, then x95 OSR2, then x98, and now x98 SE.

    :)

  20. What constitutes an x86? on Is The x86 Obsolete? · · Score: 1

    I think that the legacy of the x86 will continue long after x86 chips are dead. Right now, modern chips like the P6 and Athlon can already be considered to have a RISC-like core. In the future, exotic architectures like Transmeta's Crusoe may become common -- but they'll still be able to execute x86 instructions.

  21. The real reason for putting this on Gnutella? on SightSound To Distribute Films Via Gnutella · · Score: 2

    Some folks here are already screaming "Gimmick". That's almost certainly true, but I imagine there's another reason for doing it.

    Serving up video takes up a lot of expensive bandwidth. Why not let someone else do the serving for you? As an added plus, should SightSound's movies actually become popular, the number of people willing to host the files will increase, thus automatically scaling up the bandwidth accordingly.

  22. I suppose it's too much to hope for... on AOL To Open AIM Protocol? · · Score: 2

    ...that after the AIM protocol is opened, that AOL will suddenly be flooded with clueless newbies?

  23. A possible commercial use for this... on Avatar Me: Photorealistic Quake Skins · · Score: 1

    So, when is Playboy going to start including a CD-ROM with Killcreek skins? And even better, appropriate "weapon" mods (Hmm... BFD, anyone?). I think we can leave some of the kill messages unchanged, however -- they actually seem pretty approriate for something like this.

    "This is my rifle, this is my gun. This one's for fighting, this one's for fun..."

  24. Photorealistic Skins and Gender on Avatar Me: Photorealistic Quake Skins · · Score: 4

    I think this may have some interesting implications in how photorealistic skins impact gender and gaming. Looking back at an article from last February, Men Playing as Women, you'll find some really interesting replies in the comments section that apply here as well.

    For instance, a photorealistic skin doesn't guarantee that the person you're playing with actually was the model for that skin, and thus there's no guarantee whether he/she actually is male or female. But players may be more willing to believe in an assumed gender (even if only on a sub-concious level) when it looks like a real-life person.

    For instance, Gender can be used for in-game advantages -- some Males may hesitate to shoot a female, others become more hostile if killed by a female. Females may pretend to be male to avoid being hit on or harassed, and both sexes may pretend to be opposite genders for role-playing or exploration reasons. Take a look at the old article, there are a lot of interesting ideas in it.

  25. First, we order about 10,000 of those Lego men... on Lego Institutes Bulk Ordering · · Score: 1

    "...what do people think the coolest thing to build would be?"

    First, we order about 10,000 Lego men. Next, we order sufficient pieces to equip them all with Lego Machine Guns.

    Now we invade Legoland. I think we'll start with the Lego Kingdom, those primitive little knights and archers don't stand a chance against our overwhelming firepower. Next on the list are the happy citizens of Lego Town, all they can field are a few policemen.

    The Space guys are going to be a problem, as they posses highly advanced technology, like Galaxy Commanders and StarFleet Voyagers -- but by that time, we'll have captured and assimilated the pieces from the medival and town sets.