Slashdot Mirror


Human Genome Project Believed Complete

wecoyote writes ABC News has an article on the completion of the Human Genome Project. Apparently, there is supposed to be a presidential announcement this morning regarding the accomplishment. "

187 comments

  1. Presidential assistance by akey · · Score: 2

    The article fails to mention that President Clinton has been one of the most prolific supporters of the Human Genome Project. The "dress stains" alone probably cut 2-3 months off of the total time to completion, and hence it is only fitting that he be allowed to make the announcement.

    ---

    --

    ---
    "Go Metallica. Die RIAA." -- Linus Torvalds
  2. yippee by ^chuck^ · · Score: 1

    Let the patent wars begin!

    --

    Lemure, wtf! Don't you mean Lemur?
  3. Cool... by Maddog_Delphi97 · · Score: 2

    Does that mean we can get rid of the "first post" gene?

    1. Re:Cool... by funkman · · Score: 1
      I'd rather get rid of the troll gene.
      Or the "Me too" gene.
      OR THE I AM ALWAYS SHOUTING GENE
      Or the I'll be cute gene;-)
      wecoyote writes ABC News has an article on the completion of the Human Genome Project. Apparently, there is supposed to be a presidential announcement this morning regarding the accomplishment.
      Or the pointless pasting of message gene.
      Or the I forgot to close my HTML tag gene
  4. gnome and gEnome by MicroBerto · · Score: 1

    I wonder if the genome team uses gnome because they're spelled so similarly...!

    Mike Roberto (roberto@soul.apk.net) -GAIM: MicroBerto

    --
    Berto
    1. Re:gnome and gEnome by dones · · Score: 1

      As a matter of fact, in the July 2000 Scientific American, p. 49, there is a story about President Bush's announcement in 1989 of the Human "Gnome" Initiative.

  5. Pengiun? by Girf · · Score: 1
    So does this mean that now they can isolate the gene that is responible for us being human and change it so we now are all pegniuns?

    Or maybe it would be better if I stuck to eating my pegniun mints, and sleeping with my stuffed tux at night...

    --

    Apathy -- The state of numbness of the mind. When you are apathic, you can think.

    1. Re:Pengiun? by tve · · Score: 1

      The people of Atlantis already did this. Where did you think al the penguins came from? Duh!

      --

      If there is hope, it lies in the trolls.
  6. changing projections by sylvester · · Score: 1

    I seem to remember this project having a projected completion date of 2001 or later. Does anyone know how the projections changed as computing power and the analysis techniques got better?

    1. Re:changing projections by erroneous · · Score: 1

      Hardly hi-tech but this comes direct from BBC News :
      "The rough draft has been completed several years ahead of schedule thanks to the introduction of new robotic technology and the competition Celera gave the HGP when it started work in 1998."

      --
      erroneous: look me up in a dictionary
    2. Re:changing projections by Graham+Clark · · Score: 2

      "The rough draft has been completed several years ahead of schedule thanks to the introduction of new robotic technology and the competition Celera gave the HGP when it started work in 1998."

      The way we're being forced to do it to try and minimise the genome's exposure to patent applications is completely necessary, but an utter pain in the arse. Most of the sequencing is being done in two phases - first producing a "draft" at reduced accuracy, and then going back to resequence each area and eliminating problems in a second pass. This is not the way anybody wanted to do it, but hopefully this second part will be finished on schedule by 2003.

  7. UK hails "gift to humanity" by erroneous · · Score: 2

    http://news.bbc. co.uk/hi/english/sci/tech/newsid_805000/805803.stm

    This is widely being reported in the UK lunchtime news bulletins right now. I note that the Wellcome Trust and the Human Genome Project of which they are a member hail this breakthrough as a "great gift to humanity" and that Celera, the US corporation providing alternative research, wants to patent it all.

    --
    erroneous: look me up in a dictionary
    1. Re:UK hails "gift to humanity" by TheSencho · · Score: 1
      Don't forget the US National Institutes of Health were as major a player, if not more, than the Wellcome Trust in the Human Genome Project. And they'd like to see the genome be public knowledge as well.

      As for Celera, they are a company after all. And any corporation needs to make a profit. That's just the way of the world. However, I really hope they aren't granted any patents on this research. Why? Patents should be given for innovations, and not when a company/institute/person uses an automated machine to scan the material with no real oversight by scientists.

  8. Thank god for that!! by Barbaq · · Score: 1

    I think all human beings should be thankful for the Human Genome Project, for if it has truly won the race to map the human genome then they may well have saved the human race trillions of dollars in medicine's that come as a result of gene therapy. They have also guaranteed the free use of the genome for science.

    --
    Never believe in anything until it has been officially denied. -Otto von Bismarck
  9. we have the technology by ^chuck^ · · Score: 2

    We can rebuild Linus, we have the technology. We can change him, make him better. Give him yellow feet, and a prehensile tail [to write code faster]. Super sonic hearing, to stay to steps ahead of the evil redmond empire. Better sight to see the transmeta code in a new light. And strength of titanium, because that would be cool.

    --

    Lemure, wtf! Don't you mean Lemur?
    1. Re:we have the technology by grammar+nazi · · Score: 1

      The grammar nazi supports genetic tampering. We can finally build a race of Uberhumans!

      We can start by fixing ^chuck^'s grammar gene. For a start, he needs to capitalize Redmond. Although he seems to have a strong vocabulary (prehensile was excellent), he is unaware that plain steel is much stronger then titanium (generally speaking). Perhaps the physics is outside of the grammar nazi's realm, but I'm a little worried about super sonic hearing. How can one hear sound faster then sound? I don't think that this would allow Linus to hear into the future. Increasing Linus's clairvoyance gene would be a better idea.

      --

      Keeping /. free of grammatical errors for ~5 years.
    2. Re:we have the technology by commanderfoxtrot · · Score: 1

      Perhaps he meant super sonic in the Latin sense id est beyond the realm of sound... This could mean he already has a clairvoyant's gene.


      (But does he have Levi's too?)

      --
      http://blog.grcm.net/
    3. Re:we have the technology by Defiler · · Score: 1

      Super-sonic hearing would allow you to detect ("hear") the perturbations of air molecules directly, through some sort of "seventh sense."
      The net effect would be to enable to you hear events long before the actual sound wave reached you. You could dodge sniper bullets from across a football field.

      Titanium is a fun choice for an endoskeleton because you don't have to worry about the excessive weight of steel.. It's all about your power/weight ratio.. I think foamed aluminum would be a better choice, honestly. ;)

    4. Re:we have the technology by ^chuck^ · · Score: 1

      bruhha, the grammar nazi requires his grammar checking gene to checked into! ^CHuCK^ ignores it, does not need it, nor ever will. You missed the fact that "to stay to steps ahead" should have been "to stay _two_ steps...."

      Grammar nazis suck, NARF!

      --

      Lemure, wtf! Don't you mean Lemur?
    5. Re:we have the technology by underpants+troll · · Score: 1

      I say we start the Grammar Nuremburg Trials as soon as we can. Trolls unite! hang the grammar nazi!

  10. Spelling error? by kwsNI · · Score: 2
    Isn't that supposed to be the "Human Gnome Project"?

    I'm sorry. I just couldn't resist.

    kwsNI

  11. What's next? by zombieking · · Score: 1

    A geneticly engineered five assed Bill Gates?
    Just think of all the crap that would come from Micro$oft then....

    --

    -----
    "The only difference between me and a madman is that I'm not mad." - Salvador Dali (1904-1989)
  12. Alpha Centauri by Anonymous Coward · · Score: 3
    Human Genome Project completed! +1 talent at each base. The governor of "washington, dc" is asking you to initiate a new Secret Project, The Virtual World!

    Allow the governor to initiate a secret project
    Disallow the project, and tell the governor to interest himself in "sensible things"
    Cancel the project

    OK

  13. fabulous by waterhouse · · Score: 1

    so when do i get my third arm? oh the things i could do with that arm. imagine the stability improvements when standing on one's head! the benefits for society are limitless.

    --

    1. Re:fabulous by JimPooley · · Score: 1

      That third arm would really improve your ski-boxing...

      --

      "Information wants to be paid"
  14. caveats... by garnier · · Score: 2

    So the HGP and Celera have managed to sequence the geonome of a single person. This doesn't really address the fact that there are variations on genetic sequences even those that code for important proteins. Some of these variations cause problems but others don't. Although HGP is attempting to sequence the geonome's of 4 different people in other to get this variation, this doesn't really capture the distributions across different ethnic groups. Getting that is problem that is even larger than sequencing a few geonomes.

    Another problem I see is that even if we are able to sequence the genetic code for all the proteins, what are we going to do with them. Identifying genetic diseases before they occur is all well and good but is it really that valuable if all we can tell people right now is that twenty years down the line you're going to get Hunington's disease or someother incurable ailment and die?

    The outlook for coming up with effective genetic therapies is pretty bleak. We haven't really been able to treat even the diseases that are purely genetic and are caused by a well defined mutation. With this sort of track record how are we going to do against diseases that are caused by multiple mutations or where different individuals with the disease have different mutations? And this isn't even considering diseases that are caused by interactions between interactions between the gene and environment/history of the individual or disease caused non-genetic inheritance.

    It seems like alot of people see genetics as a panacea for all human ills. However this overlooks the fact that the environment is just as important as genetics. In some respects, the attention that whole gene therapy is getting resembles the hype that surrounded radiation in the early 20th century when radiation was going to cure anything and everything.

    1. Re:caveats... by Graham+Clark · · Score: 1

      This doesn't really address the fact that there are variations on genetic sequences

      This is also under investigation by both the HGP and Celera. The number identified is measured in tens of thousands, and will keep increasing rapidly for a good while.

      The outlook for coming up with effective genetic therapies is pretty bleak. We haven't really been able to treat even the diseases that are purely genetic and are caused by a well defined mutation.

      Well, that's not really true. X-linked SCID is one of the frontrunners in this area, and it's just reaching actual use in actual patient - only one or two so far, I believe, but the experiment seems to be going as well as could be hoped for. These things are obviously going to take a while to reach the real world, but just because they're not in use yet doesn't mean that they're not on their way.

    2. Re:caveats... by Anonymous Coward · · Score: 1
      So the HGP and Celera have managed to sequence the geonome of a single person. This doesn't really address the fact that there are variations on genetic sequences even those that code for important proteins. Some of these variations cause problems but others don't. Although HGP is attempting to sequence the geonome's of 4 different people in other to get this variation, this doesn't really capture the distributions across different ethnic groups. Getting that is problem that is even larger than sequencing a few geonomes.

      It's far more problematic than that. The HGP, for political reasons, isn't sequencing 1 person. They're sequencing a chimera constructed of anonymous samples from 12 people (and counting).

      As for diversity, that's what the Human Genome Diversity project is for. Unfortunately, it's pretty much dead, all in the name of political correctness.

    3. Re:caveats... by arivanov · · Score: 4

      No caveats. Sorry.

      Variations in the hunan genome has been subject of very intensive research since end of 1980-ties. The so called Restriction Length Polymorphisms have been used as a primary method for genetic diagnostics since and they are nothing but a manifestation of these variations. The exact differences are also usually well known. The data there can be correlated and joined with HGP. There will be need for additional research but no real caveat here. It is not as bad as you describe.

      Lots of math tough... Grin...

      --
      Baker's Law: Misery no longer loves company. Nowadays it insists on it
      http://www.sigsegv.cx/
    4. Re:caveats... by Kintanon · · Score: 1

      It seems like alot of people see genetics as a panacea for all human ills. However this overlooks the fact that the environment is just as important as genetics. In some respects, the attention that whole gene therapy is getting resembles the hype that surrounded radiation in the early 20th century when radiation was going to cure anything and everything.


      Well we bloody well have to start somewhere now don't we?! Geez, be patient, they've really just started looking into genetics, if it takes another hundred years to figure out how it all works we'll still be doing good. Yeesh, No one is claiming this is the be all end all of medicine, but it's a damn good step in the right direction for understanding how our bodies work.

      Kintanon

      --
      Check out JoshJitsu.info for Brazilian Ji
    5. Re:caveats... by garnier · · Score: 1

      I do not think you see my point. 100 years ago, people thought that radiation would would cure everything. But it didn't: not then, and not now 100 years later.

      Again people are making the same mistake, they say that genetic treatments will cure everything, ignoring other factors such as the environment. I agree that it has very big potential, but we should be more cautious before making such statements.

      Philippe.

    6. Re:caveats... by davebooth · · Score: 2

      There is, of course, one non-scientific obstacle to effective treatment for genetic disease. Whilst it is becoming ever more possible to detect and treat genetic defects on a somatic basis the net effect of this is to increase the percentage of the population that carries the gene in question. Germ-line genetic therapy will never be allowed to happen. The right wing condemn it as being man "meddling in Gods domain" the left wing paint a "brave new world" style apocalyptic vision based on institutional abuse of the technique. With todays techniques this leaves only pre-natal detection of genetic abnormality and guess what.. now we hit the abortion debate. So where can we go in the future? Probably gamete screening is possible but I predict the same problems with that as with germ-line therapy. Sad to say there is more FUD spread around on the subject of molecular genetics than has ever been generated in Redmond....
      # human firmware exploit
      # Word will insert into your optic buffer
      # without bounds checking

      --
      I had a .sig once. It got boring.
    7. Re:caveats... by Kintanon · · Score: 1

      Again people are making the same mistake, they say that genetic treatments will cure everything, ignoring other factors such as the environment. I agree that it has very big potential, but we should be more cautious before making such statements.



      Show me who is saying this is a cure all for everything? Everyone is saying it has huge beneficial possiblity, and could mean the end of many diseases and defects. Those statements are true. It COULD be. Radiation has done a lot of good in treating things like cancer. It didn't cure it all, but it helped a lot. And if someone had said, 'Well, it didn't cure everything, so lets just forget about it.' we'd be worse off for it. I have yet to see one statement to the effect that this is a complete cure all for disease and defect.

      Kintanon

      --
      Check out JoshJitsu.info for Brazilian Ji
    8. Re:caveats... by jackb_guppy · · Score: 1

      This is pure Caveats.

      Their maps will not tell anyone why I am 6'7", why my brothers are 6'2", 6'4" and 6'10".

      It at *BEST* will tell that my AGT on the 3rd gene from the left at the 10,000th atom is different from the source sample. Period.

      A few million more random samples and you might find a fragment of my family's unique DNA in the map.

      What they have today is a kin to the map of the world on display in the Vatican date 1497. Yup there is land to west and it ain't the the east.

      Just look at how well it works to take simple information, (yes DNA based in simple information - 4 state machine design) and get the wrong answer.

      Earth, Mars and Saturn were all formed millions of years ago from the dust that was circling the sun.

      So Earth, Mars and Saturn must look the same, right? All must have life looks like us, right?

      Yeah, they are a little different in size, but so are my brothers.

      Now for another 200 years for searching in the dark with a flashlight without batteries.

      jackb

      Also, Math ain't tough... just poorly used.

    9. Re:caveats... by Defiler · · Score: 1

      This is BS.. Even if I have to fly to a hospital in Malaysia, nothing can stop the march of medical progress. If politics and religion stops people from improving themselves beyond their hunter/gatherer genetics, then that will just place them under the feet of those who aren't afraid of a little "re-design."

    10. Re:caveats... by BenByer · · Score: 1

      Yes, you are correct, there will be lots of resistance to gene testing. Another problem will be insurance. It will be cheaper to insure only "perfect" people (maybe/maybe not, but I bet that is what execs will think) This will disenfranchise many people. The government will become the insurer of last resort. Maybe America will see national healthcare.

    11. Re:caveats... by BenByer · · Score: 1

      Logic aint tough, just poorly used. There are sequences that are the same in every person. The variations in DNA that distinguish people are small and rare. You and your kins height is probably affected more by environment than DNA.

    12. Re:caveats... by scheme · · Score: 2
      I do not think you see my point. 100 years ago, people thought that radiation would would cure everything. But it didn't: not then, and not now 100 years later.

      Your point? Seeing as how I wrote the post top level post which you decided to copy, I don't think you really have any cogent point on this topic.

      --
      "When you sit with a nice girl for two hours, it seems like two minutes. When you sit on a hot stove for two minutes, it
    13. Re:caveats... by waxline · · Score: 2

      > Variations in the hunan genome has been subject
      > of very intensive research since end of 1980-ties.

      I'm happy for all the Chinese people this will help, but what about me?

    14. Re: caveats... by ponos · · Score: 1


      Not many people understand the nature of this work and its possible uses.

      Mapping the genome will primarily fuel research, making the life of researchers much easier.
      What this mapping has achieved is to find the
      areas of DNA that actually contain information.
      Thus, many billions of DNA bases have been ruled out as the cause for disease (even if they do play
      a role in supporting the overall DNA structure etc)

      The search for genetical variations proceeds in
      parallalel at a different level, and already one
      can try to search for e.g. p53 protein variants
      in the GenBank. Less important proteins might not
      show, however, but they and their variants will be discovered in time if the particular genetic locus has medical significance.

      It is already possible (but not economically
      feasible) to monitor a newborn for hundreds of
      diseases but this is extremely costly and the
      diseases are so rare, that we would be spending
      (quoting a calculation from a book) e.g. 350K
      dollars in prenatal and other checks to find a
      single child with cystic fibrosis (if I remember
      correctly). All diseases caused by a single
      gene, esp. the fatal ones, are so damn rare that
      there is no point in using existing technology
      to find them.

      On the other hand, common diseases are promoted by
      a multitude of factors, possibly including genetic
      variations (susceptibility to smoke causing obstructive lung disease, susceptibility to alcool
      causing cirrhosis). These diseases are frequent,
      but the genetic background is not strong and not
      causative, and therefore it is difficult to find
      responsible genes. IF, however, we had the ability
      to detect variations that would make a person more
      sensitive to smoke then we could tell this particular person to quit smoking and that would be very effective.

      I believe that the main use (and propably the only
      ethical one) of genetic screening would be to discover sensitive subpopulations and allow for
      efficient preventive medicine in these populations.

      (note that the affordability of preventive measures always has to do with the frequency of
      the disease! if we knew the high-risk subpopulation then it would much more cost effective to apply preventive measures to it, than to the general population, because the frequency of the disease is high in the sensitive group and preventive measures "pay off")

      As for the possibility to >curecurrent uses of
      genetic knowledge in everyday medicine. I'm quite
      sure that the HG map will be an important step
      in integrating low level molecular data with
      high level clinical response and treatment.

      Petros

      P.S. My message looks awful. Shit.

  15. Didn't this construct a building in... by Ron+Harwood · · Score: 2

    Civilization? I remember it rezzed in... it was one of the "wonders of the world"...

    I can't remember what effect it had on the game though...

    1. Re:Didn't this construct a building in... by Spudley · · Score: 1

      Yes, it was the Cure for Cancer "wonder of the world". Increased happiness in all your cities.
      <sigh> If only it was really that easy.

      If I'd designed Civilization, you'd have had an extra population type called "lawyer" (to go with the taxmen, entertainers and so on they had), which would do nothing but drain resources and divert otherwise useful members of your population from actually doing anything constructive.
      Getting the "genetics" tech advance would have doubled the number of lawers.

      --
      (Spudley Strikes Again!)
    2. Re:Didn't this construct a building in... by stx23 · · Score: 2

      It's in Alpha Centauri with the effect of one extra talent per base, but I don't remember it in any of the Civ(I,II,CTP) versions. However, I may well be wrong.

    3. Re:Didn't this construct a building in... by luckykaa · · Score: 1

      If I'd designed Civilization, you'd have had an extra population type called "lawyer"

      Not quite the same, but apparently there's a lawyer unit in Civ: Call To Power. Quite a useful unit too by all accounts.

  16. Human Genome 1.0 by Dungeon+Dweller · · Score: 2

    Yeah, but I'm waiting for 1.2, which is supposed to fix that whole 3rd arm bug, as well as allow for customization of several body parts and mental abilities.

    --
    Eh...
    1. Re:Human Genome 1.0 by Kristopher+Johnson · · Score: 1

      And it's rumored that 1.2 will be released under an open-source license!!!

    2. Re:Human Genome 1.0 by aleksey · · Score: 1

      ... and 1.2 will be themable too!

      --
      --
  17. Break a leg... by tofus · · Score: 1

    Wow; Does this mean i can order my extra leg now?

  18. What now? by CBOS · · Score: 1

    I'm a little worried about some of the outcomes of this. What if before you were born a doctor was able to tell your parents that you would be blond, 6'2, and suffer from a number of things that they have defined as defects. Would your parents want a child that has bad eye sight? Would they want to deal with your addictive personality? What if they had the ability to tweak your code before you were born and decide what to keep and what to bring back to the norm that they have decided is right. Don't get me wrong this is a huge achievement but the real question is what to do with this information now that it is available.

  19. Will the two maps be combined? by stx23 · · Score: 3

    Given Celera's previous glitch, will the two Genome maps be combined and compared to give a better idea of overall accuracy, or will one be pandering to the private Sector, the other to the public sector?

    1. Re:Will the two maps be combined? by Magic5Ball · · Score: 1

      The scientific speakers at the pre-announcement announcement this morning spoke of comparing the two sets of maps.

      --
      There are 1.1... kinds of people.
  20. But what does 'mapping the genome' really mean? by jdawson · · Score: 2

    I have never understood what it means to 'map the genome.' Have they gotten a complete GATC sequencing for one person's DNA? If so, how will this help with all the coming miracle cures the media always mentions. It would make sense to me if we had gotten a GATC sequencing for a large statistical sampling of people so we correlate epidemiological data with genetic data; but this doesn't sound like what the media is always talking about. So what's really up?

    1. Re:But what does 'mapping the genome' really mean? by Graham+Clark · · Score: 1

      This means that there is a reference sequence covering 95-97% of the human genetic complement. It doesn't in itself address the variation between individuals, although this is also being investigated in separate projects. Matching specific sequences to specific disease predispositions is being researched in yet another project . . . but the reference sequence is necessary to make much sense of any of these others.

    2. Re:But what does 'mapping the genome' really mean? by Old+Wolf · · Score: 1

      Remarkably, all humans (and in fact, all known life) shares the same DNA structure.
      The genome project is like a large dictionary (which lists the words, but the meanings are not filled in); in other terms, it lists all possible arrangements of DNA, but this is like a race to the start line, now they have to actually figure out what each sequence means.

    3. Re:But what does 'mapping the genome' really mean? by jlovette69 · · Score: 1

      Yes, that is what it means. They have the whole GATC of a person (actually 4 people I think).

      What needs to happen before we can effect any real change on the genetic level is a thorough understanding of where each gene IS. For example we might want to know that eye color is on the 20th chromosome, about 1/3 of the way up. Once we learn where all these genes are (hair color, eye color, "height", etc) we match the GATC sequence to that region of that chromosome and bingo - we can now effectively change gene's and what they produce.

      There are a lot of inherent problems though. DNA codes only for proteins so you are at a fundamental loss to change those things that aren't proteins. The best that you can do is modify the enzymes (which are proteins) that in are responsible for the non-protein characteristic (for example you could change the enzyme that "makes" fat so that it would synthesize fat more slowly, but you can't alter the fat itself).

      Another problem is that organisms that reproduce sexually are notorious for having complicated chromosomes. During Prophase II of meiosis the chromosome "cross-over" - they basically switch places. The sequence of GATC is conserved but the order may be screwy. This is the reason why there is such variation in sexually reproducing organisms.

      Another problem is the issue of multi-factorial phenotypical expression. Some things (like eye color and "height") are not located on one chromosome, but instead may involve different regions of several chromosomes. Decoding these multi-factorial genes is going to be a real pain in the ass.

      There are also going to be a lot of surprises. We have no clue about how some of the more complex biochemical pathways that run our body (and especially our brain) so we are assured of the fact that we will find the "directions" for enzymes and proteins that we never discovered. What has to happen is that we need to corrolate all of our research to get the different fields to mesh together properly.

      --


      I like food.
    4. Re:But what does 'mapping the genome' really mean? by Titus · · Score: 1

      No, they *haven't* sequenced the entire genome. They've just roughed out a scaffold for filling it in. The article doesn't give details, and it's not being announced in the scientific literature because it's more of a publicity stunt than anything else, so I can't tell you exactly what's going on, but they don't have the full ATGC sequence of even a single individual. However, a significant part of the sequencing process for Celera, at least, who is using "shotgun sequencing", is assembling the sequence in the end and avoiding overlapping efforts. That's the stage they're at -- knowing where the pieces they're finishing up are located. --titus (yes, the article is misleading. the actual sequence won't be done for another couple of months.)

      --
      -- Titus Brown
    5. Re:But what does 'mapping the genome' really mean? by gargle · · Score: 2

      IMO, it doesn't mean much. It's largely hype, a symbolic milestone. It's akin to getting a bit dump of a binary program. The hard part will be to understand what it all means.

    6. Re:But what does 'mapping the genome' really mean? by Sodium+Attack · · Score: 1

      Well, yes. Just the same way the moon landing was largely hype, a symbolic milestone. Those moon colonies are still 50+ years off. But that doesn't mean it's not an important milestone.

      --

      Never take moderation advice from sigs, including this one.

  21. Let's see what happens now shall we? by Jon+Erikson · · Score: 1

    While I'm all for the advancement of science and improving the lot of humanity, I really think that the widespread use of genetic engineering can only turn out to be a mistake of the worst kind.

    Unfortuately, given today's socioeconiomic structure in which corporations have, thanks to America's love-affair with hardcore capitalism, the power to do practically whatever they want to, it seems all but inevitable that serious genetic engineering of humans will begin as soon as possible. After all, there's a lot of profit to be made from it, and in the time it takes an "ethics" council to judge something illegal the corporations will have already done it.

    What will knowledge of our genome allow us to do? Firstly it'll be "improving" our children, removing congenital defects and then enhancing their natural characteristics. What then? Inter-species transfer of genetic materal so enable children to do things that God never intended them to do? This may seem somewhat farfetched, but the hubris of scientists and the greed of corporations guarantees that all this, and more, will happen, and sooner than you'd think.

    Personally I believe that allowing this kind of work to take place in any situation is dangerous, but allowing the corporations, Satan's tools on Earth, free reign to "experiment" with this is practically placing a gun to your head and pulling the trigger. The Government, whilst having unfortunate liberal tendancies, at least has the decency to try and do the right thing.

    No, genetic engineering is likely to turn out to be a disaster in the making - who wants everybody to be the same? When we've turned to world into 6 billion clones, then there truly will be no turning back.


    ---
    Jon E. Erikson
    --

    Jon Erikson, IT guru

    1. Re:Let's see what happens now shall we? by garnier · · Score: 1

      I really think that the widespread use of genetic engineering can only turn out to be a mistake of the worst kind.

      That is a very big accusation for something so new.

      Unfortuately, given today's socioeconiomic structure in which corporations have, thanks to America's love-affair with hardcore capitalism, the power to do practically whatever they want to, it seems all but inevitable that serious genetic engineering of humans will begin as soon as possible. After all, there's a lot of profit to be made from it, and in the time it takes an "ethics" council to judge something illegal the corporations will have already done it.

      Well, there are already laws in place that put restrictions on the extent of experiments with humans. For example companies need to get explicit licenses to clone human tissue even if it is only for medical purposes. And even if what you describe happens, i.e. someone finds a loophole and does more experiments that they should really be allowed to do, new laws can put in place that will prevent this thing from happening again (even though it has happened once).

      What will knowledge of our genome allow us to do?

      Primarily it will help us cure disease. I am not prophet though, so I cannot exclude with certainty any scenario including the more far fetched ones you describe. However I am an optimist: the condition of life of the human race have been improving, especially when new technologies are invented, so I have no reason to believe that this particular one will be bad. People were predicting that computers would be our downfall, but so far they have only improved our lives.

      As for the corporations being Satan's tool, yes I agree that they can be greedy, but they have brought a lot of innovations. Governments on the other hand are ideal examples of bad management.

      Je vous embrasse,

      Philippe Garnier.

    2. Re:Let's see what happens now shall we? by Kintanon · · Score: 2

      Inter-species transfer of genetic materal so enable children to do things that God never intended them to do? This may seem somewhat farfetched, but the hubris of scientists and the greed of corporations guarantees that all this, and more, will happen, and sooner than you'd think.


      Trust me, if God doesn't intend for it to be done, then it won't happen. But if you believe in God, then you believe he put us here to have dominion over the earth and all of its creatures. Well, we're one of its creatures, so we have free reign to improve or destroy ourselves as we choose. Now yes, complete free reign to tinker with peoples genetic code just for kicks might be a bad thing. But controlled genetic experimentation can be nothing but a good thing in the long run. Turning everyone into clones is in no one's best interest. Heck, making everyone immortal is a pretty BAD idea too considering. I'm not even for increasing the overall lifespan of humanity right now. We really need to expand off of this planet before we do anything that would increase the population dramatically....
      But back to the point at hand, yes there are potential problems with genetic engineering, but there are also great potential benefits. You must risk the one to achieve the other, that's the way life is.

      Kintanon

      --
      Check out JoshJitsu.info for Brazilian Ji
    3. Re:Let's see what happens now shall we? by Megasphaera+Elsdenii · · Score: 2
      I really think that the widespread use of genetic engineering can only turn out to be a mistake of
      the worst kind.

      Mmm ... not so clear. First of all, we have been using genetic 'engineering' since time began (think of mate choice) and since the Mesolithicum (think of crop and cattle breeding). Also, so far, no examples of transgenic engineering (transfering
      genes from one species to another) or even invidual directed gene transfer in humans has been shown to be feasible, let alone desirable. Given the reaction towards Dolly the Sheep Cloneage, it seems very likely that any such technique will be forbidden, and I will probably agree. I will, however, vehemently advocate the use of genetic therapy (if they become available) for the 'definitive treatment' of very obvious heriditary diseases (such as metabolic defects (cystic fibrosis etc.). Unfortunately it's not clear-cut when a disorder is a disabling disease, I admit.

      What will knowledge of our genome allow us to do? Firstly it'll be "improving" our children, removing congenital defects and then enhancing their natural characteristics.


      Again, it's not that simple. Your 'improving' has been a possibility ever since we started studying chromosomes; this allowed ever better pre-natal diagnostics, with the obvious possibility of terminating pregnancies for foetuses that might have a more or less severe disability. I am not at all convinced it is morally repugnant to avoid suffering in very serious cases (the big question, of course, is what is 'serious').



      So far, most techological advances have been put to reasonable use in democracies . (I think Popper came up with this) There will have to be a great deal of public education about matters (to make sure democracies keep getting it right).


      PS: rants about God, Satan etc. do not inspire much confidence in the likelihood of a serious debate on these issues, which indeed is very necessary.

    4. Re:Let's see what happens now shall we? by Old+Wolf · · Score: 1

      Removing congenital defects is surely a good thing. It will counter the anti-natural-selection that has been going on lately (ie. failure to kill off weak or crippled offspring, either deliberately, or by incurable diseases).

      Enhancing of natural characteristics will certainly raise a lot of issues. It can only be seen as a step forward, however.

      People do things every day that God never intended them to do. I am sure God never intended me to cross the road by using traffic signals in order to get my lunch on Tuesdays.

      And, your most preposterous claim of all - people will not be the same ! GE will herald an age of the greatest diversity. People will come up with all sorts of things to do and have done, all wild and wonderful. I can't wait!

    5. Re:Let's see what happens now shall we? by Phredrick+Dobbs · · Score: 2
      No, genetic engineering is likely to turn out to be a disaster in the making - who wants everybody to be the same? When we've turned to world into 6 billion clones, then there truly will be no turning back.

      Why would genetic engineering make everyone identical? Thats preposterous! Its like people who think that cloning allows you to put someone in a box and get an exact copy at the exact same age!

      The only big problem I personally see with genetic engineering is the possibility of making a serious mistake which spreads to every human being on the planet. Something subtle that would eventually come out, resulting in our extinction. There's a science fiction story (probably several) that mentions something similar to this. Ahh, yes, thats right, one of the Rama books by Arthur C. Clarke mentions a race that made changes to its genome and lost the original copy, so when they noticed the error that was killing them all, they were unable to do anything about it.

      I don't see why we SHOULDN'T give our kids more intelligence, durability, as long as we don't manage to find out how to extend our 100 or so year limit before we simply wear out. And even that may be a good thing eventually, if we can manage to get off this planet and have somewhere to send all these people. (If no one died, population would grow at an even more insane rate than it is doing now)

      It is unfortunate, however, that ramblings about God or Satan or evil forces which attribute a certain mysticism to cutting edge biology are very characteristic of the populace of America, and likely the developed world. While the religious argument is not necessarily universal, I know for a fact that most people's reactions to things like cloning are not level with the reality of the science. These sciences gain a magical quality, a romantic sense of tampering with something imperturbable and divine. To most people, genetics, and much of today's more advanced science, is something to fear, something that transcends understanding.

      And this unfortunate fact is why I fear the true potential of many sciences may never be met.

      -Dobbs

      -Phredrick Dobbs
      Emperor of the Universe
      Grand and High Protector of Everything

      --

      -Phredrick Dobbs
      Emperor of the Universe
      Grand and High Protector of Everything
    6. Re:Let's see what happens now shall we? by crashed · · Score: 1
      Also, so far, no examples of transgenic engineering (transfering genes from one species to another) or even invidual directed gene transfer in humans has been shown to be feasible, let alone desirable.
      But rememeber genetically modified foods? For example a fish gene is used in GM strawberries to enable them to produce an anti-freeze to survive frosts.

      Extending this to humans shouldn't need much of a leap in technology.

    7. Re:Let's see what happens now shall we? by Skid · · Score: 1

      God never "intended" for me to have 20/20 vision, yet I have a reasonable mockup of it, thanks to corrective lenses. If you can do it, it is implicitly 'allowed'.

      Enough philosophy, though; I *really* doubt everyone will become the same through genetic engineering. It's about as likely as everyone choosing to dress exactly the same. Except for the correction of genuine 'defects' (who WANTS poor vision, or a genetic disease, etc) I think humanity will remain as varied as ever - moreso infact.

      One day, instead of dyeing their hair, or getting piercings, or wearing certain styles of clothing, teenagers will rewrite their genes. I myself wouldn't mind some intriguing alterations - heck, splice in some chlorophyll and plop me under a sunlamp while I'm at work, and I'll never eat again.


      --
      These are *MY* opinions.

      --
      These are *MY* opinions.
      They will not be *YOUR* opinions until the Orbital Mind Control Lasers are operati
    8. Re:Let's see what happens now shall we? by Rand+Race · · Score: 1
      "What then? Inter-species transfer of genetic materal so enable children to do things that God never intended them to do? This may seem somewhat farfetched, but the hubris of scientists and the greed of corporations guarantees that all this, and more, will happen, and sooner than you'd think."

      How is the hubris of scientists greater than yours when you claim to know the mind of god?

      Strangeley enough I agree with your point, why burden it with questionable theology?

      "Every religion has a soft spot, a weakness through which we may controll it: Who differentiates between hubris and revelation?" -Inner Teachings of the Missionara Protectiva

      --
      Insanity is the last line of defence for the master diplomat. But you have to lay the groundwork early.
    9. Re:Let's see what happens now shall we? by BenByer · · Score: 1

      Eat the apple, do it, its sooo sweet. Fire is a dangerous tool as well, but so far has not destroyed humanity. Your arguement is pretty old, and by this point the empirical evidence seems to say not valid. 6 billion clones would be real stupid to do. genetic diversity increases the likelyhood of survival as ecologic diversity increases the chances of a stable environment. Given the idiocy of 6 billion clones, it is not going to happen. A population that size would most likely suffer a large medical catastrophe and die. ebola only kills 80% of its victims. Why? Its possible that this is genetic and that genetic diversity saves us from that. Before you jump to goddly conclusions consider them with all the evidence involved. Science is not about destroying god but about trying to understand him.

    10. Re:Let's see what happens now shall we? by Sodium+Attack · · Score: 1

      I hate to respond to a troll, but it's worth pointing out that genetic engineering is not the only application of the HGP. Saturday's Washington Post had an excellent article on another potential application of HGP: pharmacogenomics. Essentially, pharmacogenomics is using the genetic identity of an individual to determine what drugs the person is likely to respond favorably to. Tody, we have only a limited understanding of why some people respond well to treatment X, while others have severe side effects.

      --

      Never take moderation advice from sigs, including this one.

    11. Re:Let's see what happens now shall we? by Sodium+Attack · · Score: 1
      The problem with selecting based on intelligence, looks, or athletic ability is that most likely, we will not know what side effects this will have.

      Ah, but the exact same thing is true with conventional drug testing. We can test a new drug in animals all we want, but we can't know for sure how a human will respond until the drug is given to humans. And even then, we can't predict with certainty how other people will respond to it. There's a number of drugs which were withdrawn from the market because they produced serious side effects or even death in a very small fraction of the populace (I'm talking on the order of one in a hundred thousand here), because that fraction was too small to be detected in clinical trials.

      My point is that in spite of these risks, society has made the decision to pursue new drug development. We do what we can to minimize the risk, of course, but they can't be eliminated entirely.

      Yes, there are risks with genetic engineering as well, but there is also the potential for great good. How is that any different than traditional pharmaceutical research?

      --

      Never take moderation advice from sigs, including this one.

    12. Re:Let's see what happens now shall we? by greenlante3rn · · Score: 1
      ebola only kills 80% of its victims. Why? Its possible that this is genetic and that genetic diversity saves us from that. Before you jump to goddly conclusions consider them with all the evidence involved.

      Actuly its because the more people Ebola is passed along too the more its base genetic code is changed. In other words its a really stupid virsues. It causes itself to be exterminated by making itself less viral.

      Just in case you wanted to know

      --
      Theres one problem with reflecting your reality, sometimes your reality starts to reflect you.
    13. Re:Let's see what happens now shall we? by Sodium+Attack · · Score: 1
      Quite so. I have no problem, and even agree with the attitude "We should be very careful with genetic engineering, because of the potential for deleterious side effects." It is the attitude "We should avoid genetic engineering entirely, because of the potential for deleterious side effects" that I object to.

      It's also worth noting that genetic engineering is not the only application of the Human Genome Project. Another one--and one likely to find widespread practical application much sooner than genetic engineering--is pharmacogenomics. There's a good article in Saturday's Washington Post on the topic.

      --

      Never take moderation advice from sigs, including this one.

  22. Welcome to a terrible, Wonderful future. by Da_Monk · · Score: 1

    The scary thing is the (at least) 2 very divergent paths that are now in place. Either this could bring about a utopia, where retrovirii bring everyone to a perfect state, or a distopia where everyone is brought down to the state of a mindless drone while a few perfect beings rule over everyone.

    more likely to happen is somewhere in between. as long as companies dont get too profit crazed, then the future might actually have a chance... we have seen this problem with drug prices now....

    if you have not seen the movie GATTACA you might want to... this is what _could_ happen.

    1. Re:Welcome to a terrible, Wonderful future. by BenByer · · Score: 1

      chances are gattaca would not happen. Most likely large percentages of the 'perfect' population would die off at some point. natural selection still works. it is scary to imagine a world like that, but scarier still to imagine a world where chances to better the living conditions of the average person are not taken because they are scary.

  23. Can somebody explain... by G-funk · · Score: 1

    ...Exactly what this means in plain english? Does it mean that if you can get away with it, you can choose a foetus' eye colour, build, metabolic rate, penis size? (Sorry, Gattaca screened last night).

    What does it mean? Or have they just mapped where the gene for hair colour is, and don't know how to change it, or...???

    Am I the only person who doesn't know?

    Gfunk

    --
    Send lawyers, guns, and money!
  24. Note by codemonkey_uk · · Score: 2
    Remember that they have mapped A human genome, not The human genome, and that mapping is far from understanding.

    Move along, nothing to see here ... yet.

    Thad

    --

    Thad

    1. Re:Note by Old+Wolf · · Score: 2

      Actually, they have mapped *the* human genome. There are about 3 billion possible 'letters' (ie. combinations of the four base amino acids, and they have charted them all.

  25. Here come the patents by DavidOgg · · Score: 1

    If they patent or copyright this stuff, the documentation to MY dna, I'm going to shit.

    I can see it now. No one can have a baby with OUR DNA, its DNA PIRACY! you must pay a royalty.

    --
    Fear the government that fears your guns. Fear the government that fears your computers. Remove them from my email.
    1. Re:Here come the patents by Damhna · · Score: 1

      Did you know that the entire DNA code for every individual in Iceland is owned by a private company?

  26. specialization by roman_mir · · Score: 1

    In principle we could build a specialized human being that will be able to do fast computations of pi, e and of prime numbers at a speed unattainable to a normal computer.

    1. Re:specialization by styopa · · Score: 1

      In principle, yes we could. One minor drawback though, a simple little thing known as ethics.

      --
      Disclamer - Opinion of Person
    2. Re:specialization by thogard · · Score: 2

      Aren't there a few people who can do this already?
      They are commonly called Idiot Savants but the more PC name is Autistic Savant.

  27. Girf sucks by Anonymous+Idiot · · Score: 1

    you lose

  28. Privacy by Reggyt · · Score: 1
    Maybe this is good news for the development of medicines, but this is one side of the coin. If you can create a cure based on a known genetic "defect", then you can also say that you cannot produce a cure for a known genetic "defect".

    Will this lead to penalties for those of us who possess a gene which causes an illness or death? For which, even with the access to the human genome, is deemed incurable.

    I can't imagine any insurance company offering insurance on these terms. Legislation is being considered at the moment, but one of the problems with legislation on some occasions is it appears to be driven by commercial interest.

    We should all be concerned about genetic privacy, there is nothing else which is more personal to us all.

    --
    "Common sense is nothing more than a deposit of prejudices laid down in the mind before you reach 18" Einstein
  29. Overrated by LaNMaN2000 · · Score: 1

    The problem with the HGP is that raw data is being generated faster than anybody can analyze it. Already, numerous microbial genomes and the fruit fly genome have been sequenced, but mining the data for useful information is an extremely time consuming and difficult process. Even with the human genome sequence complete, it will probably be many years before genetic treatments are offered.

    In order to create genetic treatments, scientists must determine the location of genes that produce groups of proteins that are contributing factors to disease. Dividing the genome into functional subunits, individual genes, can be a long an error-prone process. Even after a gene is discovered (and likely patented--unless we stop Congress from allowing gene-patents), an effective treatment must be developed. Then, the treatment must be tested to comply FDA regulations--another long and expensive process.

    --

    ByteMyCode.com: A Web 2.0 code sharing community.
  30. gene map by nomadic · · Score: 1

    Didn't they fully map another species a few years ago? I forget if it was a planarium or some other simple animal, but I remember being really impressed because they actually knew what every single one of the genes expressed...

  31. Genome made public by cpart · · Score: 1

    In Mid March Slashdot had an article about President Clinton and PM Tony Blair wanting to make the Human Genome free to the public. This ABC article though mentions that Celera is already charging companies for the Data how is that free? Has anybody seen anyything on making the Humane Genome Open and available?

    1. Re:Genome made public by DavidOgg · · Score: 1

      I think it should be released into the Public Domain. NO license whatsoever. nada zilch

      --
      Fear the government that fears your guns. Fear the government that fears your computers. Remove them from my email.
    2. Re:Genome made public by mugbie · · Score: 1

      I think the Gnome information ought to be public knowledge as well. Apparently from the article, the project was funded by the public. Thus, the public ought to have rights to use the data free of charge. What is all this licencing Bull-Potatoes about!? $5-$15 Mil for access to information, GIVE ME A BREAK! I realize it took 10+ years, but WE funded it, WE ought to get the fruit of the work.

      --
      So long and thanks for all the fish, m i k e c a r o n
    3. Re:Genome made public by Sodium+Attack · · Score: 1
      First of all, the fact that Clinton and Blair have stated that they want to make the information free does not mean that it's happened.

      More importantly, however, is that there are multiple organizations working on sequencing the human genome. Do not confuse them.

      Celera is a private, for-profit corporation. They would like to patent as much as they can (and already have, for some genes).

      The Human Genome Project is a project being run at a number of labs, mostly university research labs. They are committed to releasing genetic sequences freely. They published the map of human chromosome 22 a few months ago in Nature. It is funded partly by government grants, but also by a consortium of many large, traditional pharmaceutical corporations. (Large pharma, which has not been doing genomic sequencing, does not want to have to pay Celera for use of the information any more than other research labs do. Corporations aren't evil, just self-interested. Sometimes that self-interest leads to evil, and sometimes to good.)

      --

      Never take moderation advice from sigs, including this one.

  32. Re:complete scan incomplete? by Graham+Clark · · Score: 2

    The final sequence will be better than 8x. Today we have an earlier version at a lower thickness. The work is continuing to bring the thickness up, and resolve ambiguities and sequence gaps. We hope to have it finished early in 2003. And that's finished finished, not just mostly finished.

  33. . . . what this means. Some of it, at least. by Graham+Clark · · Score: 1

    Does it mean that if you can get away with it, you can choose a foetus' eye colour, build, metabolic rate, penis size?

    No, not yet, although at some future point this may become possible. The sequence we have will be very useful for those studying what it is in our genes that affects all of these traits, though. Research into these things will go a lot faster from now on.

    (Sorry, Gattaca screened last night).

    Good film. Quite insightful.

  34. What exactly this Human Genome is at this point. by Effugas · · Score: 4

    Want to see something interesting?

    Go to this page within the Entrez browser of Genbank. Click Begin Download...and watch:

    >gi|8134254|ref|NT_001039|Hs22_451| Homo sapiens 22q11.2 sequence /len=1790785 TTTGGCTAAAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAGGG AGATCTTATG AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGCTG TATTTTAGGT TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTGTA CCCTTCTCTC TATGGGAGGGCTGTCCCTTGGCTGGCCTGGGATGCAGGAATAGCTTTTGT GCACCCTTTG GTGTCCACTTCTGTGTGTCTCTCTTGGTGGCACTGCTTCCCTATCTCTGC TTGCTCTGAC CACCTTCAGGCTCCTAGGACCCTACCCTCTCAAATTTCCTCCTCCCCTGC GTCCCCCTTT CCCATTCAAAGCCCACAGCACATCTCAGTTAGTGCTATGGAAAAAACTAG CCTCAGAAAC GAATATTCACTGACATGTCAAGGTCTAGTAGTTTGTAGAGCCATTTTATT GGAAGGGACT TCAGAAAGGAATTAGTTTACCTACTCATCAGGTGAGGAGACCCACAGAGG GGAAGTCACC TGCCTGACTCCCAGAGACAGAAACAGTGCTGGGACTAAAACCCAAGAAGG GTCCTGACTC CCAAGTCCCAGGAACTTAATTTTCCCCCAGGGAATGGCCCACCACCCACC CAGATGTAAA AACTAGAGACTCTGGGCAGCATTCTATCTCTATGCCAGCCTCCAGTCTCC TGTCTATTTT GCCTCCAAGATACATCTCTAATTTGCCCACTTTTCTTGAACTTCACATCA CCGATCTGGT ACAAGCCATCATCATCTCCTTGCTTGGGCCTACCAAGACACTAATCACTG TTCTTTTTGT TTCGTTTTGTTTGTTTTTGAGACAGAGTCTCATTCTTATCACCCAGGCTG GAGTACAGTG GCATGATCTCAGCTCACTGCAACCTCTGCCTCCCATGTTCAAGCGATTCT CCTGCCTCAG CCTCCCAAGAAGCTGGGATTATTGGCATGCGCCACCACACCAGGCTAACT TCATATTTTT AGTAGAGATGGGGTTTCACCCTGTTGGCCAGGCTGGTCTTGAACTCCTGA CCTCAGGTGA TCCACCTGCCTCGGCCTCCCGAAGTGCTGGCATTACAGGCATGAACCACC ATGGCAGGCT GACTTTCATTCTTTCTCTAGTATTATTAGAATATTCCCAAATAATATTCC ATTGTGTATA TATTCCACATTTTGCTCATTGGTTTCTCATGGTCCGATCTGAGCTTTGGG TAGATCTGGC TATAGGCAGATAATCCCTGAGACATACTGCTAAATGGGAACAGCAGATGC AGAACAGTGT GTATGATACGCTACCACTTCTGCTGGAAAACGTCAAACAGGCACGTGTGC ATACATATGT ACGTGGACTTGGAAAGGCATAGACCGTCTTTGAGAATACTCAAGAAGTGG TTATCTTGGG TAGGAGAGCTGGTGGCGGGGGACAGAAATGGAAAGGAGACTTATTTTTCA CTGGATATAC TTTTGTACATTTTATGGCTTATTAATAATGATTTTATAATTATATTACCA TGATCAAATA AAACCCTTGGTGAATCTTCAATATTCAATAAAAGGCTTGGTTCTTTTAAG CACATATAAA CTTTTTTTTTTTTTGAGACAGGGTCTTGCTCTGTCACCCAGGCTGGGGTG CAGTGGCACA ATCTCTGGCTCACTGCAGCCTCTACTTCCCAGGCTCAAGTGATCCTCCCG CTTCAGCCTC

    And so on, so forth, for 33Mb worth...Chromosome 22.

    It's a bit dump, folks, with two bits per character. That's it. cat /dev/sequencer | gendump. (Yeah, yeah, abuse of unix commands. Too simple to resist.) Of course, what made this so ungodly difficult was the getting the sequences straight--vast amounts of data, no headers, and a flaky character mode device. Not simple to get this data; they essentially needed to repeatedly run the data through the analyzer and look for patterns which constantly repeated to determine how everything lined up within the chromosome.

    We don't know what any of it does, of course. We have ideas, implemented using the crudest of methods. The last time I tried to figure out what a piece of code did by commenting it out, I actually felt pretty good about myself--that's what genetics researchers do, and it is what they're wanting to patent, right or wrong.

    We've got the bits. Now we've got to figure out what they do. The entire field of computational biology has been created to decode this mess...I'm truly looking forward to seeing open source genome analysis tools come out of this.

    Open Source analysis of a system within which Source has never existed. That should be interesting.

    Entertaining tidbit: The CEO of Celera will likely have his own genome sequenced and released publically. Contrary to popular belief, this has nothing to do with the Human Genome Project's threat that "your ass is mine." (Kidding ;-)

    Yours Truly,

    Dan Kaminsky
    DoxPara Research
    http://www.doxpara.com
  35. Therapy vs. Enhancement by RobHornick · · Score: 1

    Have you by any chance ever seen the movie GATTACA with Ethan Hunt and Uma Thurman? One might be worried about the possibilities of a dystopian future similar to Huxley's "Brave New World" or similar stories; but one could also see a future where no one has any disability or genetic disorder. The issue is Therapy versus Enhancement. We can use the knowledge provided by a genetic map and knowledge of cell patterns to provide a blind child with new retinas, or an old man with a new kidney. Or we may use this knowledge to make every child a superhuman with the genius of Einstein, the body of John Elway (obviously there are different examples for females), and the creativity of Van Gogh (without the tendency for ear-chopping.) The problem is when this line between therapy and enhancement becomes blurred. Is it therapy or enhancement to provide someone with less-than-stellar vision (but not blind) near-bionic eyes when they could have their vision corrected by contact lenses or glasses? This issue may seem obvious to some, but there are several other issues you can think of if you put your mind to it. While we have just gone through a digital revolution, we are about to undergo a biological revolution. The problem is the ethics of biology are much less clear-cut than the ethics of technology.

    1. Re:Therapy vs. Enhancement by BenByer · · Score: 1

      The world of Gattaca is not going to happen. A species that is not gentically diverse enough, flaws and all, will not survive natural selection.

  36. Only one bloke. by Moderation+abuser · · Score: 1

    But on the bright side. He need never be sick ever again.

    --
    Government of the people, by corporate executives, for corporate profits.
  37. Still a work-in-progress. by Graham+Clark · · Score: 1

    The announcement today concerns what people are calling a draft sequence. For various reasons, this isn't regarded by those involved as complete, or as adequately accurate for work to be wound up. The original plan was to sequence the entire genome to a depth of about 8-10 reads. This is still the plan, but a halfway station has been created in the middle to try to forestall some of the patent applications, and that's what's being announced today. Rather than being 8-10 reads deep, this is 3.5-5 reads deep, and over most of the genome no effort has yet been made to solve ambiguous areas or fill in the gaps in the sequence. Over the next three years, this will be brought up to the standard originally planned.

    Celera are, as best as I can tell, announcing their assembly of the same HGP data plus about 3-4 read deep sequence data of their own. It's unclear how much or when this will be made available to the public, although Celera are committed to doing so at some point. They may announce a timescale today.

    Regardless of all of this, both the public-sector HGP and Celera (and, for that matter, various other companies) are continuing work on the human genome. Celera are sequencing the DNA of (IIRC) six individuals to analyse for variations between them, and the HGP have a similar project under way. The HGP are continuing to increase the depth of coverage of the main genomic sequence, and are continuing with specific problem-solving work on difficult or ambiguous areas. Both will be sequencing other genomes for comparison - mouse looks to be first, although apparently somebody's intending to do the chimp genome as well.

    So in summary, it's all go around here. This isn't a big final announcement, although it is very significant. It isn't in itself going to change your life, but it's going to be very useful for lots of work that is going to. Concrete results will start flowing over the next few years, and where it will take us, I'm not even prepared to speculate.

  38. Civilization by ArsonSmith · · Score: 1

    Isn't this one of the last advances to completing Civilization Call to Power?

    --
    Paying taxes to buy civilization is like paying a hooker to buy love.
    1. Re:Civilization by Digitalia · · Score: 1

      Quite hardly. Currently, our civilization is a Type 0 civilization. We have not met enough of the criteria to be considered a global, or Type 1, civilization. Not to mention the fact that even after we master the planet, we will still have 2 more phases to go through.

      Or were you talking about a game?

      --
      Pax Digitalia
  39. The Eleventh Commandment. by Chyeburashka · · Score: 1
    If Moses were to get that special download today, would God have added:

    Thou shalt not reverse engineer the genome of man or any other creature.

  40. Mod this up. by kwsNI · · Score: 1

    So you're saying that I'm a (Score: -1; Funny)?

    kwsNI

  41. Re:akey sucks by John+Napkintosh · · Score: 1

    So, who won?

    --

    Long signatures suck.
  42. Brace yourself... by jmccay · · Score: 1

    Along with the many "so called" befits this new advance is supposed to bring will come new ways to discriminate. Imagine not being able to get lifeinsurance or health insurance when you are 20 because they determined you have a genetic disease. Then, of course, you have the genetic databases that will eventually be built. Eventually, they will try and link behavior to your genetic profile, and this will incourage more databases and more discimination.

    The future looks like so much fun!
    -------------------------
    I wish vacations were longer. A time machine would definately be handy right now.

    --
    At the next eco-hypocrisy-meeting, count the private jets used to get to the meeting. Should be interesting to see that
  43. Re:What exactly this Human Genome is at this point by dmccarty · · Score: 3
    Open Source analysis of a system within which Source has never existed. That should be interesting.

    To believe that no one has ever held the "source" for humans and other living things is akin to believing that you could find an intricate piece of machinery (a watch, for example) lying on the ground that had somehow assembled itself and was designed by no one.

    I believe that our source exists, we just haven't met the programmer yet.

    Best regards,
    Daniel McCarty
    --

    --
    Have fun: Join D.N.A. (National Dyslexics Association)
  44. They've HAD the technology by Greyfox · · Score: 2
    The Alien Overlords that Transmeta got their technology from have had that technology for years. They probably outfit all their new-hires with prehensile tails as soon as they sign on. Why do you think they're so damn secretive?

    ;-)

    --

    I'm trying to teach myself to set people on fire with my mind... Is it hot in here?

  45. We have a right to manipulate our DNA! by ocelotbob · · Score: 2
    "I'm concerned that some day we may decide to start modifying the human genome to think that we can do better than the genome," [Eric] Lander said.

    Dammit, my kids have a right to have that fur coat and prehensile tail. Evolution has slowed to nearly a stop ever since we got the dumb idea of breeding based on brains instead of being able to better outrun the hyenas. We need to fix that and get back to evolving towards greatness.

    --

    Marxism is the opiate of dumbasses

  46. Human Genome Project by Greyfox · · Score: 2
    Increases unit strength and city production by 10% in Civ:CTP, if I recall correctly.

    Scary thing is, I didn't need to go look that up.

    --

    I'm trying to teach myself to set people on fire with my mind... Is it hot in here?

  47. Re:What exactly this Human Genome is at this point by jcabrer · · Score: 2

    O.K., so we have the ROMS, now who is going to write the emulator? Make sure it supports zipped rom sets :)

  48. Re:What exactly this Human Genome is at this point by Jerf · · Score: 2

    I do agree with you... however, would the phrase within which no human-readable Source has ever existed be better? It's much the same problem, and source code exists merely as a meeting of the minds between computers and human. There's no meeting point here, no easy answers, no cheat sheet, just pure A, G, C, and T.

  49. PREMATURE ANNOUNCEMENT by peter303 · · Score: 1

    When they announced the fly, worm, yeast
    and human chromosome #22 and #21 genome,
    they were about to give a 99.9% accurate count
    of the genes and rough protein classification.
    Today's announcement doesn't do that.

    Some interesting issues to resolve with the count:
    1) The numbers are all over the board, between 35,000 to 150,000 genes. The low end was triggered by a low #21 count. In fact there is a contest to see who has the best prediction.
    2) More is not necessarily "more evolved". From a count of genes and proteins, the worm is 25% more complicated than the fly. Where do humans fall into this range.
    3) Its interesting to see how many genes humans shared with these other sequence organism. The majority of known genetic cancers have exact genetic analogs in these other organisms.

  50. Re:caveats... another perspective by dzogchen · · Score: 1
    All the caveats are true, however, for many people just the knowledge of the gene sequence will be important.

    I am the parent of a child who has lost the ability to walk and talk and care for herself over the last 12 years. After years of extensive testing, we still have no diagnosis. The ability to compare her DNA with "standard" listings may give us some answers.

    For me, anything that advances our knowledge is a good thing.

  51. combination of sequencers and super-computers by peter303 · · Score: 1

    The newer sequence robots determine thousands of
    base pairs per day- much faster than before.
    However, there is a limit on maximum piece size.

    Supercomputers determine the connections between pieces. The government approach is more cautious in regards to breaking the genome into pieces. consider the anology of breaking a skyscraper's windows into granular pebbles, each which can be automatically sequenced. The government gave each floor of the building to different lab. In turn each lab goes window by window, shard by shard at a time. Celera basically just pulverized the entire building at once and are reassembling the pebbles simultaneously. They compute quadrillions of comparisons of each pebble with each other to discover how they fit together. People thought this was crazy, but this worked on animals with as much as 10% of the human genome.

  52. Next is a map of differing spots by peter303 · · Score: 1

    (That is after they identify the 50 some thousand genes which only are 1% of the bases.)
    The initial draft uses about 15 people- ten for the government and five for Celera, when completed in a year or two.
    Then they look for spots that differ systematically between people. The acronymn SNP stands for single spot differences, or about one base in a thousand. These SNP and the multiple cousins will define the range of being human and the range of genetic disease.

    1. Re:Next is a map of differing spots by wfrp01 · · Score: 1

      "These SNP and the multiple cousins will define the range of being human and the range of genetic disease."

      Not necessarily. Consider the process of aging, which is generally regarded as a genetic defect(s). The idea is simple: evolution does not select against defects which manifest themselves after reproduction. In other words, there may be genetic "defects" that we all share. Personally, I think it would be nice to find them, but that may be rather difficult.

      Speaking of difficult, anyone know how many single spot differences are expected? It's then rather simple to do some combinatorics to get a rough idea of how difficult the task of interpreting the genome will be. (Hint: boggles the mind).

      --

      --Lawrence Lessig for Congress!
  53. Celera: Biotech Rambus?? by dzogchen · · Score: 1
    The notion of patenting genetic info is kinda scary...

    It's one thing to patent something new, something created based on specific application of knowledge, but I'm sorry, I think our Genome code is the property of the human race.

    I would hate to have science handcuffed by some CFO's projections for the next quarter....

  54. Natalie Portman's DNA? by peter303 · · Score: 1

    When do they sequence her DNA so all the lonely slashdotters will have clones? :-)

  55. Re:What exactly this Human Genome is at this point by Effugas · · Score: 3

    To believe that no one has ever held the "source" for humans and other living things is akin to believing that you could find an intricate piece of machinery (a watch, for example) lying on the ground that had somehow assembled itself and was designed by no one.

    Whoa there, McCarthy. I'm not saying there's no God, or Allah, or Yehova, or anything else of that nature. I just prefer not to limit that guiding force to any single moment of creation, saying that It(the correct pronoun doesn't exist) needed to have all time and all thought forged at once.

    What could be more interesting to a Creator than a universe he did not Create? Think about that. Think about how cool self-optimizing code is to us hackers. Look at the talk of genetic algorithms. Are you saying we can pull off stuff our own creator can't?

    Actually, that'd be really interesting wouldn't it...

    (I actually wouldn't have replied to this, but I've been having an inordinate amount of fun reading the online comic strip Acid Reflux, which really should be read from the beginning but has a pretty good summary right about here...call me a blasphemer if you like; I just love the concept behind this strip!)

    Yours Truly,

    Dan Kaminsky
    DoxPara Research
    http://www.doxpara.com

  56. Not a new problem by Anonymous Coward · · Score: 1
    We already have all kinds of prenatal tests to detect genetic abnormalities along the lines of Down's Syndrome or worse. Let's say you test your fetus for Down's and the test is positive, so you decide to have an abortion. Person A could argue this is a good thing, because it means that we won't have to bring children into the world who are doomed to suffer. (Being crass about it, I suppose you could also argue it's a good thing because society won't need to squander its finite resources on helping someone who will likely be unproductive -- but thinking like that gives me the chills.) Person B, however, could argue it's a bad thing, because he believes every life is worth living, or because he believes diversity is a good thing for society, or whatever.

    But frankly, it's not their decision to make. It's yours as a parent. And by extension, making decisions on the basis of other genetic tests is just a matter of degree. Personally, I think it would be highly superficial and rather ridiculous to choose whether to have a child based on, say, her eye color. But where do you draw the line? You can't, which means you give the parents as much or as little information as they'd like and leave the decision to them.

  57. The future? by cheesethegreat · · Score: 1

    If we start manipulating the DNA of our children, how far might this lead? We could have parents specialising their children's genes so that they are more inclined to play the cello, or go into medicine. I know that genetics aren't the only factors in development, but when combined with influence from their parents, children could end up living a pre-chosen path. What about the right of the child to go along the path that they choose? What about the idea that there is a greater force guiding us, and that maybe we shouldn't mess with that force. I think that it is like time travel, it is something that we definitely don't fully understand, we can't foresee all the reprecussions of our actions. I think that there will need to be some MAJOR limitations on what people do with our newfound genetic knowledge.


    I like chipmunks, they taste like chicken.

    1. Re:The future? by BenByer · · Score: 1

      There are major limitations on what people can do with our newfound genetic knowledge. The strongest one is natural selection. A non-diverse population will most likely die to environmental pathogens, etc. If a society chooses to make everyone identical they will eventually die. Please dont forget 'basic' science when getting scared.

  58. Re:Using CVS to check the two maps by stx23 · · Score: 1

    In the first instance Diff, or one of it's siblings, should be enough to identify where the variations are, CVS could used to store the canonical version of the map. That is providing Caldera open it in a form similar to the example posted here.

  59. genome@home ? by bludstone · · Score: 2

    genome@home ?
    NT

    --

    no .sig
  60. the important stuff by klyX · · Score: 1

    What I want to know is how much of an impact on the recreational drug culture we can expect after the next dedcade or so. Are there going to be fun new designer drugs that only work on one type of person? Enhance a drug experience like crazy for one type of person, not work on or kill another person?

    ---
    How long have you been listening to the world's famous?
    'Bout six weeks.
    Six weeks!

  61. The Genome actually has Five bases. Sort of... by Guppy · · Score: 5

    As the HGP and Celera finish up the first draft of the human genome, I thought I'd mention a second interesting mapping project that's just starting up now.

    All life as we know it uses the same four bases in its genetic code, A, T, C, and G. However, there is a chemical modification known as methylation, which changes the structure and behavior of the base C, cytosine. Methylated cytosine is considered by some to be a "fifth" base. (Note--Adenosine can also be methylated, but mostly in prokaryotes only, I think). In mammals, about 2-5% of cytosine have this modification.

    The thing about methylation is that it doesn't affect base pairing, so G's will bind with either normal or methylated C's. The pattern of methylation can be preserved as DNA replicates, though, by the action of enzymes can methylate and de-methylate cytosines. The pattern isn't static, though. In some places it varies at different times, and sometimes may be altered in different kinds of tissues. So you get a changes which sometimes can be inherited, and sometimes not, all depending on how the patterns shift.

    Just recently, a European consortium known as the Human Epigenome Consortium (HEC) was announced to identify these methylation patterns. It's a task which is on the same scale as the HGP, but it's not as well known so I don't know if they'll be able to attract as much funding. Here's a link to an article on the HEC.

    1. Re:The Genome actually has Five bases. Sort of... by Guppy · · Score: 2

      "'A' stands for adenine not adenosine..."

      Sorry. Had a brain burp there, you're absolutely correct.

    2. Re:The Genome actually has Five bases. Sort of... by Voltage_Gate · · Score: 1

      If methylation occurs as genes are turned on or off (over development, or whenever), how do we decide if a non-methylated cytosine could potentially become methylated? I'm thinking maybe if we observe it long enough it will tell us if there's really a useful gene at that site. Or maybe we should identify a gene first and then look to see if methylation occurs within it.

  62. Article error. by Cliffton+Watermore · · Score: 5
    The article in itself is interesting, the Human Genome Project is indeed a big milestone. However, a few of the things mentioned in the article disturb and annoy me, to be quite honest.

    Each genome contains 30,000-100,000 genes containing the basic information that makes us who we are: the color of our eyes, our intelligence, the disease to which we are susceptible and more.

    No argument with most of that, colour of eyes and disease-proneness are identifiable. Intelligence? That's utter nonsense. I've been working in this area for many years, and if anything, there are still more questions that have to be answered than answers themselves. We don't know how intelligence works, yet. We aren't there. We don't know if it's mainly genetic software (as this article just assumes, without proper consultation), wetware, or something chemical. The very definition of intelligence is in question. IQ tests prove nothing, and Academic tests are almost as useless.

    I was contracted by a firm in the UK in 1995 to design a new generation of SQUIDS. Basically, what a SQUID (Superconducting Quantum Interference Device Scanner) does is convert electrochemical impulses into instructions. This way, scientests can analyze instruction patterns and try to better-design atrificial intelligence systems. I think that experience, and my academic qualifications, qualifies me tenfold to discuss this topic - there's no way intelligence is entirely genetic. Certainly genetics affects it, but to say that you can define intelligence totally by genetic mapping is utterly ludicrous, and I will take anyone out there up on that.

    --
    "A few atoms won't even light a match" - Dr Jones, 1933
    1. Re:Article error. by Xerithane · · Score: 1

      I wouldn't go be so hasty as to dub this as error per se. Remember the recent anouncement of a smart gene?
      Whilst pointless, the DNA in the nucleas of our cells makes up our bodily make up. This also includes our brain. Hence, without DNA we would have no brain and would have no intelligence. I believe (And this would be very difficult to contest) that our base intelligence capacity (from birth) is purely determined from a DNA standpoint, after that I suppose it would be the nurture end of things.

      nerdfarm.org

      --
      Dacels Jewelers can't be trusted.
  63. Finding a Watch by Phredrick+Dobbs · · Score: 1
    To believe that no one has ever held the "source" for humans and other living things is akin to believing that you could find an intricate piece of machinery (a watch, for example) lying on the ground that had somehow assembled itself and was designed by no one.

    Well, given a set of physics for a universe in which the larger components of watches tend to assemble themselves, and that these components tend to assemble into different types of watches, which in turn make minor errors in assembling more watches, one might argue that one COULD find a self-assembled watch.

    The laws of physics in our universe seem to indicate that the same thing happens with self-replicating carbon based molecules which in turn grow more complex over time.

    I'm not saying nobody set up the laws of physics that way. Just that scientific experimentation has indicated a certain proclivity for things in the universe to have gone that way.

    -Dobbs

    -Phredrick Dobbs
    Emperor of the Universe
    Grand and High Protector of Everything

    --

    -Phredrick Dobbs
    Emperor of the Universe
    Grand and High Protector of Everything
  64. Re:What exactly this Human Genome is at this point by Guppy · · Score: 5
    That's funny, I tried looking at Celera's sequence, and got the following...

    >gi|8134254|ref|NT_001039|Hs22_451| Homo sapiens 22q11.2 sequence /len=1790785
    FIRSTPOSTAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAG GGAGATCTTATG
    AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGC TGTATTTTAGGT
    TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTG TACCCTTCT...
  65. Re:this is the US president by sphix · · Score: 1

    lol

  66. Mod this up. by Effugas · · Score: 1

    This is absolutely hilarious, for all the most subtle of reasons! :-)

    Bravo!!!

    --Dan

  67. presidential announcement by eyeball · · Score: 2

    Apparently, there is supposed to be a presidential announcement this morning regarding the accomplishment.

    ...at which time Al Gore will describe how he invented the human genome project.

    --

    _______
    2B1ASK1
  68. Gattaca Anyone?? by darkstar-x · · Score: 1

    hmmmm looks like the future could be a lot like the movie called Gattaca (maybe spelt Gatacca, cant remember).

    in this movie, a persons job, potential and abilities are mapped by their genome and you are assigned, stereotyped into that segment of society. If you were by any chance born of natural means, by having sex, you were deemed as "Invalid", stating that you are not perfect, a degenerate. In the movie the people there are all deriviativs of test tube babies, where they have been created by using the parents' DNA and creating the ideal person that can be made with the DNA so to speak. The people's society is much liked the "perfect world" where no violence, robbery, poverty even exists, due to the taking out of such possible gene qualities.

    A sorta freaky movie, but a good one which is not focused totaly on the future, and possible desruption.

    A lot is happening these days... People say AI is going to take over, before that even, global warming will get us, who knows... the world is just a big time bomb waiting to explode with some "revolutionary" science, that will only contribute to our fate and death.

    catch yas later :)

    im very happy for the genome project, but i hope it doesnt get used inappropiately, and no doubt it will, oh well... :D

    --
    ---
    darkstar

  69. Open source genies. by Rand+Race · · Score: 1
    Let's use the open-source model to create our own superhuman.... the Gnubermensch!

    I'll name mine 'Noonian'.

    --
    Insanity is the last line of defence for the master diplomat. But you have to lay the groundwork early.
  70. poor poor FDA by r0ark · · Score: 1

    I can just imagine the FDA if any of these magical genetic disease cures start coming out. They will be quite busy, and streesed out from having to determine whether the cure for cancer will be the cure for cancer while being able to prove there are no side effects, all the while having to deal with the entire human population virtually forcing them to let it through.

    Also, how are these guys going to prove any of these cures without human subjects. Its all well and good cure a tiny piece of cancer-ridden tissue, but to determine whether or not a human is healed, you have to find a human subject. Oh well, I guess poeple with diseases have tryed enough experimental things that it is almost part of the disease.

  71. Give it a rest by hey! · · Score: 2

    Jeezus, can't you guys give this a rest? There ought to be a moderation category for kneejerk Al Gore/Internet jokes.

    Al Gore's original utterance on this is no less believable than the run of the mill political claim to having created jobs, or protected family values, or defeated communism. They say these things because we demand they lie to us; half of us because we want to be lied to, the other half because we don't trust anyone who isn't willing to be a baldfaced liar.

    Is it the politician's fault that the electorate is collectively too stupid to realize that its often better to do small things to remove barriers to something that is on the verge of succeeding, than to try to create big successes out of thin air?

    Now, HGP was started in the Bush administration, so the Clinton admin can't claim to have created it. But why shouldn't the administration take credit for standing behind HGP for all these years? Should Nixon have forgone calling the moon because most of the work had been done in prior administrations?

    --
    Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
  72. Re:What exactly this Human Genome is at this point by bgarcia · · Score: 2
    TTTGGCTAAAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAGGG AGATCTTATG AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGCTG TATTTTAGGT TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTGTA CCCTTCTCTC TATGGGAGGGCTGTCCCTTGGCTGGCCTGGGATGCAGGAATAGCTTTTGT GCACCCTTTG GTGTCCACTTCTGTGTGTCTCTCTTGGTGGCACTGCTTCCCTATCTCTGC TTGCTCTGAC CACCTTCAGGCTCCTAGGACCCTACCCTCTCAAATTTCCTCCTCCCCTGC GTCCCCCTTT CCCATTCAAAGCCCACAGCACATCTCAGTTAGTGCTATGGAAAAAACTAG CCTCAGAAAC GAATATTCACTGACATGTCAAGGTCTAGTAGTTTGTAGAGCCATTTTATT GGAAGGGACT
    I read this and all I saw was:
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA

    --
    I'm a leaf on the wind. Watch how I soar.
  73. "...completion of the Human Genome Project" - ?? by quintessent · · Score: 1

    From the header of the ABC News article: "Scientists say they have finished drafts of the human genome, placing in proper order most of the 3.1 billion subunits of DNA that make up the genome." Aren't we jumping the gun just a little? BTW: Will Max Headroom be one of the guest speakers at President Clinton's announcement?

  74. Hidden Message Found by mcarbone · · Score: 2

    The most impressive discovery connected with the completion of the Human Genome:

    Take the completed code of the Genome and convert each ACGT into its binary equivalent as follows:

    A 00
    C 01
    G 10
    T 11

    Then, convert the binary code to ASCII, so that the Genome now exists in Arabic letters and numbers.

    After doing these conversions, amazingly the Human Genome encodes the entire text of Cryptonomicon, by Neal Stephenson. Either Stephenson is some sort of prophet, or a blasphemous plagiarist!


    -----------------

    --

    The only true currency in this bankrupt world is what we share with someone else when we're uncool. -Crowe
  75. how does this work? by MrDingDong · · Score: 1
    I am certainly not a biologist in an sense, and I am unclear on a couple of points.

    First, I thought everyone had different genes? Isn't that what makes some people have blue eyes vs. brown eyes etc.? So if they map the gene sequence that determines eye color, aren't they mapping one person's gene sequence? I don't get it.

    Second, how does gene therapy work? I saw a story on TV where they identified someone's defective genes and "inserted" good genes somehow. Well - how did they do that? Don't you have the same chromosomes in every cell? Wouldn't they have to replace all cells' chromosomes? That seems like it would be impossible.

    That dangers of letting computer geeks on this site....

    1. Re:how does this work? by Sodium+Attack · · Score: 2
      First, I thought everyone had different genes? Isn't that what makes some people have blue eyes vs. brown eyes etc.? So if they map the gene sequence that determines eye color, aren't they mapping one person's gene sequence? I don't get it.

      Yes, but every human's genes are more than 99.9% identical. If they sequence one person's genes, then they have >99.9% of your sequence too.

      Now, knowing exactly where the differences lie, and what those differences mean, is not a trivial problem, and that will take years after the genome is completed. (Remember today's announcement is only that a "rough draft" has been completed.) But even though the HGP isn't copmleted, work has already begun towards identifying and mapping single nucleotide polymorphisms (SNPs). SNPs are one type of difference between people's gene sequences. Not the only type, but one of the most important, and certainly the most common.

      Second, how does gene therapy work? I saw a story on TV where they identified someone's defective genes and "inserted" good genes somehow. Well - how did they do that? Don't you have the same chromosomes in every cell? Wouldn't they have to replace all cells' chromosomes?

      Well, that's a difficult question to answer fully without getting into a graduate-level discussion of molecular biology. But I'll try to give some idea here. First of all, although (nearly) every cell contains the complete DNA of its organism, not every gene is "turned on" in every cell. Each gene codes for a certain protein, and so, although every cell contains the code for every protein, in any given cell most genes will be turned off, and the cell only produces a subset of its possible proteins. So part of the answer to your question is that the "correct" gene only needs to be inserted into the cells that would use it anway.

      Second, in many genetic diseases it's often enough to give a person some cells which produce the correct version of the faulty protein. For example, suppose a given protein was, normally, not used within the cell it was produced, but instead released into the bloodstream. A person that, due to a genetic defect, had *no* cells that made this particular protein would benefit from having *some* cells which produced this protein, even if most of their cells continued not making this protein. So (and depending on the particular defect, this is true for some and not for others) even for the subset of cells which ought to be making the protein in question, you don't need to get the "good" gene into all cells; it will be sufficient to get it into some of them.

      --

      Never take moderation advice from sigs, including this one.

  76. Re:What exactly this Human Genome is at this point by dmccarty · · Score: 2
    I'm not saying there's no God, or Allah, or Yehova, or anything else of that nature. I just prefer not to limit that guiding force to any single moment of creation, saying that It(the correct pronoun doesn't exist) needed to have all time and all thought forged at once.

    Please don't take this out of context; I wasn't really talking about deities. I'm only coming at this from the perspective of a programmer (or creator, if you will). It's illogical to my mind that we can understand simple things which we ourselves create, yet believe that complex things which we have yet to understand could have created themselves.

    What could be more interesting to a Creator than a universe he did not Create? Think about that. Think about how cool self-optimizing code is to us hackers. Look at the talk of genetic algorithms. Are you saying we can pull off stuff our own creator can't?

    Well, if I build a robot that builds a smaller robot, who is credited with the invention of the smaller bot? Me?--or my robot. Following the same line of logic anything that a created object builds (nanotech, for example) is credited to the original creator.

    I'm not trying to write flamebait posts (as my original was moderated). I'm only saying that your original comment--that no "source" exists for humans--is rather human-centric itself. To solve really big problems we must see outside of the boudaries that we've grown up inside: like the way you see my name, McCarty, and your brain tells your fingers to type McCarthy. I think the HGP is a giant step towards an eye-opening experience, and I hope we keep our eyes open to new ideas it might bring.

    Best regards,
    Daniel McCarty ;-)
    --

    --
    Have fun: Join D.N.A. (National Dyslexics Association)
  77. Re:What exactly this Human Genome is at this point by Dyolf+Knip · · Score: 1
    Well, if I build a robot that builds a smaller robot, who is credited with the invention of the smaller bot? Me?--or my robot. Following the same line of logic anything that a created object builds (nanotech, for example) is credited to the original creator.

    I hate to be rude, but that's bullshit. Should my parents get credit for everything I make? Why not, they created me, right? How about self-replicating programs that mutate every now and then?(ie, Tierra. Sorry, don't have the link) There was one that went from 80 commands down to 22 all by its little ole self. Can you say the original programmer 'wrote' it?

    And how is it human-centric to admit to ourselves that the earth does not exist simply for our presence? That yes, we are a totally random fluke in the fossil record? That we exist solely because of the toss of genetic dice over the past few billion years? I think that's being very honest with oneself and facing the facts without fear of making yourself seem insignificant.

    Dyolf Knip

    --

    --
    Dyolf Knip
  78. Re:What exactly this Human Genome is at this point by quigonn · · Score: 1

    anyway, programming directly in "machine"-readable form is going to get in, again. :-) And maybe some biologists will have to start reading computer science books...

    --
    A monkey is doing the real work for me.
  79. Re:caveats... Why not just rip off my comment!! by scheme · · Score: 2

    Jesus Christ! Could you be any more blatant and cut and paste my comment some more. Why not just go through my posting history and cut and paste all my other comments in the appropriate discussion.

    --
    "When you sit with a nice girl for two hours, it seems like two minutes. When you sit on a hot stove for two minutes, it
  80. MOD THIS DOWN PLEASE! THIS IS A COPY OF MY POST! by scheme · · Score: 2

    Here's the address for my post in an earlier discussion. This guy just cut and pasted it into this discussion to get karma. I guess he's never heard of intellectual honesty or properly attributing other people's ideas.

    --
    "When you sit with a nice girl for two hours, it seems like two minutes. When you sit on a hot stove for two minutes, it
  81. Really Complete? by localman · · Score: 1
    A few months ago when the first team anounced they had finished decoding the smallest of the DNA strands, I remember them saying that about 50% of the DNA was meaningless.

    Um...

    That's like claiming that we have finally decoded the "French" language, and that about 50% of it is gibberish.

    I think this is an exciting project, and hope it continues, but I get the feeling that these scientists are jumping the gun by claiming they are complete.

  82. Relative Importance by Hrunting · · Score: 2

    All the articles I'm reading on this are comparing this feat to that of landing a man on the moon in terms of its importance. Well, that's all a matter of relative importance. I'm not old enough to have experienced it, but I'm hold enough to understand what landing a man on the moon meant. Hearing the stories of entire families gathered around a television during the landing and "one small step for man" speech put the perceived importance into perspective. People to this day remember where they were when Armstrong set foot on the moon. It's doubtful that people walking around the streets today will remember what they were doing when the Human Genome Project announced they had mapped the entire genome. It's really not that important.

    But history has a way of vindicating the worthy. We look back on the moon landing today and ask, "What did it get us?" We constantly bicker over the importance of the space program. We still don't have mining operations or hotels on the Moon and we while we may have several new products (Velcro, TV dinners, yay!), the benefit to the majority of humanity from the Apollo project has been minimal at best. Jump forward 30 years from today and imagine even a small piece of the world that researchers are promising us. It benefits far more people and has the potential to impact everyone, not just rich industrial service-oriented nations (I won't name names, but I do live there).

    So can you compare the moon landing and the genome project? No. The moon landing was about a people meeting a challenge and doing something strictly for the sake of doing it. The Genome project, on the other hand, is about understanding who we are and working towards a 'better' humanity. In that regards, these news services should really be comparing it to the Manhattan Project, although, hopefully, it will turn out a lot less violent.

  83. Paranoid Rant by Perdo · · Score: 1
    "Privacy Concerns: Information about our genes could be helpful, but some implications are disturbing and dangerous. Genetic information has been used by some companies when hiring. Legislation now being considered in Capitol Hill would guarantee genetic privacy. "As we unlock the secrets of the human genome, we must work simultaneously to ensure that new discoveries never pry open the doors of privacy," the president said. "And we must guarantee that genetic information cannot be used to stigmatize or discriminate against any individual or group." Others also worry about even bigger questions. "I'm concerned that some day we may decide to start modifying the human genome to think that we can do better than the genome," Lander said."

    Let me assume that Steven Pinker "The mind [and therefore the propensity for certain behaviors] is an expression of our genome" is right. Let me also assume that there are corporations in the world (Aureate/Radiate, etc..) That do a great deal of data mining on behavior.

    Anecdote: Bob has male pattern baldness, a beer gut and hairy shoulders.

    The genome is the source code to the human mind and body. "But it's just binaries" you may say. Binaries are an expression of the source. Humans are an expression of the genome. So, Bob is carrying Gene X. Gene X also dictates that Bob will die of a heart attack and has poor impulse control. Bob cannot get insurance. Bob cannot get a job. Even if Bob has never beaten his wife or gotten into a brawl, Bob carries Gene X and has the propensity to throw his fists around. Bill is easily manipulated. Ann forms unnatural attachments to inanimate objects. There is a 30% chance that you are sociopathic.

    With the government policy on privacy protection being "industry will police itself", How can we believe this technology will not be used against us? We said "Oooh, ahhh!" when Curie discovered radiation, Einstein discovered Relativity and We dropped Nuclear bombs on Hiroshima and Nagasaki. The genome and radiation both have great medical potential but every advancement of technology ever developed has been weaponized. Assume the military is a tool to enforce political decisions. Who "owns" (can weaponize or make more subtle use of) this technology? Any corporation or government with:

    a) A large database of human behavior.
    b) The processing power to correlate behavior to specific genetic markers.
    c) The will to dominate.

    I'm going to guess there are at least a dozen government agencies and corporations in the world that can do this. It's their world now. We just live here.

    --

    If voting were effective, it would be illegal by now.

  84. Re:What exactly this Human Genome is at this point by dmccarty · · Score: 1
    Should my parents get credit for everything I make? Why not, they created me, right?

    Not really. Not in the sense that an inventor would create something. Your parents used a process of creation that people have used for thousands of years, but they didn't create the process.

    How about self-replicating programs that mutate every now and then? There was one that went from 80 commands down to 22 all by its little ole self. Can you say the original programmer 'wrote' it?

    No, I wouldn't say he "wrote" the final piece of source. But he did create it.

    And how is it human-centric to admit to ourselves that the earth does not exist simply for our presence?

    I'm not sure how you inferred that out of our previous comments. We weren't talking about what we do with the earth.
    --

    --
    Have fun: Join D.N.A. (National Dyslexics Association)
  85. Lawsuits.... by qwaszx · · Score: 1

    Okay... so we all sit here for 20 years reverse engineering the genome... and finally discover the 'source code' to making nice little humans, only to find the whole human race facing a lawsuit from {insert religious figure here} saying that that code was closed source, and the end-user-license was clearly on view in the Atlantis Legal Academy (which just happens to have sunk a few hundred thousand years back), with some wacky reverse engineering clause.....

  86. Get a clue by Peaker · · Score: 1

    Just because YOU lack the mental ability, or are just too ignorant to grasp Darwin's theory, does not make everybody who does stupid.

    A pile of transistors does not have any genetic base that can spontaniously modify (from radiation/mutation), whereas life, obviously does.
    Darwin also did not claim a cell came into existance from a bunch of molecules bumping into each other, Darwin took the cell's existance as a basis for his work.

    The connection of nurves/blood-vessels and most everything else would not be much of a problem, as those do get developed to accomodate for the body's new structure. Note some a-bomb radiation victims DID grow arms in weird places, and had all 'perfectly connected together'. The genes that make up the blood vessels and nurves are already written in a way that is 'general' enough to work for a modified gene pool.

    Also note that your analogy is also invalid because of no spontanious modification.
    A program that randomly creates software WILL create useful software at times (And that is easily proven), which is exactly what happens to genes by radiation and mutation.

    There are small software projects that show random mutation and radiation on a software base create new 'useful species' of such software.

    And as a final note, human civilization is NOT going through Natural selection, mostly. Humans no longer need much "fitness" in order to survive.
    He would survive just as well with or without a third arm, and therefore, that would not be evolved.
    If he could use a third arm in nature, it might just have a good chance of evolving.

    1. Re:Get a clue by Zerothis · · Score: 1

      I would like for people to think about Darwin's theory. Darwin's theory. Please note the difference between theory and fact.

    2. Re:Get a clue by dms0 · · Score: 1
      and you have a better solution to the problem?

      and dont try to tell me that any religious
      connection is fact..

      were all ears dude

      dms0

      --
      You should feel guilty if your just watching - ATR
    3. Re:Get a clue by Zerothis · · Score: 1

      and dont try to tell me that any religious connection is fact..

      I won't, you have seem to have dismissed this possibility outright so I will assume you have scientifically proven your stance and I look forward to reading your published works after they have been submitted for peer review.

      I have taken no stance and have nothing to prove. I never claimed I had a better theory or even a different theory. If there is anything dumber than creation or evolution advocates it would be people from the 3rd party that even momentarily consider one is absolute fact and the other must therefore be absolutely false.

    4. Re:Get a clue by Zerothis · · Score: 1

      Perhaps I could say since neither can be proven with certainty, both are equally unlikely. Then again maybe I won't.

      Absolutely nothing can be proven absolutely true or absolutely false. One can only be sure of the currently accepted facts. One of which is that the very definition of the word fact is not the same as definition of the word theory.

      It is currently accepted fact that the moon is made mostly of rock. I have no reason to doubt it. Darwin's theory still remains a theory not a fact. If this upsets you greatly then by all means, you have my encouragement to do everything within your power to prove Darwin's theory.

  87. Re:akey sucks by TGR · · Score: 1

    The duckling that went "moo".

    --

    Voting Moo Anyway!
  88. Re:Using CVS to check the two maps by Sodium+Attack · · Score: 1
    There's already plenty of tools to compare genetic sequences. And much better than diff-like functions for the purpose, because they're specifically designed for DNA and protein sequences. What, you think molecular biologists have never heard of computers, and they've been doing all their work by hand? That molecular biologists have never enlisted programmers to do such things before?

    There's a whole field devoted to this sort of thing, called bioinformatics. For one of the popular programs used to compare biosequences, do a web search for ClustalW.

    --

    Never take moderation advice from sigs, including this one.

  89. Where Can I sign Up? by Shady+Milkman · · Score: 1

    Where can I go to get my whole genetic code mapped out so I know what I'm gonna die from?? There has to be some company doing this...if not, any med-geeks wanna go in on it with me?

  90. Re:What exactly this Human Genome is at this point by scrytch · · Score: 2

    Hello fallacy of composition. The world is not a freakin watch, ergo there is no case for a watchmaker. I can't believe some people still buy this tired old theist argument.

    --
    I've finally had it: until slashdot gets article moderation, I am not coming back.
  91. honeymoon? by bmabray · · Score: 1

    Am I the only one wondering what Hemos is doing posting stories just 2 days after getting married? Dude, take a break from the geek compound & enjoy married life... :-)

    Or maybe the first application of the HGP was to clone Hemos...

    --
    human://billy.j.mabray/
    "Every good system has a backup." -- Dale Hanchey
  92. The real reason we went to the moon by copito · · Score: 2

    The moon landing was many things, but the main technolgical reason to pursue a moon landing was that it was a palatable way to spend billions on missile technology.
    --

    --
    "L'IT c'est moi!"
  93. Civ score +50 by cylcyl · · Score: 1

    Yeah! +50 bonus for being the first to complete this wonder!

  94. The First Step by johnnyd78 · · Score: 1

    As someone who could be entering the research field, this is incredibly exciting - but not because it's any sort of breakthrough development. Sequencing has been around for a while, just not on this scale. This sort of in-depth cataloguing is like maintaining a list of every grain of sand in a 64 sq.ft. area of beach.


    The real magic comes in when researchers take someone who can curl their tongue and someone who can't, do a diff on their genomes and in addition to finding out what sequences are responsible for each trait, find out what nonsense sequences are linked. Something that has been lost in all of this hubbub is that there is all sorts of nonsense data in the genome, or at least it's thought to be. It's kinda like dark matter to physics. One theory holds that it protects the chromosomes from decay - every so often, a base from the ends of the chromosome gets lost, so if you have some junk DNA there, you protect the good DNA. This is thought to be part of the aging process (wow - a molecular event proceeding on a visible level!). It could be a key to some sort of fountain of youth for all we know!

  95. Re: Article error? I don't think so. by gafter · · Score: 1
    No argument with most of that, colour of eyes and disease-proneness are identifiable. Intelligence? That's utter nonsense.

    Actually, this is so self-evident that you are probably assuming something subtle is meant here.

    The human genome is 99% similar to the chimpanzee. Who would doubt that the 1% differences between our genomes are responsible for the obvious differences between human and chimpanzee intelligence? I don't mean to imply that we are yet capable of identifying the specific causes of human intelligence by tracing them to specific genes and their develpmental consequences. It is not clear that differences in intelligence among individual humans are the result of genetic differences at all. But there can be no doubt that human intelligence develops in an individual as a consequence of (among other things) her genome.

  96. code by inetd · · Score: 1

    Does anyone know where i can download the actual code?
    I was thinking of shoveling it through my brand new C# compiler to see if anything interesting came out.

  97. Re:What exactly this Human Genome is at this point by maclay01 · · Score: 1

    My Result (Damn Hollywood promoters are everwhere):

    EthanHawkeasVincent&Jerome/UmaThurmanasIreneCass ini|Homo actorus1997sequence /len=122mins
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA

    --
    -- New findging: Early paste eaters 42% less likely to divorce.
  98. -1, Offtopic by Sodium+Attack · · Score: 1

    Evolution is just a theory the same way gravity is just a theory. I would like people to think about that.

    --

    Never take moderation advice from sigs, including this one.

    1. Re:-1, Offtopic by Zerothis · · Score: 1

      LOL!!!

      You never heard of the Law of Gravity?!

      ROFL!!!

      But darnit! You've seem to have offered evidence that you are a slightly evolved ape. Well I admit that you might be, but I'm not.

    2. Re:-1, Offtopic by Sodium+Attack · · Score: 1

      Ah, a law, not a fact!!! You yourself demanded facts as evidence. Laws can be repealed.

      --

      Never take moderation advice from sigs, including this one.

  99. Does this mean ANYTHING? by Chiasmus_ · · Score: 2

    As far as I understand, the human genome project gives us the ability to say, "Wow! Jon Katz's gene #34289689 on Chromosone #23 is ATCA.. that means he can't produce any pseudochlorohydrolynanelanymine-B in the cell membranes of his T-x84dg white blood cells!

    Well, big holy shit.

    In a way, if I make a tired Linux analogy, I'd equate the "completion of the human genome project" with "figuring out how to type ls, going into every directory, and drawing the tree". Of course, the analogy is flawed because filenames are (slightly) intuitive; this would be more along the lines of finally being able to read the file system, when the average file was named "a0sd8fhj09bv".

    Give it a shot some time. Write a Perl script to rename every single file in Debian to a random string of fifteen characters. Then go get your mom, tell her that "ls" looks at files, and ask her to install Enlightenment.

    In conclusion, we're all a little bit too excited about this.

    --
    "Beware he who would deny you access to information, for in his heart he deems himself your master."
  100. Partly, this: by Magic5Ball · · Score: 1

    The combined projects have between them most of the nucleotide sequences of about a couple dozen people (give or take). Previous research has provided additional data about human variation to some extent and can be combined with the maps currently being touted. What this all means is that very soon, you can dial in and look up any part of the chemical sequence to see what's is chemically there, and if you're good enough, take a guess at what that particluar region of nucleotides does (or just look it up, eventually). Or, you can take a protein, magic (detailed steps omitted) some possible nucleotide sequences out of it, and look for it in the geneome. You could then clone/insert/delete/experiment/etc with the gene or sequence of nucleotides more effectively.

    If you know where a particular defect is, it is easy to devise a gene therapy to correct the defect (make the correct form of the protein, etc). Knowing what the correct form of a particular gene is, we can also compare it to an individual's nucleotides at that location to see if the person has a particular defect, or even what form of defect s/he has. With enough data from more individuals to complement what is there now, it would be possible to determine certain genetic features of various groups or populations and do some mind-numbing statical analyses :-) etc.

    --
    There are 1.1... kinds of people.
  101. Then KDE must be... by DragonHawk · · Score: 2

    Isn't that supposed to be the "Human Gnome Project"?

    So what's KDE? The "Klingon Decoding Endeavor"?

    ;-)

    --

    dragonhawk@iname.microsoft.com
    I do not like Microsoft. Remove them from my email address.
  102. AH-HAH! by cr0sh · · Score: 2

    A Discordian plot, no doubt - the Law of Fives rears it's ugly head once more...

    Must...stop...madness...AGGGGGHHHHHHHHHH!!!!!

    jfkads;lkjfasldkf[wrqoiutwiqknjt/lknv;

    [EOT]

    --
    Reason is the Path to God - Anon
  103. Re:What exactly this Human Genome is at this point by Psionic+P.O.W. · · Score: 1

    It would be wonderful to see the open source community come up with something on this! I was thinking it would be cool if something was developed that used everyones home PC's and linked the power together. Kind of S.E.T.I @ Home style! - Just a thought

    --
    "Opportunity is missed by most people because it is dressed in overalls and looks like work." - Thomas Edison
  104. too frickin hard to do by unc_onnected · · Score: 2

    the problem with trying to map methylated bases is that there are shitloads of modifications to dna going on all the time. there is a whole classification of enzymes (kinases) whose sole function is to methylate or demethylate proteins and dna.

    kinases have been implicated in a very large number of biochemical pathways for practically every process. methylation is a regulation mechanism for dna. methylation is likely to change the conformation (shape) of parts of dna, allowing binding or blocking binding of proteins and consequently allowing transcription (or the lack thereof) to occur- in effect turning gene/protein activity on and off.

    this is important, but in any single organism over its lifespan thousands upon thousands of bases will get demethylated or demethylated. in fact, any individual gene is likely to be methylated or demethylated, and there are no doubt a significantly large number of genes which are methylated and demethylated many, many times over the organism's lifespan. this results in millions of possible sequences of bases which are methylated or demethylated.

    i just dont think this sounds like a feasible project. biologists right now tend to find out meth or demeth bases by studying genes or pathways one at a time. i tend to lean towards this approach as being more intelligent.

    (i kinda sorta paid attention in biochem class...but i could be wrong...)

    unc_

  105. Re:What exactly this Human Genome is at this point by ShadyG · · Score: 1

    Oh my God. Are you sure that was CTAATTTGCCCACTTTTCTTGAACTTCACATCA? Not CTAATTTGCCCACTTATCTTGAACTTCACATCA? On chromosome 22? Holy shit. No wonder...

  106. Re:Celera sucks. by dankjones · · Score: 1

    Actually the Gubbament just recently made some sort of antitrust type ruling limiting patenting of human genome info. It's a two edged sword. If you don't give companies rights to protect information they are less motivated to innovate. I still say.... BREAK OUT THE OPEN SOURCE HUMAN GENOME PROJECT BABY WOOOOOOOOOOO!!!!!!!!!

  107. Open source human genome project (WOO HOO!) by dankjones · · Score: 1

    Why couldnt somebody out there outsource computer time to all us folks with cycles to spare for cracking the genetic code. Seems a lot more usefull than seti@home.

  108. Apes and Humans by Mr.+Ed · · Score: 1

    You've got to wonder..what would an ape ask for if he got the ability to alter his genetic structure? Bigger muscles, and longer fangs! He wouldn't ask for an upright posture, larger forebrain, and Natalie Portman.

    --
    "Beauty is in the eye of the beer holder"
  109. um... by PaintJob · · Score: 1

    DNA is that stuff that somes in the red box with the little kid on it in the sailor's uniform, right guys? You know the prizes and such... sorry for wasting your time while reading this.

    --
    recall your inner-child. question everything.
  110. Opensourcing life, the universe and everything by tve · · Score: 1

    ESR proclaims God finally 'gets it'.

    --

    If there is hope, it lies in the trolls.
  111. Re:You get a clue by Sodium+Attack · · Score: 1

    Read a bit about evolution rather than attacking the strawmen creationists set up; don't show your ignorance.

    --

    Never take moderation advice from sigs, including this one.

  112. Re: Re: Article error? I don't think so. by ksw · · Score: 1

    The human genome is 99% similar to the chimpanzee. Who would doubt that the 1% differences between our genomes are responsible for the obvious differences between human and chimpanzee intelligence?

    You must be at very hairy dude then

  113. Re:You get a clue by Sodium+Attack · · Score: 1
    Follow the link the other AC gave in his response.

    Oh, and the answers you want are not in any book? How do you know? Have you read every book ever published??

    --

    Never take moderation advice from sigs, including this one.

  114. Re:^chuck^ sucks by ^chuck^ · · Score: 1

    go away bot or i shall replace you with a very small shell

    --

    Lemure, wtf! Don't you mean Lemur?