speaking of me (company co-founder)
on
Photoshop for DNA
·
· Score: 1
Four quick comments:
(1) I don't think that we really know how to engineer biology yet. Progress at the moment is taking the form of adapting (stealing?) past lessons from other engineering disciplines, from when they got started back in the "good old days," and seeing if they are worth a damn in biology. Ideas like (i) standardization, (ii) abstraction, and (iii) decoupling. We've got a lot of work to do. Help. Check out the Registry of Standard Biological Parts as one place to get started.
(2) I'm really freaked out by the idea that we might see a "microsoft equivalent" developing in biological engineering. Imagine if our wheat in the year 2050 is running the equivalent of Windows95. That seems like a "bad idea." Please see comment (4) below.
(3) I'm also concerned by the possible, future mis-application of biological technology. But, I think that the only way to deal with this problem is to (i) expect that it will, at some point in time, happen, and (ii) make sure that there are many, many, many more people who understand what is going on and who can work together to fix the problems. Mitigation of future biological risk feels like solving problems related to the security of an open distributed network. Imagine if I told you that nobody was going to write computer viruses and not to worry about network security. The same thing is going to become true in biology, we just have to make sure that the numbers of folks who are disposed to cause harm are very small relative to the numbers of folks who are empowered and want to be constructive. See this PDF for more thoughts on this topic (apologies if it seems a bit abstract).
(4) We (some folks at MIT and all over) are starting a not-for-profit called the BioBricks Foundation (BBF) to help promote the development of open biotechnology. Here's the current plan (very early). Please help if you want (or by a T-shirt when they are ready)! I'm donating all stock/income that I might receive from working with Codon to the BBF.
Patent Number: WO0154541 (UK)
Publication date: 2001-08-02
Inventor(s): WIENER DAVID
Applicant(s):: SOUNDTUBE ENTERTAINMENT INC (US)
A speaker assembly (100) is provided including a rigid front speaker mounting element (102) defining at least one speaker mounting opening (103), at least one speaker driver (104) coupled to the at least one speaker mounting opening (103) of the speaker mounting element (102), at least one flexible bladder (106) at least partially forming the sides and rear of the enclosure and coupled to the speaker mounting element (102), and a valve (108) coupled to the flexible bladder (106). The flexible bladder (108) has a first wall portion (110) and a second wall portion (112) defining a substantally air-tight interior space (114) therebetween and may take any desired shape when inflated. Together, the speaker mounting element (102) and the bladder (106) form at least one interior chamber (116) at least partially surrounding the speaker driver (104). The valve (108), which provides a substantially air-tight seal when closed, is in fluid communication with the interior space of the flexible bladder (106) and can be used for inflation and deflation of the bladder (106). The bladder (106) is inflatable by providing either pressurized gas or expandable foam within the interior space. Alternatively, the bladder may be formed as a plurality of independently inflatable cells, or may be evacuatably-formed from a material having shape retaining memory properties. After use, the bladder (106) enclosure may be removed from the speaker mounting elemet (102), and deflated for reuse, or disposed of.
"The ability to add rotate and resize extensions to X. Combined with the accelerometer, this allows windows to dynamically maintain their top/bottom orientation as the iPAQ H3600 itself is rotated."
besides sounding extremely cool, wouldn't this help out LHPs? just hold the thing "upside down".
First, there's an interesting, relevant and relatively easy-to-read article by Jack Szostak and co-workers titled "Synthesizing Life" in the January 18, 2001 issue of Nature (vol 409, page 387). In this article they talk about the challenge of creating vesicles and effecting their replication, creating a molecular information-storage device capable of self-replication and coupling the vesicles to the information-storage/replication device in order to get a living/evolving system. Many of the questions raised in earlier comments are addressed. Most relevant to making life, or pieces of life, in space might be the issue of very low local concentrations? Article here [non-free login required (mrrr!)]. Alternatively, you could likely get a reprint from the authors directly by contacting them
Second, one of the more interesting things I remember Freeman Dyson saying was that he thought we should be looking for extraterrestrial life *outside* of gravity wells. That is, he thought it was more likely that things far-along enough to communicate with us would prolly not be sitting at the bottom of a well.
The sequence you are claiming shares a 20 nucleotide region near the 3' end (ccttaatagagaggaaatat) with the protamine p1 gene.
Check for yourself here. It has one start and six stop codons and only one four codon (whee!) open reading frame (ATGCGGCCTTAA). So, it doesn't appear to be that interesting/useful/keep it/hope you aren't selling the farm enforcing your claims (grin)...
Maybe this came up earlier and I missed it, but...
There was an article by Seth LLoyd from MIT in Nature volume 406, pp. 1047-1054 last month exploring how much computing power you could theoretically expect to get out of 1kg of mass taking up a volume of 1 liter. The result was ~5x10^50 operations per second. You can (eventually) get to the original article here (but annoying registration required). Anyway, we've got a ways to go.
Four quick comments:
(1) I don't think that we really know how to engineer biology yet. Progress at the moment is taking the form of adapting (stealing?) past lessons from other engineering disciplines, from when they got started back in the "good old days," and seeing if they are worth a damn in biology. Ideas like (i) standardization, (ii) abstraction, and (iii) decoupling. We've got a lot of work to do. Help. Check out the Registry of Standard Biological Parts as one place to get started.
(2) I'm really freaked out by the idea that we might see a "microsoft equivalent" developing in biological engineering. Imagine if our wheat in the year 2050 is running the equivalent of Windows95. That seems like a "bad idea." Please see comment (4) below.
(3) I'm also concerned by the possible, future mis-application of biological technology. But, I think that the only way to deal with this problem is to (i) expect that it will, at some point in time, happen, and (ii) make sure that there are many, many, many more people who understand what is going on and who can work together to fix the problems. Mitigation of future biological risk feels like solving problems related to the security of an open distributed network. Imagine if I told you that nobody was going to write computer viruses and not to worry about network security. The same thing is going to become true in biology, we just have to make sure that the numbers of folks who are disposed to cause harm are very small relative to the numbers of folks who are empowered and want to be constructive. See this PDF for more thoughts on this topic (apologies if it seems a bit abstract).
(4) We (some folks at MIT and all over) are starting a not-for-profit called the BioBricks Foundation (BBF) to help promote the development of open biotechnology. Here's the current plan (very early). Please help if you want (or by a T-shirt when they are ready)! I'm donating all stock/income that I might receive from working with Codon to the BBF.
Thanks/take it easy!
Drew
I'll try to respond to some of the posts to this article and provide links to more information over the next couple days; today is a bit hectic.
Patent Number: WO0154541 (UK)
Publication date: 2001-08-02
Inventor(s): WIENER DAVID
Applicant(s):: SOUNDTUBE ENTERTAINMENT INC (US)
A speaker assembly (100) is provided including a rigid front speaker mounting element (102) defining at least one speaker mounting opening (103), at least one speaker driver (104) coupled to the at least one speaker mounting opening (103) of the speaker mounting element (102), at least one flexible bladder (106) at least partially forming the sides and rear of the enclosure and coupled to the speaker mounting element (102), and a valve (108) coupled to the flexible bladder (106). The flexible bladder (108) has a first wall portion (110) and a second wall portion (112) defining a substantally air-tight interior space (114) therebetween and may take any desired shape when inflated. Together, the speaker mounting element (102) and the bladder (106) form at least one interior chamber (116) at least partially surrounding the speaker driver (104). The valve (108), which provides a substantially air-tight seal when closed, is in fluid communication with the interior space of the flexible bladder (106) and can be used for inflation and deflation of the bladder (106). The bladder (106) is inflatable by providing either pressurized gas or expandable foam within the interior space. Alternatively, the bladder may be formed as a plurality of independently inflatable cells, or may be evacuatably-formed from a material having shape retaining memory properties. After use, the bladder (106) enclosure may be removed from the speaker mounting elemet (102), and deflated for reuse, or disposed of.
from the site:
"The ability to add rotate and resize extensions to X. Combined with the accelerometer, this allows windows to dynamically maintain their top/bottom orientation as the iPAQ H3600 itself is rotated."
besides sounding extremely cool, wouldn't this help out LHPs? just hold the thing "upside down".
First, there's an interesting, relevant and relatively easy-to-read article by Jack Szostak and co-workers titled "Synthesizing Life" in the January 18, 2001 issue of Nature (vol 409, page 387). In this article they talk about the challenge of creating vesicles and effecting their replication, creating a molecular information-storage device capable of self-replication and coupling the vesicles to the information-storage/replication device in order to get a living/evolving system. Many of the questions raised in earlier comments are addressed. Most relevant to making life, or pieces of life, in space might be the issue of very low local concentrations? Article here [non-free login required (mrrr!)]. Alternatively, you could likely get a reprint from the authors directly by contacting them
Second, one of the more interesting things I remember Freeman Dyson saying was that he thought we should be looking for extraterrestrial life *outside* of gravity wells. That is, he thought it was more likely that things far-along enough to communicate with us would prolly not be sitting at the bottom of a well.
Syllepsis wrote:
BTW, better check yourselves for this: TAGCTAGCTAGCTTTACAGCTACCGCTAGCTTAGCTGA GCTTCTGATCGATCGAAACGATCAGCTGATCGGCTAGCTTA GGCTTAGCTAGCTTAGCGAGACTAGCGATCGACTAGGCGCG CTAGCGGCTAGCTATTATTATATGCGGCCTTAATAGAGAGG AAATATCGACTGACTACTAGCTACGCGCGTACGCT
The sequence you are claiming shares a 20 nucleotide region near the 3' end (ccttaatagagaggaaatat) with the protamine p1 gene. Check for yourself here. It has one start and six stop codons and only one four codon (whee!) open reading frame (ATGCGGCCTTAA). So, it doesn't appear to be that interesting/useful/keep it/hope you aren't selling the farm enforcing your claims (grin)...
Maybe this came up earlier and I missed it, but... There was an article by Seth LLoyd from MIT in Nature volume 406, pp. 1047-1054 last month exploring how much computing power you could theoretically expect to get out of 1kg of mass taking up a volume of 1 liter. The result was ~5x10^50 operations per second. You can (eventually) get to the original article here (but annoying registration required). Anyway, we've got a ways to go.