I beg your pardon, but the FSM is a fake! I always pray to the Almighty Bob. I heard of His good name when the mayor came to speak of him in my quiet sandwich shop, and it has changed my life.
Thank you, and may Bob bless you. Vernon is a false prophet!!
That doesn't sound that reasonable to me at all. They should be able to provide a list of addresses or phone numbers to the broadband provider and have that provider say yay or nay. That's how you do it on the broadband providers' web sites as it is. All the regulatory agency has to do is give a more granular list for the provider to check against in their database, and then randomly sample the results to ensure that the provider didn't make a mistake or lie to them. That sounds pretty reasonable to me.
Copying a genome is copying a genome, regardless of whether it's a plant or animal. The end result is the same. You have an identical copy, and that begs the question: If A=B, why must B be labeled if A need not be?
I would tend to agree with you, but thus far, cloned animals are demonstrably not identical copies of the parents. If they were, I would definitely think that this legislation is lunacy, but I think that we have some work to do before we can be certain about the effects of animal clones in the food supply.
Yes. That's all Imus is saying. Girls that play basketball are fucking ugly. You know it. I know it. Everybody knows it. Why is this an elephant in the room that we can't admit to in public? Who the hell decided to let woman play basketball professionally? Is there even a market for watching ugly she-males playing basketball?
So, if you were to meet one of them in person, would you point that out to her? Probably not. Why? Because that would make you an asshole. Therein lies the problem. Imus gets paid to be an asshole and be funny about it. At least, it should be funny enough to a large enough segment of the audience that he can keep doing it. Apparently, he failed to be funny this time around and just pissed a bunch of people off.
It's not as if he was just trying to broach an important and relevant topic that was being unreasonably ignored. He was trying to score some laughs by mimicking some sort of "ghetto talk" as kind of a lame satire. It fell flat and for once, his "I'm a maverick, get over it!" attitude and reputation failed to save his ass. Too bad, so sad.
You're forgetting that he supported Kerry in 2004 and even supported him after Kerry's stupid "if you're dumb, you join the Army" (paraphrased) remark. MM was monitoring him because he was a target for removal... he didn't toe any Leftist line and should therefore be silenced. These thugs can't win in the marketplace, but they can win by going on the attack.
Look, if you tie your career to backlash against political correctness and showing off how "edgy" you are, you shouldn't be surprised when you eventually cross the line and people don't think it's funny. Some people are smart enough to see the line coming and some people aren't. Them's the breaks.
Imus is a tough, bad-ass, anti-establishment kind of guy, right? Then he can learn to live with the consequences of it just as he reaped the rewards of it for years and years.
If I sell a used item on eBay, to my neighbor, at a yard sale, etc.: Sales tax (most-likley) has already been paid on the item at the time of the original sale. Charging sales tax again is double-dipping --like they do to you when you buy/sell a car, boat, etc.
That's why they call it sales tax and not the tax on tiny-e's stuff.
Sounds great, unless one of those 275 is someone that you care about.
This smells strongly of the "if even one life is saved, it's worth it" logic. We make decisions about the costs and benefits of potentially fatal behavior every day. This one is nothing new and it's a no-brainer. Tens of thousands of people saved vs 275 killed is a pretty good record. Check the box and move on.
If we're concerned enough about a single digit per year death rate due to ambulance accidents that we're willing to consider reform, we shouldn't be driving at all.
It is possible that reasonable people disagree, but you and I agree on a lot more than you might realize. In fact, the only thing I really disagree with you on is the above point you made.
The funny thing about all this is that for how divisive an issue it is, most Americans agree on most points. There are few if any mythical crazy liberals who want American soldiers to die, and there are probably just as few supporters of the war who just want our troops to roll in, kill everybody, and take the oil. It's unfortunate that so many people don't realize that the vast majority of us just want this thing to end with the best possible outcome for everybody.
I think it's reasonable to consider that the constant battery of criticism became a self-fulfilling prophecy, especially considering the nature of the people and ideology that the U.S. is fighting and the tactics that they would have to use to win. This is a media war as much as anything. Terrorism is a psychological tactic that has no effect without the media support -- you really can't separate the two.
That's certainly a fair point. It would be great if we could simply ignore terrorists entirely, but that kind of a black out on bad news also makes it impossible to measure the success or failure of an operation. My problem is that our leaders have never been able to act appropriately in that sort of environment. If they can tell us whatever they want, they'll tell us that they're doing a great job and that we shouldn't worry.
I also think that if you really thought the war was a total lost cause from the beginning, that you'd have a much stronger argument against it if you don't do anything to undermine it and it still fails. Then you could say something like, "We did everything we could to support a bad decision, it still failed, lesson learned."
If I could think of a reasonable and practical way to do that, I would certainly agree. The problem is, how long do you sit in the dark while politicians lie to you about how great everything is before asking where the beef is? I'm as disgusted as anybody at a Congress that essentially approved the operation and let it go to hell with no oversight and now that things are going badly, they're more concerned at earning political capital than fixing the issue. My problem is that the only meaningful system of oversight I can see is an adversarial political system combined with news outlets that aren't afraid to carry bad news.
Personally, I think that's the mature and honorable approach in this case. There are very few blunders that are so bad that nothing good can come of them, and I don't believe that OIF was one of them.
Oh, I definitely won't say that nothing good could have come of it. Getting rid of Saddam Hussein and ensuring that no weapons of mass destruction were there are both good things, but at what cost? My problems with the operation were that they were extremely high risk with minimal payoff, and the motives for doing it were more the implementation of academic neo-conservative fantasy than an actual desire to fix anything. If our leaders had poured resources into it the way they should have rather than promising a cheap, easy victory with tax cuts to boot, they may have been able to keep law and order long enough to make the whole thing work. It may have even resulted in serious democratic reform there (although I doubt the long-term stability of any government would be seen as the puppet of a hated foreign power).
The unfortunate fact now is that we've missed that opportunity, so we either need to buckle down and pour resources into fixing this problem like we've never done before (and even then, I believe that we're more likely to fail than to succeed), or we have to walk away and let everything go to hell and honestly admit to ourselves and the world, "Yes, we just screwed all of those people. We've learned our les
Sure. But not in public. The war ends when one side decides it's not worth fighting anymore. When the other side is constantly arguing and in-fighting, it emboldens their enemy, prolonging the war.
The problem here is that politicians don't listen to rational discourse behind closed doors. The listen to voters roaring for them to take action or leave office. If I thought that the best way to make things work out for the best is to write a letter or have our leaders have a negotiating session in private, I'd be all for it. The reality as far as I can see is that our leaders see their own political careers as the most important casualty of any war. Until the public makes enough noise, nothing gets better, and the public doesn't make noise unless people point out what's going wrong in an embarrassing and public way.
Do you read what the radical Islamists write about to each other? That they must stay strong and fight, and that they are winning because of internal U.S. conflict? This message wouldn't be too influential if the New York Times weren't proving their point daily.
The public (or, at least the members of the public who weren't losing family members) would still think that this clusterfuck was the best thing since sliced bread if it weren't for the New York Times and their ilk pointing out what a dismal failure it has been. Millions would be cheering every time our leaders say, "We just need to borrow a few more billion dollars from your grandchildren while we send a few thousand more of your children into harm's way. We're winning and doing great things!" An informed populace is the only defense against the government doing terrible things and claiming the best. It should be clear from how hard the Bush administration is trying to put lipstick on this pig that if nobody was there to call them on it, they'd be telling the public how well everything was going. Nobody would know the truth.
Again, the decision to go to war may have been stupid, but second-guessing that now is the real sunk cost. We're in it, we should be in it to win, in order to minimize the protracted loss of life.
I think it's possible that reasonable people may disagree. The whole point of a sunk cost is that you ignore it when deciding whether to go forward or not. If you agree to pay a million dollars for a pair of shoes and after the first $100,000 of payments, you realize that $900,000 is too much to pay for the pair of shoes, you walk away. You don't say, "Well, I've already spent $100,000, so I have to buy the shoes now." There are reasonable arguments to be made that we're not minimizing the protracted loss of life but rather just delaying an inevitable descent into civil war. I'm not entirely convinced of that case, but I'm also definitely not convinced that walking away isn't a rational option. I'm certainly not convinced that the only way for things to work out is for us to grin and write yet another blank check to the bozos who started this thing in the first place.
And as far as rooting for failure goes, nobody even waited to see how things were going to work out. You had critics from day one -- even the same people who voted to go to war. So don't pretend that it's a simple "oh, this didn't turn out right, let's change course." It never was about the war, or the country, it was about political gain.
I don't know about anybody else, but I was a critic from day one for a variety of reasons. I didn't see the reasons for war as compelling, WMD or no. I saw it as a very effective way of stealing resources from a worthwhile endeavor in Afghanistan. I believed that it was very likely that we would simply destabilize the country and turn it into a war zone for nutty factions to fight over the power vacuum. I saw it as a quick way to burn the international goodwill we had going for us in Afghanistan. Worst of all, I saw it for what it was: The ham-
Note that he didn't say that Iraq and al Qaeda had a collaborative relationship, and he didn't say that the Iraqi government supported the 9/11 terrorist attacks against the US. He said that al-Zarqawi was in Iraq before we were, that he organized al Qaeda operations in Iraq before we got there, and that he precipitated sectarian violence in Iraq after we overthrew Saddam Hussein. This isn't playing "word games" - it is stating documented facts that nobody disputes.
Simple question: Why bring this up? Was going after Al Zarqawi a reason for the war? That's my point. Every time Cheney comes out and says something about Iraq, he's selling the invasion. Otherwise he wouldn't be bringing it up. "We're great because we saved you from the big bad menace of Iraq." The fact that a known terrorist was in Iraq at the time isn't exactly a justification for the action. It's nice that we killed the guy, but it's also clear that the whole point of bringing up Al Zarqawi was to tie the words "Al Qaeda" and "Iraq" together to get gullible people (People listening to Rush Limbaugh gullible? Surely I jest...) to think that Iraq had something to do with 9-11.
Why do you think that for years after it was disproved conclusively, the majority of Americans believed that Iraq was at fault for 9-11? I would argue that it's two factors: First, the public seems to be a bunch of morons. Second, Bush and Cheney know that, and they're more than willing to carefully try to tie Iraq to 9-11 and wave the bloody shirt because they know that they can push their agenda that way. No, it's often not out and out lying. It's often simply the careful, manipulative presentation of facts to a gullible audience designed to produce results. While I generally don't use the word "lie" to describe it, it's also not exactly the best way to create an informed public. I'm torn between being more pissed off at people who are stupid enough to fall for this stuff and leaders who are smart and cynical enough to do it. I guess my most complete take on it is here.
Question the war before, and after, not during. If you must question it during, it must be done in private. The country should be a unified front when not being seen as such will put soldiers' lives at greater risk. That's all.
Nonsense. Flat out nonsense. This is the same crap that we've been fed about how the hippies lost the Vietnam war for us. The time to question a massive, stupid expenditure of money and lives is every minute until it's over. Think sunk costs here. Don't trickle real living breathing human beings into the meat grinder simply because you decided to do so a while ago and don't want to question it until it's all over or they're all dead.
This is the first step in the idiots who supported the war slowly shifting the blame for its calamitous results to the people who didn't. We didn't lose the war because it was a stupid idea that was poorly implemented and badly run from the beginning. We lost the war because those crazy liberals didn't clap hard enough for it. Matt Taibbi's response to Joe Klein about liberals "rooting for failure" probably sums it up the best:
For most of us, if we thought there was any chance this thing could work, we'd have been for it, or at least not so violently against it. Instead, our opposition to the war was based on our absolute conviction that it would end in disaster -- which it incidentally has. But according to Klein, if we see a guy step off the top of the Empire State Building, we're supposed to root for him to nail the dismount. The whole issue is irrelevant and absurd. This is a catastrophe, not a baseball game. "Rooting" is a kid's word; grow the fuck up.
That's bullshit. This is just an excuse people use to try evade guild and blame someone else.
I would like to take this moment to pat you on the back. You're absolutely right. Let me add to your comments:
No, the administration was not at all honest in how it went about starting its little war. All this "I was lied to" crap is just whining, though. They didn't lie so much as manipulate. If you get manipulated by such transparently stupid bullshit, you deserve it. You can't sidestep blame. It was obvious from the beginning what the Bush administration was trying to pull, so don't brag to me in moral indignation about the fact that you were too damned dim witted and naive to see through it and just look at the data. I read all these complaints as, "I'm too much of a moron to have looked at the data myself, so I just blindly trusted one of the most obviously cynical and transparently Machiavellian administrations in the history of the US." Too bad for you. This is just as much your fault as George Bush's.
I almost have more respect for the people who are still trying to claim that it was a good idea than I do for wimps who are trying to pass the buck by admitting that they were too damned dumb to see this coming. That goes doubly so for the Democratic members of congress who are trying to claim that they were just babes in the woods when all this started. If I could see through this by reading a newspaper, they should have been able to use the fact that they have access to documents that I'll never be able to touch in order to figure out the obvious. There's no place for, "If I knew then what I know now, I would have been against it." If you knew then what you know now, you would have been intelligent and informed rather than a moron.
Lie? Are you somehow claiming that al-Zarqawi wasn't in Iraq in 2002, and that he didn't have extensive ties to al-Qaeda? I sure hope not, because those are documented facts, and that is exactly what Cheney has said all along.
Aside from the fact that "Al-Qaeda in Iraq" and "Al Qaeda" are not the same organization, there's a difference between being physically located somewhere and having ties to the government. Cheney is basically trying to get everybody to foam at the mouth by implying that Iraq somehow supported the people who attacked us. In reality, there as no Iraqi government support for the attacks against the US he's just playing word games and trying to rationalize a colossal military and foreign policy blunder.
Um, me? Why would I go out of my way to introduce points of failure in an integrated system with the promised benefit of gaining, like, 5% more speed? (not trolling btw, just curious)
I wouldn't even go that far. I just built a debian system on an amd64 machine and went through to customize the kernel. What I found was that I only changed a few minor options from their stock amd64 configuration. The only major difference is that the one that comes from Debian has every module under the sun ready to load, and I didn't feel like screwing around disabling them to save a few minutes of compile time. I spent quite a lot of time messing around for no appreciable gain.
I used to do a lot of kernel building and tuning. When I was in college, my machine always had the bare minimum kernel stripped down to just what I was using. It made a difference, but it was a pain. These days with the set of options available in the pre-packaged kernels, I rarely bother unless I need something weird (e.g. The 4KB kernel stack size is too small). When I go down the list of reasons to take my time to build a custom kernel, performance is just slightly ahead of "I like watching text scroll by" in order of importance.
Indeed. Like the american's outrage over the public display of Janet Jackson's nipple. Talk about "ass-backwards".
The thing I find most interesting about the incident was that the nudity was a huge issue (let's grant for the sake of argument that it should have been), but dance choreography that included a man aggressively tearing at a woman's clothes apparently wasn't a big deal. WTF?
I don't see what else this would achieve without just being a way of gouging money, and further screwing job-seekers who actually want to pay taxes, contribute to the economy and the growth of American companies. I don't subscribe to the idea that skilled workers take American jobs, I believe they help companies grow and generate more jobs in the long-term.
I think that the point of the H1-B program is that would could skim the most valuable workers from other economies without creating a total labor glut of mediocre people do depress wages all over. The idea was, if you need somebody with special skills that you can't easily get around here, you should be able to hire abroad. A lottery system doesn't perform that function nearly as well as an auction system would. Why give a visa to a person who was hired because he was slightly better than his competitors when you could give the visa to somebody who was so much more of a valuable rarity that his employer was willing to drop $100K or more on a visa to get him in the door? Giving the visa to the first person and sending the other person packing is a seriously suboptimal outcome.
In fact, it might be interesting to initially auction the set of visa slots off and then create a market for privately trading them afterward. New visas would issue at the market price like corporate stock. The price of a visa would more accurately reflect the discrepancy in value between the local market and the worldwide market and give labor economists interesting numbers to work with simply by watching price fluctuations in the visa market. The particulars could be pretty tricky, but the idea may work.
I have it on authority from a Glaswegian that Glasgow has the best stab-wound doctors in the world.;-)
On a related note, I seem to remember reading that there are a number of European countries that send their military trauma surgeons to the big cities in the US to train. If they didn't, they might very well arrive on the battlefield never having seen a gunshot wound.
Sorry for the slow reply, now that school has started up again I've been very busy, but I will try to keep posting, for now.
Not a problem. Slashdot is full of busy people, and students tend to be particularly so.
Sure, scientists can look at what historically has been, but remember, an ape, a tree, and ice absorb C14 from the air. Each specimen will breath in a different amount of air giving a different original amount of C-14 So, even though hours of research have gone into it, they truly are little more than just assumptions.
That's going to depend heavily on the organism. There's no known method by which organisms distinguish between C12, C13, and C14 when they absorb carbon from the atmosphere. I'd be very surprised if there was any reference that indicated concrete examples of this. There are, however, a few ways to get strange isotope ratios. The best known is through the shells of mollusks that get their carbon from the limestone they inhabit. Obviously, their source of carbon is not the present day atmosphere, so carbon dating is meaningless. Likewise, trees that live for hundreds or thousands of years will have layers of old tissue and new tissue, and anything that eats the old tissue will inherit a funky carbon ratio, as will anything that eats those organisms. Most animals, though, eat the parts of plants that have extremely short life cycles (leaves and fruits). The carbon from those parts is sourced from the atmosphere at the time those features grew. There's little practical way that a cow that eats grass whose blades grow seasonally could get old carbon into its system. I can see an argument for a primate that eats termites that eat old wood, but that's an exception to the rule. As I said, carbon dating isn't perfect, and it requires some knowledge of what it is that you're dating, but it's not nearly as flawed as you seem to want to make it out to be.
It's worth noting that calibrated carbon dates do show very good accuracy through recorded history. If it were all as arbitrary as you say, that wouldn't be the case.
If you'd like some evidence to back this up, here it is: "Radio-carbon dating is a method of obtaining age estimates on organic materials. The word "estimates" is used because there is a significant amount of uncertainty in these measurements.......The C-14:C-12 atmospheric ratio is known to vary over time and it is not at all certain that the curve is "well behaved."" Here's the Source
As far as I can tell, the source is correct, but as discussed above, I don't think that the claim of differential rates of C14 absorption are accurate. As far as I have been able to find, bad ratios of carbon have to do with the source of absorption and the age of the organism, not on some method that allows them to "reject" certain isotopes of carbon.
I'm sorry for the confusion here, what I meant by decay was non-radioactive decay. "In early September, British researchers reported that warmer temperatures were causing the soil to heat up and dramatically increasing rates of decay. The temperate forests and fields of the United Kingdom are becoming, in essence, semitropical."
This is a very important distinction. Radioactive decay of the type we're discussing has absolutely nothing to do with the type of decay you just brought up. It's a complete red herring. Higher temperatures make the water from swimming pools evaporate faster as well, but that has nothing at all to do with the well understood process of atomic decay.
I was simply trying to point out that the earth is constantly changing and we can not just assume that processes are always occurring at the same rates. And since science is based on observation (look at the scientific method), observation is necessary to prove something. In this case, since the half-life of C-14 has been CALCULATED to be AROUND 5700 years, w
I was able to eliminate any problems like those of the OP by simply sending an email out that reminded everyone of my foreign contacts of the change.
Something which clearly, when done by everybody in a company with hundreds or thousands of employees, costs absolutely nothing and never results in errors, obviously.
If they start shifting the time zone boundries around for arbitrary reasons seasonally then I'll have an issue with timezones.
Another great thing about DST is that time zones do shift around for arbitrary reasons as a result of it. Like, for example, when some unnamed country's dumbass legislature decides to change when DST starts and ends while other countries don't. This gives us the added bonus of the fact that time zones not only shift arbitrarily, but the shifts aren't even necessarily correlated with longitude! Hooray!
Hey, I don't want to be a douche here but your problem is not with Daylight savings. Your problem is with communication. And yes, sometimes a lack of communcation can be expensive.
So adding yet another variable into the equation has nothing to do with the problem? Having to keep track of arbitrarily shifting clocks is an expense. Yes, it can be dealt with, but that doesn't mean it's not a problem. If I take a swing at you and hit you in the face, at least a teensy weensy bit of the blame should fall on me for causing the problem, not just on you for not being quick enough.
Why would you buy such a clock? Is it really too much effort for you to set your clock two times a year? I know I'm lazy, but this is ridiculous.
The whole point of a clock is that you ask it what time it is and it tells you. If you have to tell your clock what time it is, it's not performing that function. I'd wager that most Americans forget to change their clocks during this ridiculous semi-annual exercise and end up working on the wrong schedule for at least part of the day. Having a clock that...well...tells the correct time during this confusing period can prevent missed appointments, missed flights, etc. It's not about the number of calories you burn changing the time. It's about what being an hour off in your schedule without realizing it can cost you.
Apparently there was a bit of ignorance on my part of where the information on information theory that I was referring to came from. It falls under information theory, but is more specifically called the 'law of conservation of information.' It was coined by a man named Medawar "to describe the weaker claim that deterministic laws cannot produce novel information." A man named Tellgren claims that it is mathematically invalid, Dembski disagrees, and the mathematical proofs thereof are all above and beyond my capacity for understanding.
The point here is that while selection could be called deterministic, the input to it is random. Even if deterministic systems can't create new information (and I suppose I'll tend to agree barring somebody pointing out where I'm wrong), the random mutations that drive much of natural selection are decidedly not deterministic. I suppose that one could say, philosophically, that the entire universe is predetermined and pre-loaded with all the information we need, but I'm excluding that point for the moment. I know that if I say that too loudly, MarxistHacker42 will show up. Natural selection is essentially a filter for a huge amount of information being pumped in into it in the form of mutated and crossed over genetic material.
According to Rudolf Clausius, "The entropy of an isolated system not in equilibrium will tend to increase over time, approaching a maximum value at equilibrium." What definition of the second law are you using that gives my point trouble?
That's a much better definition. The part you're missing is the phrase isolated system. Life is not, by any stretch, an isolated system. It constantly takes in energy and keeps its localized entropy low. Once you start doing that, all bets are off and the whole thermodynamics argument goes out the window. Self-replicating systems are essentially machines whose job it is to take in energy and high-entropy inputs and create low-entropy output. It is also worth remembering that the second law is probabilistic in nature. It's possible to violate the second law on very small scales (cold regions of molecules allowing a net flow of heat to warmer regions of molecules), although extremely unlikely for macroscopic violations to happen. In short, tiny violations of the second law can and do occur on the molecular level.
You can put a bull in a china shop and generate a ton of energy, but nothing good can come of it. I've seen people in pools expend huge amounts of energy to get to shore and fail because they didn't know how to focus it (they made it out ok). You can take the pieces of a clock, put them in a bag and shake it for eternity and it'll never actually come together to make the clock. You can put a frog in a blender and expose it to a lot of energy, but no life will come of it.
These are all fine aphorisms, but they really don't address the topic at hand. Natural selection is the focusing mechanism. When one mutates DNA (or produces novel sequences through sexual reproduction), one is throwing your proverbial clock parts into a bag. The difference here is that natural selection filters those results and can actually end up with a clock. Let's modify the experiment for the moment: Imagine you shake that bag around and there's a little person inside. Whenever two pieces hit one another, that person decides whether they've gone into useful positions or not. If they have, he holds them together. If not, they go on shaking. Eventually, you'll find gears meshing and find some interesting mechanical mini-contraptions in your bag. All you put in was raw material and random shaking, but a simple filter ("if the pieces fit together, keep them") ends up producing interesting results.
Likewise, if some DNA randomly gets copied (and this happens very regularly), the environment will filter the results. Many times, it does so by killing the mutant. More often, nothing noti
Evolution, in the sense of molecules to man, requires an input of information. When you make an amoeba, that thing has a lot of information stored in it. When you give that amoeba the ability to consume food, that's more information. When you give it the ability to reproduce by dividing, there is a lot more information that has to be input. DNA and RNA are really little more than information on how the cell, and the organism overall, is supposed to act.
So far so good.
Information theory basically says that the information of a system can not increase without an outside influence, and the second law of thermodynamics says that as time goes on, order tends towards disorder. Evolution, however, requires the opposite on both counts. That is what I mean when I say that macroevolution flies in the face of those two theories
Let's pretend I know something about information theory. Can you show your work on this? I think you're missing a very important variable: energy. Before coming back to this, you may want to reread the second law of thermodynamics. You've presented a very touchy-feely version of it, but not a complete or entirely accurate one. It's great for giving people a basic understanding of how thermodynamics works, but it falls flat on its face for what you're trying to do.
The reason that the seed acts like it does is that the information for that tree is already in the seed. The seed effectively runs on a program that says "Do this, then do this, then do this." That's information. The cells are programmed to divide like that.
Let's try another exercise: We start with a bowl of salt water sitting in the sun. A week later later, the water has evaporated and the salt has formed lovely crystals in the bottom of the pot. Those salt crystals are highly ordered. What happened, thermodynamically speaking?
The point here is that given a flow of energy it's possible to separate systems into high and low entropy parts. That's how life does its thing. That's how living things keep from dissolving into disorderly piles of goo. It's also what allows DNA to accumulate information and complexity. Any system that takes energy as an input and is capable of reproducing itself with modification can very easily accumulate new information. For example, which strand of pseudo-DNA contains more information:
1) ACTGTGTATCGGGC
2) ACTGTGTATCGGGCCGGGCA
Clearly, version 2 does. There are known mechanisms for this type of change to happen in DNA, so clearly that sort of change doesn't violate the laws of thermodynamics. So, what gives?
Fundamentally what gives is, evolution violates the popular science version of the second law of thermodynamics, and it violates the hand waving versions of "information theory" people put up on web sites, but it doesn't cause any trouble for actual thermodynamics or actual information theory. If you think otherwise, I strongly suggest running the numbers. Any argument that uses thermodynamics and or information theory should be expressible mathematically. The problem is, creationist web tracts tend not to want to define their terms, because if they did, it would be obvious that they were equivocating by using words like "information" fast and loose and not according to the rules of the formal systems they're invoking.
Actually, I think it isn't a big if. There are inherently two choices: 1. We got here through some method that doesn't involve outside influence. 2. Some intelligent entity made us. There really aren't any other choices. Therefore, the 'if' isn't very big. It's going to be one or the other.
So essentially you're suggesting the "evolution or magic" dilemma. I'm suggesting that even if evolutionary theory as it stands is wrong, there may be any number of other naturalistic explanations that still explain our observations and don't involve intelligent action. Cer
Slashdot Mirror
Thank you, and may Bob bless you. Vernon is a false prophet!!
That doesn't sound that reasonable to me at all. They should be able to provide a list of addresses or phone numbers to the broadband provider and have that provider say yay or nay. That's how you do it on the broadband providers' web sites as it is. All the regulatory agency has to do is give a more granular list for the provider to check against in their database, and then randomly sample the results to ensure that the provider didn't make a mistake or lie to them. That sounds pretty reasonable to me.
It's not as if he was just trying to broach an important and relevant topic that was being unreasonably ignored. He was trying to score some laughs by mimicking some sort of "ghetto talk" as kind of a lame satire. It fell flat and for once, his "I'm a maverick, get over it!" attitude and reputation failed to save his ass. Too bad, so sad.
Imus is a tough, bad-ass, anti-establishment kind of guy, right? Then he can learn to live with the consequences of it just as he reaped the rewards of it for years and years.
If we're concerned enough about a single digit per year death rate due to ambulance accidents that we're willing to consider reform, we shouldn't be driving at all.
The funny thing about all this is that for how divisive an issue it is, most Americans agree on most points. There are few if any mythical crazy liberals who want American soldiers to die, and there are probably just as few supporters of the war who just want our troops to roll in, kill everybody, and take the oil. It's unfortunate that so many people don't realize that the vast majority of us just want this thing to end with the best possible outcome for everybody.
That's certainly a fair point. It would be great if we could simply ignore terrorists entirely, but that kind of a black out on bad news also makes it impossible to measure the success or failure of an operation. My problem is that our leaders have never been able to act appropriately in that sort of environment. If they can tell us whatever they want, they'll tell us that they're doing a great job and that we shouldn't worry.
If I could think of a reasonable and practical way to do that, I would certainly agree. The problem is, how long do you sit in the dark while politicians lie to you about how great everything is before asking where the beef is? I'm as disgusted as anybody at a Congress that essentially approved the operation and let it go to hell with no oversight and now that things are going badly, they're more concerned at earning political capital than fixing the issue. My problem is that the only meaningful system of oversight I can see is an adversarial political system combined with news outlets that aren't afraid to carry bad news.
Oh, I definitely won't say that nothing good could have come of it. Getting rid of Saddam Hussein and ensuring that no weapons of mass destruction were there are both good things, but at what cost? My problems with the operation were that they were extremely high risk with minimal payoff, and the motives for doing it were more the implementation of academic neo-conservative fantasy than an actual desire to fix anything. If our leaders had poured resources into it the way they should have rather than promising a cheap, easy victory with tax cuts to boot, they may have been able to keep law and order long enough to make the whole thing work. It may have even resulted in serious democratic reform there (although I doubt the long-term stability of any government would be seen as the puppet of a hated foreign power).
The unfortunate fact now is that we've missed that opportunity, so we either need to buckle down and pour resources into fixing this problem like we've never done before (and even then, I believe that we're more likely to fail than to succeed), or we have to walk away and let everything go to hell and honestly admit to ourselves and the world, "Yes, we just screwed all of those people. We've learned our les
The problem here is that politicians don't listen to rational discourse behind closed doors. The listen to voters roaring for them to take action or leave office. If I thought that the best way to make things work out for the best is to write a letter or have our leaders have a negotiating session in private, I'd be all for it. The reality as far as I can see is that our leaders see their own political careers as the most important casualty of any war. Until the public makes enough noise, nothing gets better, and the public doesn't make noise unless people point out what's going wrong in an embarrassing and public way.
The public (or, at least the members of the public who weren't losing family members) would still think that this clusterfuck was the best thing since sliced bread if it weren't for the New York Times and their ilk pointing out what a dismal failure it has been. Millions would be cheering every time our leaders say, "We just need to borrow a few more billion dollars from your grandchildren while we send a few thousand more of your children into harm's way. We're winning and doing great things!" An informed populace is the only defense against the government doing terrible things and claiming the best. It should be clear from how hard the Bush administration is trying to put lipstick on this pig that if nobody was there to call them on it, they'd be telling the public how well everything was going. Nobody would know the truth.
I think it's possible that reasonable people may disagree. The whole point of a sunk cost is that you ignore it when deciding whether to go forward or not. If you agree to pay a million dollars for a pair of shoes and after the first $100,000 of payments, you realize that $900,000 is too much to pay for the pair of shoes, you walk away. You don't say, "Well, I've already spent $100,000, so I have to buy the shoes now." There are reasonable arguments to be made that we're not minimizing the protracted loss of life but rather just delaying an inevitable descent into civil war. I'm not entirely convinced of that case, but I'm also definitely not convinced that walking away isn't a rational option. I'm certainly not convinced that the only way for things to work out is for us to grin and write yet another blank check to the bozos who started this thing in the first place.
I don't know about anybody else, but I was a critic from day one for a variety of reasons. I didn't see the reasons for war as compelling, WMD or no. I saw it as a very effective way of stealing resources from a worthwhile endeavor in Afghanistan. I believed that it was very likely that we would simply destabilize the country and turn it into a war zone for nutty factions to fight over the power vacuum. I saw it as a quick way to burn the international goodwill we had going for us in Afghanistan. Worst of all, I saw it for what it was: The ham-
Why do you think that for years after it was disproved conclusively, the majority of Americans believed that Iraq was at fault for 9-11? I would argue that it's two factors: First, the public seems to be a bunch of morons. Second, Bush and Cheney know that, and they're more than willing to carefully try to tie Iraq to 9-11 and wave the bloody shirt because they know that they can push their agenda that way. No, it's often not out and out lying. It's often simply the careful, manipulative presentation of facts to a gullible audience designed to produce results. While I generally don't use the word "lie" to describe it, it's also not exactly the best way to create an informed public. I'm torn between being more pissed off at people who are stupid enough to fall for this stuff and leaders who are smart and cynical enough to do it. I guess my most complete take on it is here.
This is the first step in the idiots who supported the war slowly shifting the blame for its calamitous results to the people who didn't. We didn't lose the war because it was a stupid idea that was poorly implemented and badly run from the beginning. We lost the war because those crazy liberals didn't clap hard enough for it. Matt Taibbi's response to Joe Klein about liberals "rooting for failure" probably sums it up the best:
No, the administration was not at all honest in how it went about starting its little war. All this "I was lied to" crap is just whining, though. They didn't lie so much as manipulate. If you get manipulated by such transparently stupid bullshit, you deserve it. You can't sidestep blame. It was obvious from the beginning what the Bush administration was trying to pull, so don't brag to me in moral indignation about the fact that you were too damned dim witted and naive to see through it and just look at the data. I read all these complaints as, "I'm too much of a moron to have looked at the data myself, so I just blindly trusted one of the most obviously cynical and transparently Machiavellian administrations in the history of the US." Too bad for you. This is just as much your fault as George Bush's.
I almost have more respect for the people who are still trying to claim that it was a good idea than I do for wimps who are trying to pass the buck by admitting that they were too damned dumb to see this coming. That goes doubly so for the Democratic members of congress who are trying to claim that they were just babes in the woods when all this started. If I could see through this by reading a newspaper, they should have been able to use the fact that they have access to documents that I'll never be able to touch in order to figure out the obvious. There's no place for, "If I knew then what I know now, I would have been against it." If you knew then what you know now, you would have been intelligent and informed rather than a moron.
I used to do a lot of kernel building and tuning. When I was in college, my machine always had the bare minimum kernel stripped down to just what I was using. It made a difference, but it was a pain. These days with the set of options available in the pre-packaged kernels, I rarely bother unless I need something weird (e.g. The 4KB kernel stack size is too small). When I go down the list of reasons to take my time to build a custom kernel, performance is just slightly ahead of "I like watching text scroll by" in order of importance.
In fact, it might be interesting to initially auction the set of visa slots off and then create a market for privately trading them afterward. New visas would issue at the market price like corporate stock. The price of a visa would more accurately reflect the discrepancy in value between the local market and the worldwide market and give labor economists interesting numbers to work with simply by watching price fluctuations in the visa market. The particulars could be pretty tricky, but the idea may work.
Not a problem. Slashdot is full of busy people, and students tend to be particularly so.
That's going to depend heavily on the organism. There's no known method by which organisms distinguish between C12, C13, and C14 when they absorb carbon from the atmosphere. I'd be very surprised if there was any reference that indicated concrete examples of this. There are, however, a few ways to get strange isotope ratios. The best known is through the shells of mollusks that get their carbon from the limestone they inhabit. Obviously, their source of carbon is not the present day atmosphere, so carbon dating is meaningless. Likewise, trees that live for hundreds or thousands of years will have layers of old tissue and new tissue, and anything that eats the old tissue will inherit a funky carbon ratio, as will anything that eats those organisms. Most animals, though, eat the parts of plants that have extremely short life cycles (leaves and fruits). The carbon from those parts is sourced from the atmosphere at the time those features grew. There's little practical way that a cow that eats grass whose blades grow seasonally could get old carbon into its system. I can see an argument for a primate that eats termites that eat old wood, but that's an exception to the rule. As I said, carbon dating isn't perfect, and it requires some knowledge of what it is that you're dating, but it's not nearly as flawed as you seem to want to make it out to be.
It's worth noting that calibrated carbon dates do show very good accuracy through recorded history. If it were all as arbitrary as you say, that wouldn't be the case.
As far as I can tell, the source is correct, but as discussed above, I don't think that the claim of differential rates of C14 absorption are accurate. As far as I have been able to find, bad ratios of carbon have to do with the source of absorption and the age of the organism, not on some method that allows them to "reject" certain isotopes of carbon.
This is a very important distinction. Radioactive decay of the type we're discussing has absolutely nothing to do with the type of decay you just brought up. It's a complete red herring. Higher temperatures make the water from swimming pools evaporate faster as well, but that has nothing at all to do with the well understood process of atomic decay.
The point here is that while selection could be called deterministic, the input to it is random. Even if deterministic systems can't create new information (and I suppose I'll tend to agree barring somebody pointing out where I'm wrong), the random mutations that drive much of natural selection are decidedly not deterministic. I suppose that one could say, philosophically, that the entire universe is predetermined and pre-loaded with all the information we need, but I'm excluding that point for the moment. I know that if I say that too loudly, MarxistHacker42 will show up. Natural selection is essentially a filter for a huge amount of information being pumped in into it in the form of mutated and crossed over genetic material.
That's a much better definition. The part you're missing is the phrase isolated system. Life is not, by any stretch, an isolated system. It constantly takes in energy and keeps its localized entropy low. Once you start doing that, all bets are off and the whole thermodynamics argument goes out the window. Self-replicating systems are essentially machines whose job it is to take in energy and high-entropy inputs and create low-entropy output. It is also worth remembering that the second law is probabilistic in nature. It's possible to violate the second law on very small scales (cold regions of molecules allowing a net flow of heat to warmer regions of molecules), although extremely unlikely for macroscopic violations to happen. In short, tiny violations of the second law can and do occur on the molecular level.
These are all fine aphorisms, but they really don't address the topic at hand. Natural selection is the focusing mechanism. When one mutates DNA (or produces novel sequences through sexual reproduction), one is throwing your proverbial clock parts into a bag. The difference here is that natural selection filters those results and can actually end up with a clock. Let's modify the experiment for the moment: Imagine you shake that bag around and there's a little person inside. Whenever two pieces hit one another, that person decides whether they've gone into useful positions or not. If they have, he holds them together. If not, they go on shaking. Eventually, you'll find gears meshing and find some interesting mechanical mini-contraptions in your bag. All you put in was raw material and random shaking, but a simple filter ("if the pieces fit together, keep them") ends up producing interesting results.
Likewise, if some DNA randomly gets copied (and this happens very regularly), the environment will filter the results. Many times, it does so by killing the mutant. More often, nothing noti
So far so good.
Let's pretend I know something about information theory. Can you show your work on this? I think you're missing a very important variable: energy. Before coming back to this, you may want to reread the second law of thermodynamics. You've presented a very touchy-feely version of it, but not a complete or entirely accurate one. It's great for giving people a basic understanding of how thermodynamics works, but it falls flat on its face for what you're trying to do.
Let's try another exercise: We start with a bowl of salt water sitting in the sun. A week later later, the water has evaporated and the salt has formed lovely crystals in the bottom of the pot. Those salt crystals are highly ordered. What happened, thermodynamically speaking?
The point here is that given a flow of energy it's possible to separate systems into high and low entropy parts. That's how life does its thing. That's how living things keep from dissolving into disorderly piles of goo. It's also what allows DNA to accumulate information and complexity. Any system that takes energy as an input and is capable of reproducing itself with modification can very easily accumulate new information. For example, which strand of pseudo-DNA contains more information:
1) ACTGTGTATCGGGC
2) ACTGTGTATCGGGCCGGGCA
Clearly, version 2 does. There are known mechanisms for this type of change to happen in DNA, so clearly that sort of change doesn't violate the laws of thermodynamics. So, what gives?
Fundamentally what gives is, evolution violates the popular science version of the second law of thermodynamics, and it violates the hand waving versions of "information theory" people put up on web sites, but it doesn't cause any trouble for actual thermodynamics or actual information theory. If you think otherwise, I strongly suggest running the numbers. Any argument that uses thermodynamics and or information theory should be expressible mathematically. The problem is, creationist web tracts tend not to want to define their terms, because if they did, it would be obvious that they were equivocating by using words like "information" fast and loose and not according to the rules of the formal systems they're invoking.
So essentially you're suggesting the "evolution or magic" dilemma. I'm suggesting that even if evolutionary theory as it stands is wrong, there may be any number of other naturalistic explanations that still explain our observations and don't involve intelligent action. Cer