Slashdot Mirror


48% of Americans Reject Evolution

MSNBC has up an article discussing the results of a Newsweek poll on faith and religion among members of the US populace. Given the straightforward question, 'Is evolution well-supported by evidence and widely accepted within the scientific community?', some 48% of Americans said 'No'. Furthermore, 34% of college graduates said they accept the Biblical story of creation as fact. An alarmingly high number of individuals responded that they believe the earth is only 10,000 years old, and that a deity created our species in its present form at the start of that period.

1,856 comments

  1. In unrelated news... by Kelson · · Score: 5, Insightful

    America continues to worry about losing its edge in the high-tech industry.

    But that couldn't possibly be related to poor science education, could it?

    Note: I'm referring specifically to the 48% who believe that evolution is not well-supported by scientific evidence and that it is not widely accepted within the scientific community. Well, and the people who think the universe is less than 10,000 years old, despite all the evidence to the contrary. You can believe in God and have an understanding of science, just like you can have morals without being religious. But thinking that evolution isn't supported by evidence, or isn't widely accepted by scientists, is just plain ignorance.

    1. Re:In unrelated news... by 808140 · · Score: 4, Insightful

      Frankly, even the rabidly fundamentalist anti-evolution junkies are aware that evolution is widely accepted in the scientific community. This doesn't stop them from trying their best to discredit the theory and convert people over to their way of thinking, but they'd have to be utterly daft to not realize that most scientists do not in fact agree with their point of view.

      I agree; this has to be ignorance, not religious zealotry. It's one thing to say "Evolution is bunk, and there's a pervasive anti-religious conspiracy in academia promoting it" and quite another to say "No scientists really believe in evolution." As far as I know, none of the fundies are actually saying the latter and expecting to be believed. The former, however, is one of their standard talking points.

    2. Re:In unrelated news... by Eggplant62 · · Score: 1, Troll

      That 48% is composed mostly of people who have a firm Christian background, I'm certain.

      I only have three more things to say:

      All Hail the Flying Spaghetti Monster!

      Praise "Bob"!

      Hail Eris!

    3. Re:In unrelated news... by Anonymous Coward · · Score: 1, Funny

      What evedence do they have?

    4. Re:In unrelated news... by El+Cubano · · Score: 1, Insightful

      But that couldn't possibly be related to poor science education, could it?

      Beacuase you can't possibly have faith (or religion, your choice) and be well educated in sciences, could you?

      I'm willing to bet that the reason the US is losing its technological edge has little (if anything to do with religion). Look at how the teacher's unions are simply stifling any sort of competition in the education "market". They try vehemently to have vouchers outlawed. They prevent school districts or states from "grading" schools based on the performance of their students (which might give parents clues were to live/not live.

    5. Re:In unrelated news... by slughead · · Score: 0

      America continues to worry about losing its edge in the high-tech industry.

      Meh. The top 5% of minds in the country ALWAYS accounted for 99% of innovation.

      I'm not alarmed by these figures. If we actually had a graph indicating that we're growing "dumber", that would be something. The last graph of that sort showed a flat but mildly positive slope in test scores over the last century. So, according to that, at least, we're getting 'smarter.' Try to keep an open mind when it comes to alarmist headlines :)

      I doubt we'll lose our "edge" in technology. The industry will just grow, and it'll grow in other geographic locations faster than ours, simply because ours is too large to continue growing at their rate. As long as we still grow, we'll be fine. There's enough wealth in the world to go around, and we create more every day.

    6. Re:In unrelated news... by Gerzel · · Score: 5, Insightful

      Most of them just use the tactic of saying things longer and louder than everyone else in the room and eventually people will believe you.

      In America this has worked.

    7. Re:In unrelated news... by Phillup · · Score: 4, Funny

      Beacuase you can't possibly have faith (or religion, your choice) and be well educated in sciences, could you?

      Yes you can. But only 52 percent of the time...

      --

      --Phillip

      Can you say BIRTH TAX
    8. Re:In unrelated news... by catbutt · · Score: 3, Interesting

      Actually, I've run into a lot of people who have problems with evolution even though they aren't Christian or religious.

      Evolution is, to many, extremely unintuitive, aside from religion. I've noticed that people have a really hard time with lots of other concepts similar to evolution (market economics and such).

    9. Re:In unrelated news... by blahplusplus · · Score: 0

      "But that couldn't possibly be related to poor science education, could it?"

      Could it possibly be that that American children have enormous populations with a strong christian heritage? Note that before modern science *everyone* was to some extent religious, in fact religion was the dominant explanation for why things were the way they were before darwin. Evolution seemed like a non-explanation before the tools were available to extrapolate the earth's great age which did a lot to upend most religions. It was the age of the universe and the earth that upended religion, not biological evolution.

      Trauma theory explains religion as well: Slavery and exploitation has been a part of human history for a long time, Marx saw religion as a feature of capitalism, and to some extent it is a feature of the stress put on people in the economic system. But the reason why people believe is because the death instinct is so strong, the whole reason religion was invented was to counteract teh painfully depressing realization that: You are going to die. You can dress it up with feelings of being jewed before humanity invented life extension technology or what have you, but that sum's up a big reason why people believe. If "sacred text" X's god offered you a pat on the back and a bag of chips would anyone follow that god?

      No matter how you slice it some people will never believe in something the can't see or witness for themselves (ironically) that goes against their genetically determined instincts. I wouldn't be surprised if it was found out genetically that they have strong psychological predisposition towards god belief and it just takes the form of Christianity since that is the geographic religion.

    10. Re:In unrelated news... by aquabat · · Score: 1

      Can you please provide some references for that graph? I'm interested particularly in how questions from different tests are compared to determine how they are weighted for difficulty.

      --
      A republic cannot succeed till it contains a certain body of men imbued with the principles of justice and honour.
    11. Re:In unrelated news... by iminplaya · · Score: 1

      It also explains the class of people who get elected to high office. Nothing but a bunch of snake-oil salesmen.

      --
      What?
    12. Re:In unrelated news... by slughead · · Score: 1

      Can you please provide some references for that graph? [shows flat but slight increase in test scores]

      I looked for more information for a couple minutes and have given up.

      I saw it in this 20/20 special.

    13. Re:In unrelated news... by rhakka · · Score: 1

      if we were dumbing down as a culture, wouldn't tests get easier too?

    14. Re:In unrelated news... by aquabat · · Score: 1

      Thanks.

      --
      A republic cannot succeed till it contains a certain body of men imbued with the principles of justice and honour.
    15. Re:In unrelated news... by A+beautiful+mind · · Score: 5, Interesting

      Evolution is not intuitive. Richard Dawkins was showing a possible explanation why in his book, The God Delusion.

      Basically according to the research he quotes, there are stances the brain takes of thinking. Like the "physical" stance, how an object will react to gravity, etc. But that is slow and not really useful in judging complex machines (like animals for example). So there is a "design" stance, where you judge the function of an object and determine it's expected behaviour. That is sometimes too slow, so there is the "intention" stance, which assigns intentions to things. That tiger over there is going to attack me not because it has sharp claws capable of killing, but because he intends to kill me so I better run. Get the point. Anyway, according to research, infants and young children are especially prone to think in an intent stance. Thus it is conceivable that the thinking that something must have a reason or intent, is something to be discarded through a conscious effort.

      --
      It takes a man to suffer ignorance and smile
      Be yourself no matter what they say
    16. Re:In unrelated news... by huge+colin · · Score: 0, Flamebait

      Beacuase you can't possibly have faith (or religion, your choice) and be well educated in sciences, could you?
      Correct. Religion is inherently non-scientific, and cannot therefore co-exist in the mind of a scientific person.
    17. Re:In unrelated news... by WatchTheTramCarPleas · · Score: 1, Insightful

      Its very likely many of those who took the survey and answered in what seems the ignorant maner didn't read or completely comprehend the question as anything beyond "do you believe in evolution or not." I know several intelegent Christian people (this hopefully includes myself) who would have done the same especially if this were an online survey or some other quick format. How many slashdot readers don't go on to read the actual article?

    18. Re:In unrelated news... by ThomasFlip · · Score: 1, Troll

      *cough* Bill O'Reilly *cough*

      --
      If the dollar is an "I owe you nothing", then the Euro is a "Who owes you nothing." - Doug Casey
    19. Re:In unrelated news... by Clock+Nova · · Score: 5, Insightful

      I don't understand this line of thinking. Evolution is extraordinarily intuitive. In fact, it makes perfect sense. Two animals are born. One is unable to adapt to its environment, and dies. The other one is able to adapt to survive in its environment and lives long enough to reproduce, thus passing on its genetic material to the next generation. Repeat. Profit. What's not to understand?

      This is, of course, a bit oversimplified, but I find nothing about evolution difficult to understand.

      --
      There they were, sitting in the van with all those dials, and the cat was dead. -V. Marchetti, CIA
    20. Re:In unrelated news... by VJ42 · · Score: 4, Interesting

      Actually, I've run into a lot of people who have problems with evolution even though they aren't Christian or religious. Conversely, at least here in the UK, I know of many religious Christians, including IIRC the Archbishop of Canterbury, and I believe the Pope (obviously he's not in the UK); who accept the theory of evolution with no problems.

      Personally I'm a lax hindu*, and evolution fits right in with my world view, and that of others I know. Infact AFAIK I don't know a single creationist.


      *by which I mean I'm religious on Tuesdays and during holy festivals and other holy days.
      --
      If I have nothing to hide, you have no reason to search me
    21. Re:In unrelated news... by c_forq · · Score: 1

      At least in the city I grew up in the 2 local religious schools (one catholic and the other baptist) consistently lead the public school in math and science, and by a very wide margin. So I think religion and education can go hand in hand.

      --
      Computers allow humans to make mistakes at the fastest speeds known, with the possible exception of tequila and handguns
    22. Re:In unrelated news... by Seumas · · Score: 1

      To be fair, that same 48% of Americans, while "rejecting" evolution probably buys into the Pat Robertson and Jerry Falwell claim that lesbians cause hurricanes and other natural disasters.

      If someone can believe in a literal translation of the bible. Or, in fact, in spirituality, ghosts, ESP and all this other stuff altogether which has little and no supporting evidence whatsoever, then I don't really care what their opinion on scientific hypothesis and theories are as they are no more qualified to dismiss evolution as a generally accepted scientific theory than they are to diagnose a medical condition or than I am to fly up and repair the space station.

      However, this statistic certainly goes a long way in illustrating the ignorance in this country that we are ruled by. You can't expect to compete in the world on any level when you are lead around by religious insanity.

      And while we're miring in the suck here, keep in mind that these 48% get to vote and their vote counts just as much as the most educated, wise, worldly person in the country. Hurrah for a system which encourages, promotes and maintains the consensus. Even when they're idiots!

    23. Re:In unrelated news... by Sockatume · · Score: 2, Informative

      IIRC the "stances" are actually the creation of Daniel Dennett, and came out of his study of the development and structure of consciousness. Not that Dawkins would've raised them without crediting Dennett, of course. Incidentially he wrote "Darwin's Dangerous Idea": like everyone studying the hard problems in biology and anthropology, evolution is central to his work.

      --
      No kidding!!! What do you say at this point?
    24. Re:In unrelated news... by bishmasterb · · Score: 2, Insightful

      You hit the nail on the head.

    25. Re:In unrelated news... by daniel23 · · Score: 2, Insightful


      There is a theory that the day the soviet union ceased to exist after decades of cold war, some folks in the US started to believe that from now on all limits had gone. Multilateral treaties? Climate change? Geneva Convention? Any science with unwanted results? All those questions get answered like:

      "We're an empire now, the rules have changed. We don't have to ask, we define what is real and what not."

      There is another theory that this in fact is the truth.

      --
      605413? Yes, it's a prime.
    26. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Note: I'm referring specifically to the 48% who believe that evolution is not well-supported by scientific evidence and that it is not widely accepted within the scientific community.

      Even though it's in the /. summary, the article doesn't actually say that. In fact the wording used is:

      Nearly half (48 percent) of the public rejects the scientific theory of evolution; one-third (34 percent) of college graduates say they accept the Biblical account of creation as fact.

      In other words, 48% of Americans say "I don't believe it", not "I don't think many scientists believe it."

      Of course, it's still quite a scary statistic.

    27. Re:In unrelated news... by stanmann · · Score: 1

      Thats natural selection, Creationists do not dispute that fit creatures(created things) survive and unfit creatures don't.

      the question evolution fails to answer and which makes it counterintuitive is "Where/How/When did it all start"

      --
      Food not Bombs is a nice platitude but it breaks down when you notice that the Bombees are usually well fed
    28. Re:In unrelated news... by Iron+Condor · · Score: 5, Informative

      Only 51% of physical scientists believe in any form of Darwinian evolution.

      This is a lie.

      You are a liar.

      --
      We're all born with nothing.
      If you die in debt, you're ahead.
    29. Re:In unrelated news... by PopeRatzo · · Score: 3, Insightful

      Evolution is, to many, extremely unintuitive,

      Quantum mechanics is pretty "unintuitive" too. Is it more "intuitive" to believe that the cosmic thunderer created the World in six days and that the first woman was fashioned from Adam's spare rib?

      It's fascinating that there's a one-to-one relationship between those who don't believe in evolution and those that don't believe in global warming.
      --
      You are welcome on my lawn.
    30. Re:In unrelated news... by Seumas · · Score: 1

      I know an enormous amount of people who openly admit that they are terrible at math and have a hard time comprehending things like math, chemistry, biology and physics. Their own failings (or even reasonably understandable lack of knowledge in areas) doesn't make those fields of science or the generally accepted theories (not hypothesis -- THEORIES) any less real.

      And for the religious types... Well, they don't have a foot to stand on. You can't talk about believing in some magical space guy that will send you to a burning hell if you wear multiple textiles simultaneously and don't honor your mom and dad while saying that evolution is completely ridiculous and unfounded on the other hand. That's like saying you believe in mental telepathy but not gravity.

    31. Re:In unrelated news... by vimh42 · · Score: 2, Interesting

      The real question I have is what percent of Americans even know what the theory of evolutions is? I'd wager the percentage is quite small.

    32. Re:In unrelated news... by coopex · · Score: 5, Informative

      Uh, too bad evolution is about how life is changing, and completely unrelated to how life started, but keep on with your small minded worldview and ignorance, you're sure to make the history books (as a laughingstock).

      --
      The road to hell is paved with good intentions.
    33. Re:In unrelated news... by stanmann · · Score: 1
      I would tend to agree with you. and go a step further. Christians, scientists and otherwise fall back to the mandate from Genesis

      Gen 1:28 And God blessed them, and God said unto them, Be fruitful, and multiply, and replenish the earth, and subdue it: and have dominion over the fish of the sea, and over the fowl of the air, and over every living thing that moveth upon the earth.
      and many of us would apply the "dominion mandate" to all creation, not just the sphere of the earth.
      --
      Food not Bombs is a nice platitude but it breaks down when you notice that the Bombees are usually well fed
    34. Re:In unrelated news... by PopeRatzo · · Score: 2, Insightful

      I'm ready to accept evolution just as soon as the science is more credible than faith and the Bible.

      That's why you work at Wal-Mart and collect disability instead of performing thoracic surgery. I pray that you're not home-schooling your kids. We've got enough of your kind bringing down the national average already.
      --
      You are welcome on my lawn.
    35. Re:In unrelated news... by coopex · · Score: 1

      I don't know about natural disasters, but I learned from FOX that lesbians are the primary cause for 747s to blow up over the Mojave desert...

      --
      The road to hell is paved with good intentions.
    36. Re:In unrelated news... by SpinyNorman · · Score: 2, Interesting

      Evolution is, to many, extremely unintuitive

      Maybe, but this denial of evolution is a US-only phenomena. Could be related to poor US high school education I suppose (since that's the only time most people are going to be taught about it).

    37. Re:In unrelated news... by shraps78 · · Score: 1

      I'm kind of at a loss as to how a belief in evolution really effects the entire high-tech industry? Sure, biology and some other fields. However, I would not say that my belief in Creation really hampers my ability to study computer science. Nor does it really effect my ability to learn about physics (at least the vast majority of the field), chemistry, or a number of other topics. Granted, I would probably not have answered that there is no evidence for evolution, but this was a loaded poll. They were basically asking people to either accept or oppose evolution, while also asking whether there was any scientific evidence supporting it. I realize that there is some evidence supporting evolution. You can call me irrational, or whatever, but it doesn't change my view or what I have experienced God doing in my own life. These are my personal beliefs. However, I really do not see how they effect my ability to contribute to the "high-tech industry" through computer science.

    38. Re:In unrelated news... by Nyeerrmm · · Score: 4, Insightful

      As another example I've just recently been learning about optimization algorithms (I'm using a Particle Swarm Optimization routine to determine a randomly optimized satellite constellation for imaging,) and even though I wrote the code myself and know exactly what it's doing, I still want to anthropomorphize it and believe its doing it intelligently instead of just randomly selecting points and discarding those that don't give good results.

      Basically, it's very easy to attribute intelligence to a natural process, simple algorithm, etc., even if you know exactly what's going on.

    39. Re:In unrelated news... by VJ42 · · Score: 1, Informative

      Anyone not a complete idiot would be atheist. "God does not play dice" - Albert Einstein
      --
      If I have nothing to hide, you have no reason to search me
    40. Re:In unrelated news... by Anonymous Coward · · Score: 0

      My crystal ball says "You will be modded down".

    41. Re:In unrelated news... by PopeRatzo · · Score: 1

      Beacuase you can't possibly have faith (or religion, your choice) and be well educated in sciences, could you?

      It's possible, just not very likely.

      Before you start worrying about science, I suggest you work on the spelling. I'm pretty sure you can be religious and still be able to read and write English. Despite the evidence.
      --
      You are welcome on my lawn.
    42. Re:In unrelated news... by benjaminperdomo · · Score: 3, Funny

      This is slashdot. NO ONE reads the full article. At best, they skim the summary. :P

    43. Re:In unrelated news... by cyphercell · · Score: 3, Insightful

      Personally, I often just stop talking to people like that, doesn't mean I believe them. Of course the average person seems to think that the last person talking wins.

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    44. Re:In unrelated news... by catbutt · · Score: 1

      Idon't think that is the question that make evolution unintuitive.

      Spend some time arguing with someone who asks "if we evolved from monkeys, why are there still monkeys?" or "why haven't we ever seen an animal born with an improvement?" You'll see that, for whatever reason, people have immense problems with the sort of evolution that happened AFTER the origin of life.

      Also, while we don't have much evidence for how the origin of life happened (and we wouldn't expect to have evidence), I don't see that it is that hard to imagine how it might have happened. The first form of "life" (or "self-replicating chemical reaction" might be a better description) had one immense advantage...there wasn't competition. So it was certainly WAY simpler that anything alive today.

    45. Re:In unrelated news... by Fordiman · · Score: 2, Informative

      Correction: GPP is a manipulative liar. Which is why he shouldn't get too many responses. The only appropriate response to such behavior is blankly-staring disbelief.

      --
      110100 1101000 1101000 1100110 0 1101111 1101000 1100011 1
    46. Re:In unrelated news... by VJ42 · · Score: 0

      Religion is inherently non-scientific, and cannot therefore co-exist in the mind of a scientific person. As I said to an AC:
      "God does not play dice" - Albert Einstein (obviously not a "scientific person")
      Note: I'm not trying to rebuff evolution (a concept I believe in), just the notion that science and religion cannot coexist.
      --
      If I have nothing to hide, you have no reason to search me
    47. Re:In unrelated news... by A+beautiful+mind · · Score: 1

      You're right, and Dawkins does credit him in his book, although I have to admit that Dawkins' book was the first time I've heard about these stances that is why I referred to his book as a source of explanation. I've been just lazy to check before I've written my post. :)

      --
      It takes a man to suffer ignorance and smile
      Be yourself no matter what they say
    48. Re:In unrelated news... by evolseven · · Score: 1

      I believe you are confused, evolution doesn't even attempt to answer the question of genesis. It only attempts to answer how we got from single cell life form to what we are today. How that single celled life form was "created" is not answered by evolution. The origin of life is a different question than the question of how organisms develop and evolve over time.

    49. Re:In unrelated news... by BKX · · Score: 3, Informative

      Alright troll, I'll bite.

      Only 51% of physical scientists...

      Only 98% of statistics are made up on the spot by people who are full of shit.

      ...just CREATE LIFE IN THE LAB and that will fix it.

      Been there, done that, bought the T-shirt. We've shown that every prerequisite for life can be synthesized by processes known to happen on Earth prior to life. The only thing we haven't done in the lab is wait the million years for them to get together and start fucking...yet.

      Furthermore, and this is part that we really have you nailed on, Darwinian evolution doesn't necessarily preclude God creating Earth or the first life. Instead, it just describes a mechanism by which life can adapt to changing circumstances. And we've demonstrated this in the lab thousands of times over. (Cancer rats, fruit flies, albino psylocybe cubensis mushrooms) In fact, humanity has been playing with evolution of lesser species for thousands of years. Did you ever wonder why bunny rabbits only exists in people's houses? (Hint: It's because monks bred them from wild rabbits until they became a new species, incapable of surviving in the wild. Evolution works even when we're controlling the circumstances.)

      Embryology as a whole cannot be made to fit ANY part of evolution.

      We came from apes. Apes came from monkeys. Monkeys came from lemurs. Lemurs came from rodents. Rodents came from some earlier mammal. That mammal came from reptiles. Reptiles came from amphibians. Amphibians came from fish. And so on. In fact, the biggest evidence of this IS embryology. Do some research on it some time. There's a reason human embryos have a tail, and are indistinguishable from nearly every other land dwelling embryo for quite a large amount of it's development.

    50. Re:In unrelated news... by Anonymous Coward · · Score: 1, Insightful

      That's a sad, convoluted way to amalgamate two very different things to try and pass market economics as what they aren't. Evolution is science. Market economics are religion, and much akin to astrology.

    51. Re:In unrelated news... by Anonymous Coward · · Score: 0
      The article's numbers come with the following caveat: according to the latest NEWSWEEK poll.


      Newsweek more than likely does not have an accurate sample when it comes to the American populace at large. Judging by the content on their front page they are seem to appeal to conservatives, and we all already knew they were fools. :)

    52. Re:In unrelated news... by VJ42 · · Score: 2

      At least in the city I grew up in the 2 local religious schools (one catholic and the other baptist) consistently lead the public school in math and science, and by a very wide margin. So I think religion and education can go hand in hand. Indeed; despite being of an entirely different religion, my parents sent me to a Church of England school for exactly the same reasons. Religious schools consistently top the league tables here in the UK, suggesting that it's not religion that makes people dumb, just genral, run of the mill, ignorance.
      --
      If I have nothing to hide, you have no reason to search me
    53. Re:In unrelated news... by el+cisne · · Score: 1

      ""God does not play dice" - Albert Einstein"

      Maybe not, but he/she/it plays blackjack like, well, like a god!!

    54. Re:In unrelated news... by stanmann · · Score: 1

      Fine, Natural selection doesn't answer that question either.

      --
      Food not Bombs is a nice platitude but it breaks down when you notice that the Bombees are usually well fed
    55. Re:In unrelated news... by thryllkill · · Score: 4, Informative

      Nice try, but that is a horrible mis-quote.

      Einstein said once, "It was, of course, a lie what you read about my religious convictions, a lie which is being systematically repeated. I do not believe in a personal God and I have never denied this but have expressed it clearly. If something is in me which can be called religious then it is the unbounded admiration for the structure of the world so far as our science can reveal it."

      Read all about it here.

      --

      Note to self: No more arguing with the faithful.

    56. Re:In unrelated news... by xerxesVII · · Score: 2, Insightful

      Until your faith in God and His word generates something so simple as a God-powered toaster, you are kindly invited to keep your pet out of science classrooms. Foundations of scientific thinking are not based on "God did it."

      --
      "We shall grapple with the ineffable, and see if we may not eff it after all." - Douglas Adams
    57. Re:In unrelated news... by Clock+Nova · · Score: 2, Insightful

      Um. . . yes, it does.

      --
      There they were, sitting in the van with all those dials, and the cat was dead. -V. Marchetti, CIA
    58. Re:In unrelated news... by tim620 · · Score: 1

      Its not really a matter of how easy or difficult evolution is to understand. Its more a matter of belief. I know a number of fundamentalist Christians who understand evolution, but don't believe in evolution. An example: I understand Bush's reasons for attacking Iraq, but I don't believe in his reasons for attacking Iraq. :-)

    59. Re:In unrelated news... by MichaelSmith · · Score: 1

      Frankly, even the rabidly fundamentalist anti-evolution junkies are aware that evolution is widely accepted in the scientific community. This doesn't stop them from trying their best to discredit the theory and convert people over to their way of thinking, but they'd have to be utterly daft to not realize that most scientists do not in fact agree with their point of view.

      At college we had one fantastic physics lecturer and we all tried to get into his class because the understood the subject and was a great communicator. He had one flaw which was religion. One day when talking about the second law of thermodynamics he claimed that it conflicts with evolution. Fortunately I had just been reading an Asimov book on the subject so I was well prepared to argue and my lecturer agreed that Asimov was correct.

      I know he didn't believe that stuff, but he had to say it for some reason. Its a shame really. He's a smart guy.

    60. Re:In unrelated news... by xerxesVII · · Score: 1

      I don't know about either of those, but I do know that lesbians blow my frigging mind. They are awesome!

      --
      "We shall grapple with the ineffable, and see if we may not eff it after all." - Douglas Adams
    61. Re:In unrelated news... by jgrahn · · Score: 2, Informative

      Maybe, but this denial of evolution is a US-only phenomena.

      Not really. I have several Jesus freak and/or Pentecostalist acquaintances who believe the earth is 4,000 years old (4,015 by now; I haven't met them in a while). And I'm in Sweden, which is supposed to be one of the most secularized countries on the planet.

      But yes, the US figures are staggering.

    62. Re:In unrelated news... by ScrewMaster · · Score: 1

      The Big Lie.

      --
      The higher the technology, the sharper that two-edged sword.
    63. Re:In unrelated news... by dlthomas · · Score: 1

      Largely correct, but I think you place the starting point too late. Life probably didn't start out in a cell. Evolution may well still explain how it got from a bunch of replecating molecules to single celled organisms. The one point that evolution can't explain is the creation of the first molecules that make it more likely that other molecules similar to themselves will come to be compared to alernatives. What evolution *does* do is make it a whole lot *easier* to explain. Going with chance because it's simple, it's plainly a whole lot more likely that such a molecule would come about by chance than an entire organism. Other explainations are surely easier, too.

    64. Re:In unrelated news... by SatanicPuppy · · Score: 1

      Gotta put it in bold, right, otherwise no one would take it seriously.

      First: you're completely wrong. If 1% of scientists actively reject evolution as absolutely the best answer for the origin and evolution of life on this planet, I'd be utterly stunned. .01% would still be pretty damn surprising.

      Second: You're misrepresenting the arguments made by people who support evolution. Yes, it does happen all the time, and no, it's not easy to spot, except in life forms like bacteria and fruit flies that have extremely short life cycles. It is, however easy to spot over time, and we have millions of years of fossils that support the theory of evolution.

      Third: You misrepresent science in general. Science isn't like religion. When scientists don't believe what another scientist says, they point out the flaws. If that scientist is right, then either the first scientist corrects his theory to account for those flaws, or the whole thing gets scrapped. If even 1% of scientists disbelieved evolution, there would be a competing theory that explains the facts...and there isn't one. The only people who object to evolution do so on the grounds that it doesn't agree with their narrow-minded religious beliefs, and that is hardly a problem with evolution.

      --
      ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
    65. Re:In unrelated news... by sbentmar · · Score: 0

      It was, of course, a lie what you read about my religious convictions, a lie which is being systematically repeated. I do not believe in a personal God and I have never denied this but have expressed it clearly. If something is in me which can be called religious then it is the unbounded admiration for the structure of the world so far as our science can reveal it.

      - Albert Einstein

    66. Re:In unrelated news... by badenglishihave · · Score: 1

      It's not. I believe in creation and frankly it doesn't matter how old the earth appears to be. There is no evidence for faith; that's why it's called faith.

    67. Re:In unrelated news... by baboo_jackal · · Score: 0, Troll

      *cough* Global Warming *cough*

    68. Re:In unrelated news... by casper75 · · Score: 5, Insightful

      In America this has worked. should read "This has worked."
      No single group of humans has a monopoly on ignorance.
    69. Re:In unrelated news... by cyphercell · · Score: 1
      you misspelled "intelegent"

      You're stance that religion and science are mutually exclusive will never help in the scientific community.

      I believe in God, and I believe in science, I believe that my moral beliefs put me in good religious standing while my belief in science puts me in good standing with the advancement of man.

      "The Bible itself speaks to us of the origin of the universe and its make-up, not in order to provide us with a scientific treatise, but in order to state the correct relationships of man with God and with the universe. Sacred Scripture wishes simply to declare that the world was created by God, and in order to teach this truth it expresses itself in the terms of the cosmology in use at the time of the writer" - John Paul II
      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    70. Re:In unrelated news... by Panzergheist · · Score: 2, Insightful

      Most people glaze over when it gets to the point of genetics adapting enough to change the subject into a completely different species. Discounting time and scale, microevolution is quite easy to understand, but macroevolution is a whole other bucket of trouble. I also think this is where a lot of contention from religious folk comes from. There is a common belief among the religious that all evolutionary studies refer to and entail only macroevolution.

      Just my two-cents that hopefully bought you a different point of view. ;)

    71. Re:In unrelated news... by rossifer · · Score: 1

      Actually, I've run into a lot of people who have problems with evolution even though they aren't Christian or religious.
      I find this statement hysterical. 150 years ago, when Darwin was making waves, evolution wasn't in doubt. Nobody disputed the evidence for evolution: you can go look at the bodies of different but similar species from the past and the farther you go back, the more different they get. So things must have changed, i.e. evolution. What Darwin got everyone all excited about is the theory that natural selection (without the hand of God) was enough for evolution to work and to produce the modern richness of species visible on the planet.

      In the 150 years since then, this debate has not advanced. It's regressed. These days in the US (and pretty much only in the US), 48% of the population not only doubts natural selection, but evolution itself. As in, you're choosing to doubt facts and conclusions that Darwin's critics had long accepted and put to rest while people were still using horses and carriages for transport and oil lamps for lighting.

      Evolution is, to many, extremely unintuitive
      Your statement, sir, is absolute nonsense. Only neo-Christian fundamentalists doubt evolution or that the earth is about 4 billion years old (give or take 500 million years). Well, them and some pacific islanders who have never seen someone with shite skin. Everyone else is lying (they're really neo-Christians but claiming otherwise).

      Regards,
      Ross
    72. Re:In unrelated news... by Seumas · · Score: 2, Insightful

      I think an important point to note is that a lot of people are more concerned with accepting and dismissing facts and evidence and theories based on whether these things fit their world view when they should instead be shifting their world view to fit in with facts and evidence. My world view may involve a flat earth, but when it's proven to be round, I should probably alter my worldview.

    73. Re:In unrelated news... by SpinyNorman · · Score: 2, Informative

      I believe you are confused, evolution doesn't even attempt to answer the question of genesis. It only attempts to answer how we got from single cell life form to what we are today. How that single celled life form was "created" is not answered by evolution. The origin of life is a different question than the question of how organisms develop and evolve over time.

      The origin of the earliest forms of "life" (simple single "cells", pre-DNA, pre_RNA) is surely one of the easiet things to answer - this is nothing more than self-sustaining chemical reactions occuring in a lipid bubble (maybe naturally occuring - oily froth by the sea shore, or maybe the fatty polymers being a product of the chemical reactions that occured inside them). I think what confuses non-scientists is how chemistry became life, since they don't realize it's just a matter of definition... at the point where your chemistry has become capable of feeding (consuming more chemicals from the enviroment), reproduction (large bubble of chemical soup splits into to), etc, then we assign the label of "life" to it... The real early "breakthru" was the formation of complex chemicals such as RNA or even simpler precursors (catalysts to begin with) that caused these early chemical soups to start to become self-defining.

    74. Re:In unrelated news... by clawoo · · Score: 1

      No, wait, you must be joking. I presume you are joking, it's April's fools in Europe already. Where exactly did you get the 51% number? Of the "physical scientists"? How about metaphysical ones? How about self imagined ones?

      When asked for proof scientists will say those things? What scientists? That is just plain aberrant beyond any drug induced reason.
      Evolution is supported by fossils, by the genetic drift, by gene flow, by artificial hybridization and one of the most important, by speciation.

      How the hell can anyone get from evolution to creating life in the lab?

      --
      This is not your signature.
    75. Re:In unrelated news... by Anonymous Coward · · Score: 0
      > And while we're miring in the suck here, keep in mind that these 48% get to vote and their vote counts just as much as the most educated, wise, worldly person in the country. Hurrah for a system which encourages, promotes and maintains the consensus. Even when they're idiots!

      Worse that that, they outbreed the enclued, too. Welcome to Idiocracy!

      (There's a reason Atlas Shrugged ended the way it did, and that it didn't end like Idiocracy. Rand never anticipated that even the starving survivors of the collapse of society would ultimately outbreed the few surviving scientists and engineers. As Heinlein might have said, evolution, like the moon, is a harsh mistress, and there ain't no such thing as a free lunch.)

    76. Re:In unrelated news... by speaktruth · · Score: 1

      It sounds to e like we are all confused. The makers of the survey made a very poorly worded one if I understand the article right. I agree with you that the scientific community does accep evolutionary hypotheses as fact, and to pose a question about this in a survey is pointless. However, you have done the same thing as teh poor survey makers by conflating two different issues. You are right that you can have an understanding of science adn God, but to say that anyone who believes the earth is lessa than 10,000 years old is ignorance is also right only in as much as you assume that the earth must be less than that old to have been created. The whole creationism and evolution denate is so flawed tha neither side really has the ability to see the truth of what the other stands for. Once this is overcome then we will be ablet o both have an understanding of God and science.

    77. Re:In unrelated news... by dlthomas · · Score: 1

      Honestly, I've encountered someone who denied heredity. That was a bit extreme (and baffling)... More generally, I would say that evolution is difficult to understand simply because so many people walk away with so many wrong impressions, and so many who think they understand it don't. That said, it's certainly easier to understand than quantum theory - indeed, I think it's reasonably within the grasp of virtually everyone *if* they make the effort. If they already think they understand what it's saying, they usually won't.

    78. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Beacuase you can't possibly have faith (or religion, your choice) and be well educated in sciences, could you?

      Course you can - doublethink is a wonderful thing.
    79. Re:In unrelated news... by tim620 · · Score: 4, Informative

      Actually, if you had been watching the news about evangelicals (besides the whole Ted Haggard thing) you would know that more and more evangelicals are also becoming environmentalists. Many believe that global warming is happening and they are standing side by side with the Sierra Club (and others) to help fix environmental problems. Many are conservative evangelicals that also believe in creationism, etc.

    80. Re:In unrelated news... by SamSim · · Score: 1

      Evolution is, to many, extremely unintuitive,
      Quantum mechanics is pretty "unintuitive" too.

      This is the key problem. People think that because they don't understand something, that means it's wrong. If your computer starts behaving really strangely, it's not because you introduced a seriously complex problem to the operating system when you deleted those critical files, it's not because you didn't select the correct set of options on your mail merge, it's because the computer is stupid. Schroedinger's Equation? "Oh, I never got math when I was in school!" Newsflash: Schroedinger's Equation doesn't care.

      Science is really, really complicated. It is, in many instances, exceedingly counter-intuitive. Nothing anybody can do will ever change that. But just because it's amazingly hard to understand without a lot of training - or, for many people, simply impossible to understand at all - doesn't mean it's wrong. Sooner or later there comes a point where the vast majority of people - even we learned Slashdotters - have to take what the smart guys are saying on faith.

      And here, I suspect, is the real issue: a lot of people in America (and other countries) only have room for one kind of faith.

      But it doesn't matter. We'll see whose science works, the one which directly contradicts reality or the one which models it as closely as possible. We'll see who cures the most diseases. It's just a matter of time.

    81. Re:In unrelated news... by Seumas · · Score: 1

      Pat Robertson and Jerry Falwell blame lesbians, gays, abortionists and the ACLU for WTC attacks. He has also over the years blamed things like Katrina on them.

      Following the September 11, 2001 terrorist attacks on the United States, Robertson appeared together with Jerry Falwell on the "700 Club" and declared that the American Civil Liberties Union along with feminists, gays and abortions were responsible for the attacks because their lack of religion had caused God's wrath:

              FALWELL: What we saw on Tuesday, as terrible as it is, could be miniscule if, in fact--if, in fact--God continues to lift the curtain and allow the enemies of America to give us probably what we deserve.

              ROBERTSON: Jerry, that's my feeling. I think we've just seen the antechamber to terror. We haven't even begun to see what they can do to the major population.

              FALWELL: The ACLU's got to take a lot of blame for this.

              ROBERTSON: Well, yes.

              FALWELL: And, I know that I'll hear from them for this. But, throwing God out successfully with the help of the federal court system, throwing God out of the public square, out of the schools. The abortionists have got to bear some burden for this because God will not be mocked. And when we destroy 40 million little innocent babies, we make God mad. I really believe that the pagans, and the abortionists, and the feminists, and the gays and the lesbians who are actively trying to make that an alternative lifestyle, the ACLU, People For the American Way--all of them who have tried to secularize America--I point the finger in their face and say "you helped this happen."

              ROBERTSON: Well, I totally concur, and the problem is we have adopted that agenda at the highest levels of our government. And so we're responsible as a free society for what the top people do. And, the top people, of course, is the court system. [4]

    82. Re:In unrelated news... by cephal0p0d · · Score: 2, Insightful

      "What I believe in cannot be proved correct scientifically, therefore it cannot be proven wrong scientifically." No, see, it doesnt work that way. What you believe cannot be proven, period, therefore it is imaginary.

      --


      ~!J!
    83. Re:In unrelated news... by DrFalkyn · · Score: 2, Interesting

      The non-intuitive part comes with speciation - how do new species occur. A typical simplistic creationist objection goes something like "Well if humans evolved from apes then the 'first human' that was the offspring of a an ape would not have been able to find a mate because there were no other humans to mate with. Therefore humans could not have evolved from apes or any other species.' You have to explain to them that reproduction is not an all or nothing thing and that species boundaries are sometimes not clear cut. It is unfortunate that this is not made clear to more people when studying basic taxonomy.

    84. Re:In unrelated news... by CRCulver · · Score: 1

      Only neo-Christian fundamentalists doubt evolution or that the earth is about 4 billion years old (give or take 500 million years). Well, them and some pacific islanders who have never seen someone with shite skin. Everyone else is lying (they're really neo-Christians but claiming otherwise).

      A number of Muslims dispute evolution too. By your silly blanket statement they would just be neo-Christians lying about it.

    85. Re:In unrelated news... by CodeBuster · · Score: 4, Insightful

      Was it not Adolf Hitler who said that, "The people will more easily fall a victim to a big lie than to a little one"?

    86. Re:In unrelated news... by VJ42 · · Score: 2

      Thanks for that link, I'm personally not a Christian, but I do want to dismiss the foolhardy notion that science and religion cannot coexist. Take for example Gregor Mendel, a monk; now considered the father of genetics. I'm sure that there are many similar stories throughout history.

      --
      If I have nothing to hide, you have no reason to search me
    87. Re:In unrelated news... by badenglishihave · · Score: 1

      Homeschooled children are better educated as a whole than most of public school because of individual attention and a less stressful learning environment. This is why most colleges view it as a plus if the prospective student has been homeschooled. I was homeschooled myself K through 12 and I am doing very well. I am currently working towards my BA in EE. Don't be so quick to pass judgment.

      And I don't want to see any replies about "social skills." I had no trouble at all leaving my family or making friends in school, so I don't want to hear about how homeschoolers can't make it in "the real world." If the real world was anything like public school, we'd all be in trouble.

    88. Re:In unrelated news... by daniel_mcl · · Score: 1

      I'm not sure that I really agree with the assertion that you'd have to be crazy not to have a certain opinion about evolution. If we polled the public on their opinion on, say, the comparative benefits of declarative versus functional programming languages, or the assumption of complete markets on which Black-Sholes analysis relies, or on their ideas about differential equations, would we expect to receive reasonable answers?

      In truth, there is no difference between these fields and evolutionary biology -- they are arbitrary areas of science, and to understand any of them takes the equivalent of several college courses. I "believe" in evolutionary biology the same way that I "believe" in the heliocentric model, the VSEPR model, Newtonian gravity, etc. -- which is to say that I believe these because I've been taught them. I've never performed any experiments to confirm any of these things.

      When we ask random people their opinions on things which have no relevance to their lives whatsoever, what are we really asking? Does it really benefit anyone to have a "Jeopardy" knowledge of these subjects -- "Evolution explains the diversity of life on this planet, Alex"? I can't see why. Sure, if you're interested, go ahead and look into these areas for your own entertainment, or you really want to do serious work in a particular field, by all means go ahead. But it seems that certain fields -- evolutionary biology, cosmology, etc. -- are considered "privileged" areas by some solely because of their interface with "religious" ideas.

      This is an entirely nonscientific way of thinking, and really isn't much better than what "creation scientists" push; so far as I have seen, most non-biologists who are militant about their views are really militant about a religious belief in atheism rather than a real desire for a more comprehensive understanding of science in the general populace. As a mathematician, I am not worried at all about the fact that the average person might have severe misconceptions about abstract algebra or differentiable manifolds or combinatorics. As far as I can tell, hoping for plumbers to have a surface-level grasp of biology makes about as much sense as hoping for biologists to have a surface-level grasp of plumbing.

      --
      I used to read Caltizzle. I was a lot cooler than you.
    89. Re:In unrelated news... by Anonymous Coward · · Score: 1, Informative

      Evolution is not the same as Abiogenisis. You see the 48% of people the article is talking about? You're one of them. Congratulations.

    90. Re:In unrelated news... by Andrew+Kismet · · Score: 4, Insightful

      Not yet, but the USA is trying damn hard.

    91. Re:In unrelated news... by badenglishihave · · Score: 0, Troll

      What I am referring to is deeper than your sadly shallow point of view. It is the love you feel from your savior. Without trying to get myself into a religious debacle, I will point out that you cannot see love either. But I'd be willing to bet you believe it exists. Some things cannot be seen.

    92. Re:In unrelated news... by dlthomas · · Score: 1

      While 52% is an easy number to arrive at, it's also wrong. That 52% includes those well educated in science who do not have faith, and I expect both camps have some members who are not well educated in science and do not have faith. For that matter, I expect there *are* some who buy into evolution for reasons of faith without understanding it, though we come up to a question on what, precisely, faith means. All of that, of course, doesn't kill the humor - just a random nitpick.

    93. Re:In unrelated news... by DrFalkyn · · Score: 4, Informative

      The origin of the earliest forms of "life" (simple single "cells", pre-DNA, pre_RNA) is surely one of the easiet things to answer - this is nothing more than self-sustaining chemical reactions occuring in a lipid bubble (maybe naturally occuring - oily froth by the sea shore, or maybe the fatty polymers being a product of the chemical reactions that occured inside them). I

      Ahh, no its not. There are some good guesses, and they've been able to discover things like short sequences of RNA that can catalyze their own reproduction, but (natural) abiogenesis is by no means a solved problem. The simplest organism that can reproduce on its own (not without a host organism like a virus) is a prokaryotic bacteria, but even there you still have millions and millions of base pairs of DNA, which could not come randomly together by chance.

    94. Re:In unrelated news... by idkk · · Score: 1
      The scientific and the non-scientific can exist in the same mind without conflict. For example:
      1) I believe the music of J.S.Bach to be utterly beautiful (that's a statement of my personal taste - you don't have to share it), but I cannot tell you why it is beautiful.
      2) I believe that the theory of evolution (or something very like it) is a correct description of how life is organized upon this planet, even though we cannot perform extensive experimental tests to show this.
      3) I believe that nuclear physics and quantum mechanics are useful - and though not perfect - mathematical images of how this physical universe is organised, and that this can be expermentally falsified (that is, tested).
      4) And I believe that the universe owes its ultimate being to the will of a Creator, whom I call God.

      These four ideas exist in my mind at the same time, without conflict. I do not ask my taste in Bach to explain the shape of animal bodies, I do not ask the theory of evolution to explain the position of electron shells, I do not ask nuclear physics to explain eternity (which is orthogonal to time, and not a great extension of time). What I do ask (of myself), however, is that God should be the centre of the wonderful beauty of music and of biology and of physics and of all the other experiences of our life. A centre, not as an explanation of what we do not know (a "God of the gaps"), but a centre as binding together all things in perfection.

      And, yes, that's not a scientific statement - but then, neither is the Tocatta and Fugue in D.

      --
      Ian D. K. Kelly

      idkk Consultancy Ltd.

      "Quality through Thought"

    95. Re:In unrelated news... by mulhollandj · · Score: 1

      You can. There is only religion where the amount of education has a positive correlation to how active and faithful you are in your religion. That is the Church of Jesus Christ of Latter Day Saints, also known as Mormons. They believe very strongly in a good education.

    96. Re:In unrelated news... by SEMW · · Score: 3, Informative
      Quite apart from the problems with your implication that evolution implies lack of "faith in a higher power" and vice versa, your last statement:

      What I believe in cannot be proved correct scientifically, therefore it cannot be proven wrong scientifically. simply does not logically follow. It is perfectly possible to have a proposition that can never be conclusively proven, but can be conclusively disproven (for example, in mathamatics, an unproveable conjecture about the natural numbers that a single counterexample could disprove). There also exist propositions that can never be conclusively disproven, but can be conclusively proven; and others which can neither be conclusively proven nor disproven, and ones which can be both. Knowledge alone of whether something can be proven tells you nothing about whether that thing can be disproven.
      --
      What's purple and commutes? An Abelian grape.
    97. Re:In unrelated news... by humungusfungus · · Score: 2, Insightful

      "It's fascinating that there's a one-to-one relationship between those who don't believe in evolution and those that don't believe in global warming."

      Fascinating, but not entirely surprising. I think that of people who reject global warming (or climate change etc etc), many do so because they make the implicit assumption that the earth is here for us; that it was somehow designed to accommodate us, no matter what. To imply that we are negatively affecting to human-hospitable climate of the planet would imply that God screwed up.

      If you believe in evolution, and recall that 99% of every species that has walked the earth or swam in it's oceans is now extinct, and that the timeframe of human existence is rather paltry compared to the age of the planet well....one can concede a bit more readily that it is actually possible that we are the ones screwing things up and that no-one is going to come and save us.

      --
      No sig.
    98. Re:In unrelated news... by CannonballHead · · Score: 1

      I think possibly the real reason for losing the tech edge is perhaps bad American public education in general. Most Americans can barely name a capital of any non-European/North American country, it seems. :)

    99. Re:In unrelated news... by cyphercell · · Score: 1

      You are the reason I am afraid to take my kids to church.

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    100. Re:In unrelated news... by Scrameustache · · Score: 1, Flamebait

      Frankly, even the rabidly fundamentalist anti-evolution junkies are aware that evolution is widely accepted in the scientific community. [...]
      I agree; this has to be ignorance, not religious zealotry. 'Is evolution well-supported by evidence and widely accepted within the scientific community?'

      They answer "NO!" at the first half of the question and never take the rest into account.
      --

      You can't take the sky from me...

    101. Re:In unrelated news... by Planesdragon · · Score: 0

      No, see, it doesnt work that way. What you believe cannot be proven, period, therefore it is imaginary.

      1: The existence of God is proven (or disproven) definitively to every dead human being.

      2: You cannot prove that yesterday happened; are you calling my Big Mac imaginary? I cannot prove you exist; are you calling /. imaginary?

      3: If you can't even be bothered to understand the basic context of the word "imaginary" -- that is, "intentionally conceived without basis in reality" -- then you shouldn't use it. When you say that God is imaginary, you are implying that everyone who believes in God is intentionally stating a falsehood, which there is zero support for. The correct term you're thinking of is "false" or "wrong", which have the proper connotation of earnest belief but incorrect result.)

    102. Re:In unrelated news... by SEMW · · Score: 1

      What you believe cannot be proven, period, therefore it is imaginary. Whilst the parent's statement was certainly flawed, yours is not that much better from a purely logical sense: it does not follow that something that cannot be proven must be imaginary (Godel's incompleteness theorem comes to mind: it can never be proven that Mathematics is logically consistant; but that hardly reduces it's usefulness).
      --
      What's purple and commutes? An Abelian grape.
    103. Re:In unrelated news... by Dadoo · · Score: 4, Insightful

      Evolution has been forced on and indoctrinated into youth today and yet these figures seem to show that young adults are growing up with a faith in a higher power.

      Umm... Acceptance of evolution and faith in a higher power are not mutually exclusive. Just ask the Catholics.

      --
      Sit, Ubuntu, sit. Good dog.
    104. Re:In unrelated news... by Anonymous Coward · · Score: 0

      There is no such thing as "microevolution" nor "macroevolution". Large changes such as speciation are mearly the sum of smaller changes over time.

    105. Re:In unrelated news... by shaitand · · Score: 3, Insightful

      'It is true that I grew up in a Christian home, but I believe what I believe no matter what science says because of the personal impact it's had on my life.'

      The things you have faith in are things you THINK are true. The things that science has shown are things everyone KNOWS to be true. You can have faith all day long but refusing to accept the findings of science is not ignorance, it is utter stupidity.

      P.S. Science has not disproven Christianity, Science has disproven many of MAN'S interpretations of what is found in the Bible. That is the beauty (or curse) of the Bible, almost everything in it can be interpreted in so many ways that you can disprove interpretations until the end of time.

      Personally I am agnostic, it is possible that a being created everything. I shy away from this possibility because as incredible and complex as everything around us is and as difficult as it is to believe that this aways was it is just that much more difficult to believe that a being that was so much more powerful, beautiful, and complex to have been able to create all this around us has always been. Having a creator may solve 'where did we come from and why are we here' but it only shifts those questions to become 'where did the creator come from and why is it here'.

      As far as any religion on Earth being correct. Of course not, that is just silly. Some semi-literate desert dictator who wrote a book to enslave and manipulate didn't guess it right.

    106. Re:In unrelated news... by j35ter · · Score: 5, Insightful

      My dear friend,
      Your faith and the fact that you believe in God shouldn't make you a creationist per se.
      Remember that many of the most inquisitive, rational and critical minds were members of the Church. Even though they had to follow an official Canon, they never took the Bible for granted. Aware that this book was written down by stone and bronze age nomads, they just refused to take for granted that God created the world in 6 (earthen) days. Look at people like Thomas Aquinas ans William of Occam. Would they have shared the creationists views? I think not!
      They rather marveled at the way God led the creation of nature and the universe.
      After all, how could you have explained a bunch of stone age shepherds what the big bang was and how DNA works. Once you start looking at the Genesis from this viewpoint, you might see the true revelation behind these words.

      I consider myself agnostic, although I had the opportunity to let myself be warmly embraced by faith.

      --
      Delta-Mike November Bravo Tango
    107. Re:In unrelated news... by transporter_ii · · Score: 0, Flamebait
      The one point that evolution can't explain is the creation of the first molecules that make it more likely that other molecules similar to themselves will come to be compared to alternatives.

      And that's what always rubs me in this debate. At some point, evolutionists take a lot of things on faith, because quite simply, given the lack of actual evidence, it is easier to believe than an external being creating life in its full form. But at some point, faith and belief in something that can't be proven is just as much like believing in a God that created us, which also can't be proven (oh, I know, at least one side is "scientific" about its beliefs).

      Now I have my beliefs, but I think if we hadn't have had evolutionist beliefs shoved down our throats from morning until night for all these years, there are few people that would believe that life just sprang from nothing and evolved from a few cells into complete animals.

      If a person had never heard of Darwin's evolution and started studying the fossil record, I'm hard pressed to see that they would have come to same conclusions. Evidence Liebniz's studies some 300 years ago:

      Liebniz's studies of the German silver-mines nearly 300 years ago still serve as a profound read in attempting to describe the untold picture of this world's primordial infancy as reflected in geological formations. Liebniz details a picture which is much different than any trendy evolutionary or impassive geological theory. Liebniz saw, in the Earthy silver-mines, layers and formations of rock indicating a wild, arbitrary, fantastic, confused, totally surprising geomorphic history of a planet Earth bursting with a metamorphoses of forms.

      To put this idea in a more tangible context, Liebniz saw geology in as objective a fashion as we could hope, because he was not over-filled with any preconceived ideas as to what he should see. The contemporary models of geomorphism had not been developed yet and did not hamper his observations.
      --
      Doctors destroy health, lawyers destroy justice, universities destroy knowledge, religion destroys spirituality
    108. Re:In unrelated news... by Scrameustache · · Score: 1

      I believe the Pope (obviously he's not in the UK); who accept the theory of evolution with no problems. That was the old pope, Palpatine the 1st is less enlightened.
      --

      You can't take the sky from me...

    109. Re:In unrelated news... by Hes+Nikke · · Score: 0, Troll

      Some things cannot be seen.

      like air! air cannot be seen, therefore it must not exist. just like god, the flying spaghetti monster, zuse, budda, alla, ra, or thore. (at least other religions bother to name there gods!)

      but since air exists, all of the above gods must exist also! (did you stop and think about why there are so meny different religions? i think people are just trying to cope with there own mortality)

      just like a witch must float because she's made out of wood - like a duck!
      --
      Don't call me back. Give me a call back. Bye. So yeah. But bye our, well, but alright we are on a shirt this chill.
    110. Re:In unrelated news... by metlin · · Score: 2, Interesting

      Sooner or later there comes a point where the vast majority of people - even we learned Slashdotters - have to take what the smart guys are saying on faith.

      That's the thing, though.

      It's not entirely faith - it is based on a methodology that's proven to work, and that methodology (i.e. science) isn't always written in stone. We change the way we do things based on what we observe and learn.

      And finally, if you *really* wanted to understand something, nobody is stopping people from going to a library and spending a few years understanding the science. It boils down to how badly you want to have something verified personally.

      We even question everything that comes about. There's a reason publications are peer reviewed. I mean, science by its nature tends to be very fact-oriented -- immaterial of whether or not you believe that an apple falls to the ground, it does.

      No, I think it boils down to something else. At the end of the day, this is how it works for the religious nutheads - "I cannot be bothered to do all that, but my prejudice tells me I'm right. Therefore I should be."

      Most of these "Christians" are hardly that. They are just zealous idiots afraid of change and are merely using religion as a crutch. They are no different from the other religious nutheads all over the world. They are no different from the people who burnt witches, books and killed people for thinking.

      Given the chance, they would gladly do that - it's just that it's a little hard in this day and age to get away with doing stuff like that.

    111. Re:In unrelated news... by Scrameustache · · Score: 2, Insightful

      Basically, it's very easy to attribute intelligence to a natural process, simple algorithm, etc., even if you know exactly what's going on. All religions evolved from animism, and animism comes naturally to everyone.
      --

      You can't take the sky from me...

    112. Re:In unrelated news... by shaitand · · Score: 1

      'Look, instead of talking about how evolution MUST be true just CREATE LIFE IN THE LAB and that will fix it.'

      http://www.gnxp.com/MT2/archives/002541.html

      Here is some interesting reading.

      http://www.talkorigins.org/faqs/evolution-fact.htm l

      'Only 51% of physical scientists believe in any form of Darwinian evolution.'

      Great. Thats a fine useless number. Now how many believe in more modern views of evolution? 99% or so I would suppose and rest are a few fundementalist crackpots.

    113. Re:In unrelated news... by uhlume · · Score: 1

      Having been homeschooled myself, I don't believe the GP was passing judgement on the practice of homeschooling, merely expressing concern that the GGP might pass his ignorance on to his children without interference from outside influence.

      There are a great many reasons people may choose to homeschool; unfortunately, one possible reason is to enable religious brainwashing of their children by isolating them from others with conflicting worldviews. Sad, but true.

      --
      SIERRA TANGO FOXTROT UNIFORM
    114. Re:In unrelated news... by Volante3192 · · Score: 5, Insightful

      (On a personal note, I fear you're going to be modded down inappropriately... You're articulate in your point and state it very clearly. While I'll admit to not being fully aware of your past history, at least in this case it doesn't seem bad. It's the people who kneejerk a -1 that are just as bad as the raving nutters that trumpet this from on high...)

      I have no problem with people believing in one or more deities. Some feel the need to have a higher power looking over them. I, personally, am confused by this necessity yet I see some reasoning behind Voltaire's statement that if there was no god, we would invent him.

      Yet to be willfully ignorant of the scientific process and instead believe solely in a god is to inadvertantly question him. If you believe that the world is only 10,000 years (or 6,000, or whatever the going age is), then how do you explain the dating processes scientists use that result in objects older than that? The most common argument I hear about this is that "It's the way He wants it to be," yet that throws into question the believability of a benevolent deity since why would a benevolent deity purposefully mislead his creation?

      I shudder what would happen if fundamentalists in Europe back in the 1500s and 1600s had been able to fully supress what was discovered. Would we still believe that Earth is flat and the solar system was geocentric?

      If you do not believe in evolution, how can you understand how penicillin has become ineffective and how superbugs are being uncovered; strains of bacteria and virii that, while exhibiting all the characteristics of previous ones, are immune to the same attack styles?

      Truth and fact are two seperate ideas. They can very well be mutually exclusive.

    115. Re:In unrelated news... by Dragoon235 · · Score: 1

      The fact of the matter, is, that it is not easy to understand for many people.

      The majority of science (social sciences included), mathematics, CS, engineering, etc. involves large amounts of abstract thinking. Thinking of objects not just as individuals, but as members of a system (where the whole is greater than the sum of the parts, i.e. "emergent properties") can be difficult for some to grasp. Now, considering the audience of slashdot, one would assume almost everyone here is able to process and reason through these abstractions.

      Now, just think of all those people who never really understood algebra ("How do I find x? oh, its right here..."); those who claim "evolution is only a theory" and "there is no proof for evolution" pander to this type of individual. It might be the crappy science education in the U.S. I think that what's more necessary is to have national standards for education, rather than allowing the local yokels in the backwoods decide what to teach. This way people (who are easily convinced or don't understand) won't be as easily tricked by the "evolution does not exist" types.

    116. Re:In unrelated news... by shaitand · · Score: 1

      'First: you're completely wrong. If 1% of scientists actively reject evolution as absolutely the best answer for the origin and evolution of life on this planet, I'd be utterly stunned. .01% would still be pretty damn surprising.'

      He skewed his statistic to cook the numbers. He didn't refer to how many scientists believe in evolution, he referred to how many scientists believe in Darwinian evolution. The general concept of evolution is pretty much accepted as fact, whether Darwin had the right of it is what is debated.

    117. Re:In unrelated news... by cyphercell · · Score: 1

      He is not ostracizing you, he is simply stating that letting this idiot teach kids would be a crime. The results of home schooling are as broad as the results of public school. For instance many home schooled kids do far worse than high school graduates the opposite is also true.

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    118. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Of course it's not intuitive. It's probably one of the reasons it took so long to figure it out (e.g., basic gravitation, Newton's laws were figured out in the 1600s, biological evolution -- mid 1800s, and not really in the modern sense until the new synthesis in the early 20th century). It's a late arriver for such an important scientific theory.

      Nobody would intuitively expect that random mutation + selection would be an efficient way to optimize a complex problem. The human brain doesn't (conciously) operate that way for most tasks. Yet, it does work. More importantly (as a test) there is scads of evidence that biological systems work that way over many generations, and the process accounts for the evidence of life over geological history quite effectively. There are many relicts of the process that are hard to explain otherwise.

      Of course, there are plenty of scientific theories which are not intuitive (e.g., relativity, plate tectonics -- turning on the lights of the car when driving at the speed of light doesn't mean the light travels twice as fast, the continents of the Earth move around -- right!), but most of those theories don't matter. It is only the politically/psychologically challenging ones that really bother people. Some people can't tolerate the idea that they might have originated from the rest of life on Earth, or that we were anything else but perfection when humans were first formed. We differ from other life only in degree. The transition is not black and white. It's bothersome.

      Besides the challenge of understanding it, evolution is hard for some people to psychologically accept because it hurts their pride.

    119. Re:In unrelated news... by Panzergheist · · Score: 1

      ". . . Large changes such as speciation are mearly [sic] the sum of smaller changes over time."

      Which is considered, albeit without 100% consensus in the scientific community, to fall under the umbrella of microevolution.

    120. Re:In unrelated news... by diablomonic · · Score: 3, Insightful
      this is not meant as a troll, just an honest (perhaps offensive) opinion.

      What it all comes down to is: Most (50%+) of people are stupid.

      Expecting some one with below average (and average isn't something to be proud of either) intelligence to overcome this evolutionary handicap and the often lifelong indoctrination from their family/parents, to understand and believe a conflicting concept which, while it seems simple to me, obviously isn't to them, is perhaps expecting too much. Especially given the joke that is passed as education ("edumacation") in many places in America/many other countries.

      Ah well.

      --
      watch "the money masters" on google video
    121. Re:In unrelated news... by Eivind · · Score: 1
      True. But non-scientific is not a synonym for religious. You don't actually *believe* Bach music is beautiful, you *KNOW* that it pleases you. (but you also know that it can fail to please some other person, with none of you being "wrong", i.e. it's a subjective judgement)

      And that's where it diverges from religion. If I'm religious and believe in Jesus, and you don't. Then I have to believe you're *wrong*. "Jesus is the son of God" is a statement of (claimed) fact. "I like Bach" is just a personal preference, which ain't the same thing at all.

    122. Re:In unrelated news... by mctk · · Score: 1

      Completely unrelated to how life started? Evolution has a lot to say about how life started. Life, when it started, looked very different than life looks today. Life did not start in the multiple forms we see it today. All life appears to come from a single source. Tracking backwards, we know that when life first appeared on Earth the environment was extremely different. Because of these differences, we can know some things about the first organism (it must have been anaerobic, for example).

      If we know something about how life changes and if we have a good idea of where life is, can we not trace backwards and make reasonable inferences about where life began?

      --
      Paul Grosfield - the quicker picker upper.
    123. Re:In unrelated news... by BakaHoushi · · Score: 1

      I'm reminded of an episode of South Park.

      Kyle: Anyone who believes in those stupid 9/11 conspiracy theories is retarded.
      Cartman: Kyle, 1 in 4 Americans believe 9/11 was a conspiracy. Are you saying 25% of America is retarded?
      Kyle: Yes, I think 25% of America is retarded.

      Change the topic to Evolution, to 48%, and you have my view.

      In my personal experience, the people who say "God HAS to be the one who created the universe" are the same people who tell me people who don't believe in God can't have morals. "But the only thing keeping us from killing each other is God!" Actually, I'm pretty sure that's a little thing called common decency (And a product of social evolution. Group A is willing to work together and Group B is willing to kill each other for food. Well, whaddya know, group B didn't last too long, did it?).

    124. Re:In unrelated news... by Score+Whore · · Score: 1

      If you want to be pedantic about it those 48% of the responders are right. Evolution, genetic drift, natural selection, etc. have very little evidence to support them. Personally I think they're the best bet. But there isn't hard and strict scientific evidence that demonstrates evolution occurs. Nobody has observed an organism mutate and then saw the parent organism be selected against with the end result that the new organism continues and the old organism has died out. The fossil record is very good for the purpose of proving extinction, but very poor for proving evolution.

      As I told a friend recently, so far through out human history science has been 100% wrong.

    125. Re:In unrelated news... by nuzak · · Score: 1

      > You cannot prove that yesterday happened; are you calling my Big Mac imaginary?

      Your assertion of a Big Mac from yesterday is irrelevant. Presumably McDonalds has sales records that could corroborate your account, and probably still hasn't overwritten its in-store surveillance recordings from that store. It's also pretty darned irrelevant.

      Now about that invisible rhinoceros in your living room...

      --
      Done with slashdot, done with nerds, getting a life.
    126. Re:In unrelated news... by dosius · · Score: 2, Interesting

      A typical fundie is going to cough up Hebrews 11:1 at you, so before they do, I will: Now faith is the ground of things which are hoped for, and the evidence of things which are not seen.

      It is thusly in their beliefs to say "X is true because we believe it to be true", which is circular reasoning and faulty logic.

      (Although I am, like badenglishihave, a relatively strict Christian, I am not blinded to reality by my beliefs as many such people are.)

      -uso.

      --
      What you hear in the ear, preach from the rooftop Matthew 10.27b
    127. Re:In unrelated news... by Wildclaw · · Score: 2, Insightful

      Faith is the one the worst things ever to befall upon mankind. It is a destructive force that destroys reason and makes otherwise intelligent people into idiots.

      Do I have faith in my fellow man? The answer is no. Having faith is just ignorance. This doesn't mean that I don't trust my fellow man. I know from empirical evidence that most people are nice and friendly, and if money or power (both known to corrupt people) isn't involved I have good reason to believe them. For closer friends I have even more empirical evidence to base my decisions on, so I trust them more. It is a basic question of risk vs reward. If there is little to no risk, I don't have any good reason not to trust others. The more risk there is, the more reason I need.

      Do I have faith in God? No, and even if there were evidence that god existed, I still wouldn't have faith in him. And my trust would be pretty limited, considering his track record according to the bible. I don't even have faith that what I experience is real. I just accept my experiences as real, because speculating the opposite doesn't have any advantages and a whole lot of disadvantages.

    128. Re:In unrelated news... by Score+Whore · · Score: 1

      Yay for imaginary! Yay gravity! Yay strong nuclear force! Yay weak nuclear force! Yay electro-magnetic force! Yay big bang! Yay speed of light!

      I don't believe in organized religion, but I don't have the hubris to claim that my beliefs are not faith based.

    129. Re:In unrelated news... by CNeb96 · · Score: 2, Informative

      >>Uh, too bad evolution is about how life is changing, and completely unrelated to how life started

      He is referring to Chemical Evolution

      http://en.wikipedia.org/wiki/Chemical_evolution

      "The second use of chemical evolution or chemosynthesis is as a hypothesis to explain how life might possibly have developed or evolved from non-life (see abiogenesis). Various experiments have been made to show certain aspects of this process, the first ones were done by Stanley L. Miller in the 1950s. For that they are now called Miller experiments. However only very basic organic building blocks were obtained. The challenge is getting complex molecules organized consistently."

    130. Re:In unrelated news... by iamstretchypanda · · Score: 1

      After a quick pondering of a few comments and tfa i've come up with:

      {
      If
      the earth was in fact created by a diety
      then
      why exactly couldn't the earth be less than 10 000 years old?
      }

      Some might say dinosaurs became extinct X years ago, where X is a number greater than 10 000. This is proved by there bones and carbon dating etc. My question is, why exactly couldn't the 'diety' have created the earth with dino bones burried in the earth. Maybe he just happened to know they would be useful for fuel or he wanted to give some geologist something to do or Y (where Y is some other reason).

      I'm not a scientist or high level scholor, but there are some holes in evolution just like there are some holes in creationism, but saying that just because there is some evidence to support evolution doesn't mean that creationism is bunk either.

      (Note: This isn't necessarily a comment back to your post specifically, it is more to address the overall ideas i've seen from reading slashdot and TFA)

    131. Re:In unrelated news... by jelle · · Score: 1

      Right. The problem is that evolution goes really, really slow. We can't see hit happen in real-time, so it's hard for some people to see what is happening. The exact same thing happened before, when religious poeple were prosecuting scientists who said that the earth was not flat.

      No sane religious person will argue that the earth is flat now, and hopefully the same will be the end of the story with this resistance to the results of extended and detailed scientific study into about how natural life on earth evolves.

      The vatican gets it, but I guess the people who don't get it are the same people who think that being religious and being pro any kind of war can mix.

      http://www.msnbc.msn.com/id/10101394/
      http://www.iht.com/articles/2006/01/18/news/evolut ion.php

      --
      --- Hindsight is 20/20, but walking backwards is not the answer.
    132. Re:In unrelated news... by Anonymous Coward · · Score: 0

      I went to graduate school in Oklahoma. While there, I was exposed to a population that I never knew existed - these people that believed the Earth was 10,000 years old etc etc.

      I have read some of the posts in this thread, and I agree that the answer is ignorance. Some of these people could be very well educated - it doesnt matter, they will still hold these views. I dont know it they were brainwashed as children, if their "preachers" brainwash them etc...but whatever the answer is, I would be interested to know.

      Here is an example - one of my classmates in graduate school at Oklahoma State University- her father was an oral surgeon in southern Oklahoma, who I met many times. Both my classmate and her father strongly believed that God created Earth 10,000 years ago. When I asked them about fossils of dinosaurs that had been carbon dated to millions of years ago, they not only became insulted, but they both said "If God is powerful enough to create Earth, isnt he powerful enough to create fossils? He put those fossils there...to make the Earth look older than it really is...."

      This stuff is partly coming out of the mouth of an M.D. I know that not all M.D.'s are smart, there are certainly ignorant doctors out there....I have seen my share of them myself...but being a doctor, he had much more science training than the average person....and yet he still held these views...

      So what causes this? I think that these pathetically ignorant views are plastered into these peoples brains from age 3. And no matter how much hard science training they receive later in life, it doesnt matter, because they have already been sufficiently brainwashed. How else can you explain entire towns of people like this in Oklahoma, Arkansas, Missouri, Texas, Lousianna, Mississippi, etc? The Bible Belt has destroyed science in this country. Period. Dont believe me - Go spend some time in Oklahoma and youll see for yourself.

    133. Re:In unrelated news... by Anonymous Coward · · Score: 0
      If the real world was anything like public school, we'd all be in trouble.

      Your vast experience in the matter has inspired me to change my viewpoint.

    134. Re:In unrelated news... by Foofoobar · · Score: 1

      Hell it works for our current monkey in chief... er' I mean commander in chief. Just repeat the same thing over and over again and somehow no matter how ridiculous it is, it becomes believable. Through repetition, it becomes fact... at least psychologically.

      --
      This is my sig. There are many like it but this one is mine.
    135. Re:In unrelated news... by Anonymous Coward · · Score: 0

      The only difference is they believe global warming's being sent to punish the liberal homosexual atheists who live on both coasts.

    136. Re:In unrelated news... by Movi · · Score: 1

      Umm, wrong again. Love as well as other emotions are steered by psychoreceptors in your brain by various chemicals. The most blatant example is rage which is pumped by adreanline.Note: i am not a biologist nor a chemist so the terms used in this post may be vague. A quick trip to wikipedia will give you the needed details

    137. Re:In unrelated news... by shaitand · · Score: 2, Informative

      'the question evolution fails to answer and which makes it counterintuitive is "Where/How/When did it all start"'

      Evolution makes no claims about the origin of life. It could have been done by the Christian god when he created life. He might have done it via evolution. Contrary to what preachers would tell the ignorant followers who don't read and interpret the bible for themselves there is no conflict between evolution and creation.

      'Thats natural selection, Creationists do not dispute that fit creatures(created things) survive and unfit creatures don't.'

      Maybe you do. Most have already decided they don't believe in evolution so when you break it into the pieces they are forced to admit, like natural selection they refuse logical debate. Natural selection is 99% of evolution. The other 1% is how new genes (and therefore traits) come into being. That is the part that is debated by scientists. Scientists have no doubt that Evolution occurs the only question is how the new traits come into being. If people evolve to have purple eyes where did the purple eye gene come from? I believe that things aren't that simple, there are multiple answers. One obvious answer is that new changes in genes are called mutations and those mutations occur under radiation. Since those mutations are random most mutations are worthless, natural selection then takes over to determine if they will be passed on.

      Its really hard to dispute this when humans share common ancestral genetic code with rats. In the same way we can use DNA to determine if you are related to someone, we have used DNA to show that all humans are related to rats (and many other diverse lifeforms). That means we all evolved from a common ancestor.

    138. Re:In unrelated news... by linvir · · Score: 5, Insightful

      It is true that I grew up in a Christian home
      This is the only reason you believe in the things you do. It's got fuck-all to do with "seeing beauty and power surrounding things". Your parents were brought up as Christians, so they brought you up a Christian. If they'd decided instead to bring you up to believe in Power Rangers, you'd believe in a superhuman team of ninja warriors defending the earth from an evil witch living on the moon, and you'd be posting Slashdot comments telling us all about the "beauty and power" you see in things, which convinces you of the existence of Power Rangers no matter what those oppressive science types might say about there being no recorded sightings of huge robots or aliens doing battle in remote wastelands. And of course, you'd say it was "because of the effect it had had on your life" as well.

      You're a slave to the meme forced upon you by your parents, a believer in an idea considered idiotic by the vast majority of scientists and Christians, and an embarrassment to the 21st century.

      GO GO POWER RANGERS! YOU MIGHTY MORPHIN POWER RANGERS!

    139. Re:In unrelated news... by Anonymous Coward · · Score: 0

      > I've encountered someone who denied heredity.

      He/she was taught by their mother 'god made you' or 'the stork brought you' and hasn't got over it. Sex is probably a sin and/or not necessary to have children.

    140. Re:In unrelated news... by TerranFury · · Score: 1

      >Maybe, but this denial of evolution is a US-only phenomena. Could be related to poor US high school education I suppose (since that's the only time most people are going to be taught about it).

      Not really; you'd be surprised.

    141. Re:In unrelated news... by alexjohnc3 · · Score: 1

      You can believe in God and have an understanding of science, just like you can have morals without being religious.

      This is a bad example. The former often isn't true. Belief in the Christian God and adherance to the view that the Bible is an accurate description of the natural world has caused and is still causing problems for the advancement of Science and humanity in general. However, the view that irreligion brings with it amorality is just a myth propagated by Christians who either have a fear that, without Christianity, everyone will just go around killing each other or by those who just don't want to risk Christianity weaken when people realize that morality isn't a reason to be a Christian. Here's a good article on the subject of morality without God.

    142. Re:In unrelated news... by Wildclaw · · Score: 1

      That is true to some extent. However, what the grandparent referred to is the fact that the appearance of the first self replicating organism (or more probably chemical compound) isn't part of evolution. Evolution only explains what happens when you already have a self replicating organism.

      An important thing to know is that Intelligent Design have the exact same limitation, so it can't be used as an argument against evolution. Very useful, because many ID debaters tend to fall back on that argument.

    143. Re:In unrelated news... by Movi · · Score: 1

      Spelling correction : Adrenaline. Should have used the preview button *hits himself with a bat*

    144. Re:In unrelated news... by Anonymous Coward · · Score: 0

      What is it made up of? How do you measure it?

    145. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Think of it more as a debilitating illness than a viewpoint. With this approach the handful of religious scientists are accounted for.

    146. Re:In unrelated news... by Syberghost · · Score: 1

      Sir Isaac Newton was much more highly regarded as a theologian than as a natural philosopher for most of history.

    147. Re:In unrelated news... by Movi · · Score: 1

      Dude, EVERYONE knows that Newtonian Laws are just a bunch of lies! It's all because of Intelligent Falling http://en.wikipedia.org/wiki/Intelligent_falling/!

    148. Re:In unrelated news... by at_18 · · Score: 1, Troll

      Why stop at thousands of years? if the deity likes to plant false evidence, how about creating the Earth three years ago, and planting false memories in your head? Or three hours ago. Or three seconds. Anyone supporting creationism must support this argument too.

    149. Re:In unrelated news... by adrianmonk · · Score: 5, Interesting

      I don't understand this line of thinking. Evolution is extraordinarily intuitive. In fact, it makes perfect sense. Two animals are born. One is unable to adapt to its environment, and dies.

      The fact that you have just explained it in a way which is subtly wrong supports the idea that it is counterintuitive. An animal does not adapt. It is born with a certain set of DNA, which it cannot change or control, and it lives or dies as a result what DNA it has (along with other factors like chance).

      In fact, this makes for a bit of a paradox. A single organism cannot ever adapt. Its DNA is essentially immutable, or at least it certainly cannot do anything to change its own DNA in any useful way. So you have an organism, and that organism has offspring, and so on. You have a whole chain (lineage) of organisms, and none of them can adapt, so how does the adaptation occur?

      The answer, of course, is that adaptation in that sense doesn't really occur at all. What occurs is that new, different organisms are created when organisms reproduce, and the different ones either are already adapted or are not already adapted at the moment they're born, and the well-adapted ones end up reproducing.

      This is a bit counter-intuitive because it's not how people solve problems. Humans generally apply intelligence to a problem. If you're a car company and you want to sell a new model of car, you don't make a bunch of new types of car at random without any direction, then ask potential customers if they suck or not, then throw out the ones that suck. That would be enormously wasteful and slow given limited resources, so humans rarely ever do that. Instead, you figure out what you want, you apply theory, and you make a plan to go directly where you want to go (or as directly as possible).

      As it turns out, my sister is a Ph.D. student in genetics, and I am a computer programmer. We've had conversations about the similarities and differences of computer code and genetic code, and it took me a while to grasp, but there are really more differences than there are similarities. If a programmer wants to create a construct, he sits down with a piece of paper (or whiteboard), charts out what he wants it to do, and writes some code, hopefully (if he has any training) in a nice, orderly manner. If he's any good, he makes it modular and separates concerns so that (say) code for the GUI is not mixed in with code for the filesystem.

      DNA does not work like this AT ALL. There are huge, gigantic sections of DNA code that are never used. Then there are sections in certain places which are used for two TOTALLY UNRELATED purposes just because the particular sequence of base pairs happens to fit both purposes. It is the equivalent of compiling a header file full of constants (say, error codes or strings) and then after you're done compiling, going, "Oh hey, since we are using a Pentium processor, that sequence of bytes for the error codes happens to also be a valid sequence of opcodes. So now I don't need to bother writing the first half of memmove(), because it already exists right there! Whoopee!" Except that it's worse than that because the DNA will have 100 other copies of memmove() in other places, all different, all incompatible, and most with bugs. Except that you can't call them bugs, because there is no spec. You expect them to do "wrong" things every now and then, indeed often, and the only real crime is to do something so wrong that the organism doesn't survive. And the only reason it does survive is that the system is pretty redundant and tolerates chaos pretty well, except when someone gets heart disease, cancer, dementia, a sore lower back, etc.

      The point is this: imagine how you would design a human. Now look at a real human -- it's almost nothing like what you'd make. It's simultaneously way more "clever" and way sloppier. It's totally whacked, totally effective, and the way it works is pretty alien to how we think. Biology, in general, is very complex and is not very intuitive.

    150. Re:In unrelated news... by Phroggy · · Score: 1

      Been there, done that, bought the T-shirt. We've shown that every prerequisite for life can be synthesized by processes known to happen on Earth prior to life. The only thing we haven't done in the lab is wait the million years for them to get together and start fucking...yet. I do not dispute that you've been able to synthesize these prerequisites, and I applaud your efforts. However, I disagree with your claim that life itself will arise from this all by itself, given enough time.

      (By the way, I'm also not convinced that these processes are "known to happen on Earth prior to life". I suspect that what you "know" about conditions on Earth before life are based on what you've concluded "must have been" in order for life to have formed the way you believe it did, rather than on any evidence of what the conditions really were. But who knows?)
      --
      $x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
      $x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
    151. Re:In unrelated news... by ergean · · Score: 1

      You are right, love is made up by evolution.

    152. Re:In unrelated news... by flyingfsck · · Score: 1

      I think you should read up about Rene Descartes and what he wrote about the scientific method in his "Discourse on Method" in 1637.

      --
      Excuse me, but please get off my Pennisetum Clandestinum, eh!
    153. Re:In unrelated news... by thryllkill · · Score: 1

      Oh, I was actually not being unrealistically reactionary, as I sometimes tend to be. I agree, while I don't believe personally, I don't really hold it against those that do (unless they try to legislate based on these beliefs). I mean the big bang theory was first popularized by a jesuit.

      --

      Note to self: No more arguing with the faithful.

    154. Re:In unrelated news... by hobo+sapiens · · Score: 1, Insightful

      That saying cuts both ways, ya know. Most people in the US as well as the world believe in evolution. What if evolution were the big lie? What will we think in 100 years? Will we laugh at evolution like we laugh at Phrenology or Lobotomy? Or will we finally get past the genesis creation account and look at it as some silly old superstition?

      Most if not all ancient legends and myths have been shown to be totally untrue. But, so have theories and teachings that had the backing of the scientific community of the time. So let us not think that just because evolution has the approval of the scientific community now that it always will or that it is infallible. When you blindly follow something, be it scientific or religious, without taking the time to examine your beliefs, it could be you who falls victim to The Big Lie.

      Since you brought it up, in a very non-Godwin-invoking way I will point out that Hitler was a perfect example. Normal, everyday people went right along with his plans. Why? Because nobody stopped to think. They all fell for The Big Lie.

      To this day, Hilter lives in London trying so see how he can get people to go along with the bocialist party's platform. (if you aren't laughing, then just do yourself a favor and ignore this entire paragraph, except the part about ignoring it, this part I mean. Don't ignore that last sentence. Or that one. Or...ok, moving on...)

      I guess my point is that many, in fact, I'd say most people believe in what they believe in because it's comfortable to them. Many people who believe in creation do so because it's what they were raised to believe and haven't thought about it. Lots of people who believe evolution do because their high school science teacher told them it is correct, or because they are afraid of public ridicule.

      There are a lot of blind followers in both camps. The question is: Are you one of them?

      --
      blah blah blah
    155. Re:In unrelated news... by Anonymous Coward · · Score: 0

      You misspelled 'you're', it's 'your'

    156. Re:In unrelated news... by Kattspya · · Score: 1

      Småland is not Sweden ;)

    157. Re:In unrelated news... by Simon+Garlick · · Score: 1

      And yet only 7% of members of the National Academy of Sciences believe in God.

      I wonder how long it will be before scientists have to wear armbands so they can be identified by good, honest, God-fearing Americans.

    158. Re:In unrelated news... by shmlco · · Score: 0, Redundant

      Precisely. Note, for example, how the title of the article wasn't "Over 50% of all Americans believe in evolution."

      --
      Any sect, cult, or religion will legislate its creed into law if it acquires the political power to do so.
    159. Re:In unrelated news... by boaworm · · Score: 4, Informative

      - "History is a set of lies agreed upon." - Napoleon Bonaparte

      - "History is the lie commonly agreed upon," - Voltaire

      If the vast majority believes something for long enough, it becomes the truth.

      And btw..

      "The Teaching Authority of the Church does not forbid that, in conformity with the present state of human sciences and sacred theology, research and discussions, on the part of men experienced in both fields, take place with regard to the doctrine of evolution, insofar as it inquiries into the origin of the human body as coming from pre-existent and living matter."

      - Pope Pius XII

      --
      Probable impossibilities are to be preferred to improbable possibilities.
      Aristotele
    160. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Beacuase you can't possibly have faith (or religion, your choice) and be well educated in sciences, could you?

      You know, that might go farther as a refutation of the GP post if that post hadn't made the exact same point.

      If you think evolution isn't backed up by scientific evidence, your education in science has been lacking. Whether you're Christian, atheist, or pastafarian.

    161. Re:In unrelated news... by cyphercell · · Score: 1

      oh you're right, thanks! Less embarrassing than spelling intelligent though. :)

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    162. Re:In unrelated news... by jcr · · Score: 1

      But that couldn't possibly be related to poor science education, could it?

      It's not just science education. History, english, geography, any subject you name has dismal standards at the elementary and high school levels in most schools in the USA. This is what we get for allowing a cartel of bureacrats to sieze a monopoly of a critical industry like primary education. The bible-thumpers wouldn't be getting any traction at all if the USA hadn't already been through several decades of dumbing-down by the fabian socialists of the NEA.

      -jcr

      --
      The only title of honor that a tyrant can grant is "Enemy of the State."
    163. Re:In unrelated news... by miro+f · · Score: 5, Insightful

      another example of something that can be disproven but not proven is every scientific theory, such es (for example) the Theory of Evolution.

      It is essentially the act of being falsifiable that actually makes Evolution a real scientific theory, and the fact that it has stood for so long (with modifications) that makes it so widely accepted.

      --
      being vague is almost as cool as doing that other thing...
    164. Re:In unrelated news... by libkarl2 · · Score: 1

      The name (democratssuck) kind of says it all. As I read his/her posting I heard a blood curdling scream... It was logic.. being brutally tortured.

      --
      You are where you are at the time you are there.
    165. Re:In unrelated news... by Anonymous Coward · · Score: 1, Insightful

      Actually there are a lot of evangelicals who are concerned about the environment and a lot of secular libertarian types who willfully believe that global warming is all nonsense.

      It's all about what fits into your world view. Conservationism fits in with the good shepherd mentality and libertarianism is a zero sum game in global warming type scenarios... so they would rather disbelieve global warming than believe libertarianism isn't a panacea.

    166. Re:In unrelated news... by $imo · · Score: 1

      Just "most scientists"? Could you point a respected, acknowled scientist who is supporter of creationist theory? I got your point, its the wording that puzzles me.

    167. Re:In unrelated news... by Anonymous Coward · · Score: 0

      You need to take Philosophy 101 or at least read Philosophy for Dummies. You don't really think those questions are clever, do you?

    168. Re:In unrelated news... by miro+f · · Score: 1

      Evolution is the term given to "Macroevolution" or evolution on a large scale, involving creating new species that cannot interbreed, and that is what is disputed in the religious world.

      Only the most absolutely ignorant religious fundies believe "Microevolution", evolution on a small scale, isn't around us everywhere.

      --
      being vague is almost as cool as doing that other thing...
    169. Re:In unrelated news... by jcr · · Score: 1

      1: The existence of God is proven (or disproven) definitively to every dead human being.

      This is a statement for which absolutely no evidence is available.

      When you say that God is imaginary, you are implying that everyone who believes in God is intentionally stating a falsehood, which there is zero support for.

      They are stating a falsehood; whether they do so out of malice or wishful thinking has no bearing on the falsehood of the claim.

      -jcr

      --
      The only title of honor that a tyrant can grant is "Enemy of the State."
    170. Re:In unrelated news... by catbutt · · Score: 1

      But this simplest of organisms you describe has to compete with other organisms that have 4 billion years of evolution behind them. The first thing that was able to "reproduce on its own" certainly had plentiful fuel and no competition. So it probably wasn't in any real sense an "organism", it would be better described as a chemical chain reaction.

    171. Re:In unrelated news... by hobo+sapiens · · Score: 1

      The Catholic church is a business, plain and simple. They are in the business of making people feel good about themselves, and parting them with their money in the process. Since people want to believe in evolution and the bible, they found a way to combine them. That doesn't mean the two are compatible.

      That's the trouble with people these days. Nobody wants to stand for their beliefs. If you believe in something, then at least stand by it. If you can't or won't stand by it, then why do you believe in it?

      --
      blah blah blah
    172. Re:In unrelated news... by Anonymous Coward · · Score: 0

      yea, but science now believes very differnt things about the flow of time. Theres no actual definitive "yes" that yesterday happened. You may have paperwork, but based on what we know about quantum theory, time has no actual flow. Yesterday didnt happen yesterday, its happening right now. Tommorow isnt happening tommorow, its happening right now. Your just paying attention to this "moment" instead of that "moment". So no, you cannot definitivly prove that yesterday happened. Not the events of yesterday, but the actual idea of yesterday.

    173. Re:In unrelated news... by MichaelSmith · · Score: 1

      Faith is the one the worst things ever to befall upon mankind. It is a destructive force that destroys reason and makes otherwise intelligent people into idiots.

      Though I wonder where we would be without it. Seriously, if you have to teach uneducated stone age people how to do agriculture for generations after you have died, you need to start by saying "do these things because I say so". There really is no other way to communicate your ideas.

      Its a shame we are stuck with the original methodology now that our communications (language, storage, etc) are so mature.

    174. Re:In unrelated news... by Wellington+Grey · · Score: 1

      Evolution is, to many, extremely unintuitive


      Aside from that, faith is so, so easy and science too hard.
    175. Re:In unrelated news... by David+Rolfe · · Score: 1

      So the defense that a sizable portion of Americans is ignorant (or answered ignorantly) is that... a sizable portion of Americans can't be bothered to read or comprehend what they are asked?

      You'll get no argument from me, but either case is damning. Full disclosure: My wife teaches reading to high-schoolers.

      Is it any wonder that "the straightforward question, 'Is evolution well-supported by evidence and widely accepted within the scientific community?'" would be hard to answer correctly when education in the U.S. (though not for lack of trying!) stops before high-school? Another explanation is that the Creationists really have 'won' and evolution wasn't taught to nearly half of Americans. Maybe it was taught in such a diminished and castrated way that it immediately slipped the mind of half of those asked. Now I'm just rambling. Sheesh.

      Sigh.

      --
      Read Heinlein's 1953 Revolt in 2100, now more than ever.
    176. Re:In unrelated news... by Wildclaw · · Score: 2, Interesting

      "It's fascinating that there's a one-to-one relationship between those who don't believe in evolution and those that don't believe in global warming."

      I believe in evolution. I don't believe in god. I believe that the earth climate is currently warming .

      I am pretty certain that the climate warming won't have catastrophic effects on the human population. The most serious scenario would be a new iceage. Flooding and storms are minor concerns, and nothing new. People will move from the worst affected areas as always. The earth getting warmer is not very likely to cause a runaway effect, because in that case earth wouldn't have been able to establish a "stable" (relativly) climate in the first place.

      I am fairly certain that humans are behind atleast some of the warming. We are 6 billion people after all. There is the possibility of the sun having more effect than most scientists think, so I can't be completly certain.

      I am very uncertain about some of the assumptions made by many of the current climate scientists. I am doubtful about co2 being a root cause to global warming because of the co2 lagging behind temperature change. The realclimate response is flawed from the start because it fails to explain the lag once the temperature begins to drop. (Unless someone can show me that there is no lag when temperature begins to drop, in which case I will alter my belief.)

      I am completly skeptical about the presentation of scientific research in mass media, because of the selection pressure being on sensationalism. There is also, way too much poltics involved.

    177. Re:In unrelated news... by PopeRatzo · · Score: 4, Insightful

      Everybody likes to say how sick they are of political correctness, yet the one area of life where political correctness is MOST in force is when it comes to questioning someone's religious beliefs.

      It's perfectly acceptable to call someone crazy for believing that maybe spewing pollution into the environment for centuries might be harmful, yet heaven forbid someone suggest that just maybe it's kind of strange to believe that Joseph Smith met an angel in the desert who gave him a set of gold-plated dinnerware inscribed with the Word of God and then he proclaimed that everyone should wear special underwear. It's OK to call a woman who choses not to carry a fetus to term a murderer, but don't you dare suggest that there's no reason to believe that some magic juju called a "soul" enters a cell at the moment of conception, or you'll be called a troll and flamebaiter.

      I believe in morality, I believe in ethics, and I might even believe in God, but please don't expect me to swallow your Iron Age superstition. Is it really so hard to see that much of the pain in the world is being caused by narrow-minded fools believing that THEY have the TRUTH and everybody else is destined to burn in hell for eternity? Do you really not realize that it was exactly this kind of exceptionalist thinking that led people to fly planes into the World Trade Center believing that God not only wanted them to do it but would reward them? Can we really not call "bullshit" when people start claiming that there's more evidence for the magical events of the Bible than for natural selection and the Origin of Species?

      Sam Harris makes a ton of sense when he wonders why it is that we are not allowed to take all the knowledge gained by science into account when forming our spirirtual beliefs. For some reason, we're supposed to disregard all of the insight that science has given us into the Universe when it comes to spirituality. He asks why it is that it's so taboo to suggest that picking one "book written by God" out of all the "books written by God" and claiming that THIS one is the REAL "book written by God" is just a little bit "counter-intuitive".

      We are told that most Americans believe that Faith should be part of our political life and they demand that our leaders be men of this "faith". If faith is "belief in that for which there is no evidence" then I say we've already had enough of leaders who ignore evidence when making decisions over war and peace, life and death. I say it's time that we had a little less "faith-based" foreign policy and "faith-based" economic policy and "faith-based" environmental policy and a little more reality-based decision-making.

      But if you're going to claim that faith and religion should be part of public life and political behavior, then you best be ready to have questions raised about just what kind of magical thinking you base your political beliefs upon. And for God's sake, stop hiding behind Political Correctness when it comes to people challenging the nature of that magical thinking.

      --
      You are welcome on my lawn.
    178. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Did you ever wonder why bunny rabbits only exists in people's houses? (Hint: It's because monks bred them from wild rabbits until they became a new species, incapable of surviving in the wild. Evolution works even when we're controlling the circumstances.)

      Now, I don't know much about rabbits, but... what the hell is a "bunny rabbit"?

      I mean, I always thought "bunny" is just a childish name for a rabbit -- any rabbit. Or am I just a rabbit-ignoramus?

    179. Re:In unrelated news... by rasputin465 · · Score: 1

      I find it impossible to avoid the ad hominem response because the stupidity reflected in the parent's comment is astounding. But I will try.

      Only 51% of physical scientists believe in any form of Darwinian evolution.

      Which filthy orifice did you pull this number out of? I assume most /.'ers realize how bogus that is.

      Embryology as a whole cannot be made to fit ANY part of evolution, and is one field of science where evolution is ignored.

      Well, apart from stating that this comment is factually incorrect, let me offer an example which supports consistency. The embryos of all organisms are extremely similar. The untrained eye would find it very difficult to note differences between, say, a frog embryo and a human embryo. One would not expect this to be the case if we didn't all share common ancestors at some point.

      When asked for proof the boosters usually say something like "It used to happen but does not happen anymore", or "it happens so slowly as to be beyond detection" or my favorite "its happening all the time".

      It is happening all the time. Why do you think you can catch a cold twice? Of course, this 'microevolution' is quite impossible to deny, so most creationist say they oppose 'macroevolution'. Yes, macroevolution is something we don't see day-to-day, but based on the measured rate of DNA mutation, we expect this to happen. The whole mechanism of how evolution works implies that large populations of macroscopic organisms see very little evolution. But fortunately we have a large fossil record, so we can see how organisms have evolved over time.

      I say believe because no one can make it happen in the lab

      Actually, you can make it happen in the lab with viruses and bacteria. The only difference between micro and macro evolution is that microbes reproduce at vastly higher rate than multi-celled organisms (and they're asexual).

      it has to be taken as an article of faith because no one can prove it.

      This is a falacy actually, because nothing in science can ever be proven. But we can say that evolution is the only theory available that actually agrees with the evidence.

      CREATE LIFE IN THE LAB

      I think someone else already pointed out that evolution, as its name implies, deals with how organisms change over time, not with how life began.

    180. Re:In unrelated news... by Anonymous Coward · · Score: 0

      rabbits live in the wild around here. you have eaten too many albino psilocybe mushrooms

    181. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Translation:
      "1) I don't know much about music and cognition, so there must be nothing I can know.
      2, 3) I believe some sciencey things.
      4) Here's another thing of which I am convinced.

      Notice how not only have I not though about why I like Bach [I the translator am guessing it has something to do with soothing rhythms and cultural conditioning], but I have a wide range of other concepts which I have managed to swallow whole without examining or comparing to one another. Therefore, these things can coexist."

      Yes, "Ignore each other and you can get along" is a wonderful lesson. There's no reason at all that we might try to put the things we know (and "know") together. Nope, none at all.

    182. Re:In unrelated news... by miro+f · · Score: 1

      the question evolution fails to answer and which makes it counterintuitive is "Where/How/When did it all start"


      that's because it's not TRYING to answer that question. Look up Abiogenisis
      --
      being vague is almost as cool as doing that other thing...
    183. Re:In unrelated news... by Anonymous Coward · · Score: 0

      I see you like arguing with strawmen. Whatever gets you off, man. Your "logic" is absurd and you know it. Stop being a moron.

    184. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Actually I'm a programmer in the health care industry - no kids, by the way.

    185. Re:In unrelated news... by bendodge · · Score: 1
      ICR's RATE project did publish a number of astonishing finds, mostly related to the following:

      Carbon-14 found in diamonds and coal, suggesting that they are not millions of years old.
      Polonium radiohalos that suggest that granite was cooled quickly.
      Very inconsistent nuclear decay dates.
      Helium in zircon crystals.
      Almost all of the experiments were hired out to commercial and university laboratories, sometimes through third-party mining companies (a common practice). They published a volume of hypotheses three years into the project, and published the second volume containing the results five years later at the end of the multi-million dollar project.

      Their research was acknowledged at the annual American Geophysical Unions conference, and they were encouraged to keep up the "first good creationist research" the conference attendees had seen. Many scientists there were amazed by the project's results, and have since repeated and validated many of their finds. While evolutionist will not say that this research disproves long ages or current radioisotope dating methods, it has stirred much interest in the scientific community.

      If you wish to flame me or decimate my karma, please do so by (and after) attacking the argument, not the presenters.
      --
      The government can't save you.
    186. Re:In unrelated news... by Anonymous Coward · · Score: 0

      I'm using a Particle Swarm Optimization routine...I wrote the code myself and know exactly what it's doing, I still want to anthropomorphize it and believe its doing it intelligently instead of just randomly selecting points and discarding those that don't give good results.

      And in a random poll of 1000 particles, 67% of them reported belief in a "Programmer".

    187. Re:In unrelated news... by Squozen · · Score: 1

      'Intelligent', not 'intelegent'. :P

    188. Re:In unrelated news... by loxosceles · · Score: 1

      Wonderful... they're not ignorant, they're simply illiterate? I may not read an entire article linked from slashdot, or I may not read it at all, but then again I don't volunteer to answer questions about those articles.

    189. Re:In unrelated news... by jcr · · Score: 4, Insightful

      I know how fashionable it is to bash the USA, but if you think we're ahead in that race, then you need to visit a few more countries. I could tell you about places where people believe in witchcraft and have been known to hack their neighbors to pieces over it, and I'm not talking about things that happened centuries ago.

      -jcr

      --
      The only title of honor that a tyrant can grant is "Enemy of the State."
    190. Re:In unrelated news... by skeftomai · · Score: 4, Informative

      We came from apes. Apes came from monkeys. Monkeys came from lemurs. Lemurs came from rodents. Rodents came from some earlier mammal. That mammal came from reptiles. Reptiles came from amphibians. Amphibians came from fish. And so on. In fact, the biggest evidence of this IS embryology. Do some research on it some time. There's a reason human embryos have a tail, and are indistinguishable from nearly every other land dwelling embryo for quite a large amount of it's development.

      Correction...the theory goes that we did NOT come from apes but from a common ancestor...from wikipedia:

      Since the time of Carolus Linnaeus, the great apes were considered the closest relatives of human beings, based on morphological similarity. In the 19th century, it was speculated that their closest living relatives were chimpanzees and gorillas, and based on the natural range of these creatures, it was surmised humans share a common ancestor with other African apes and that fossils of these ancestors would ultimately be found in Africa.

      Also see http://www.pbs.org/wgbh/evolution/library/faq/cat0 2.html.

    191. Re:In unrelated news... by Anonymous Coward · · Score: 0

      The fact is thousands of fossils that should be in evidence are missing. I stopped being an anthropology major when I realized they were making things up as the went along and then changing their story when it was "needed". It's medieval to think people came from monkeys - a very unsophisticated view.

    192. Re:In unrelated news... by FiloEleven · · Score: 4, Insightful

      The things you have faith in are things you THINK are true. The things that science has shown are things everyone KNOWS to be true. A small but important correction: the things that science has shown are things which we believe to be true because the evidence points in that direction. That is to say, science uses evidence to produce a model, and we accept the most accurate model because we have nothing better. The scientific process is always open to new evidence, and if new evidence contradicts our current model then we refine the model to account for the new evidence.

      Science is meaningful and helpful, and it would be a real shame if its pursuit were to be abandoned, but calling science truth is just as bad as calling it a lie.
    193. Re:In unrelated news... by PopeRatzo · · Score: 3, Insightful

      OK, wildclaw, you make sense. You look at the evidence, and you come to a slightly different conclusion than some other people looking at the same evidence. But you're a long way from denying that Man can have a deleterious effect on our environment.

      If you listen to the extraordinary reaction of the Religious Right (and the non-Religious Right like Hannity and Limbaugh), you'll hear something completely different. To them, any discussion of global warming or any sort of negative effect on climate due to more than a century of industrial pollution is a total threat to their entire world-view. To them, it's not enough to say that "yes, the climate is heating up, but it might not be because of people". They have to completely deny any possibility that there's anything at all wrong with dumping plutonium in our drinking water or mercury in our food supply. They're not just arguing with the conclusions of scientists, they're hysterically demanding that it not even be SUGGESTED that pollution is bad in any way, and it's perfectly acceptable for some 22 year-old with an associates degree in political science from Regent University to edit scientific journals because George Bush said so. I'm not exaggerating.

      Science itself is under attack. Not just this one area of science, but the most basic concepts of scientific thought, and indeed, logical thought. What scares me the most about the turn of the thinking of the Right in the US is their insistence that reality itself is biased against their beliefs and so, reality itself must be at fault. It's not unlike the kind of thinking that led to the backwardness of certain parts of Europe during the Middle Ages or Cambodia under Pol Pot, where anybody who wore glasses was suspect because it meant they could read a book, and thus, might not have polished off every drop of the koolaid. If we're going to have any kind of chance in the coming decades, it's going to fall upon people like us, those of us who actually have read a science text that didn't suggest that the Earth is 6,000 years old, to stamp out this kind of ignorance with extreme prejudice. And, it means we're going to have to give those poor souls who grew up being told that Science and Humanistic Thought are B.A.D. because they "go against Scripture" a lot of kindness and understanding, as well as some decent reading material and patience.

      --
      You are welcome on my lawn.
    194. Re:In unrelated news... by Anonymous Coward · · Score: 2, Informative

      We came from apes. Apes came from monkeys. Monkeys came from lemurs. Lemurs came from rodents. Rodents came from some earlier mammal. That mammal came from reptiles. Reptiles came from amphibians. Amphibians came from fish. Ok it's pedantic but the evolutionary biologist in me needs to point it out, this isn't really correct. We didn't come from apes we are apes or at least primates. We, along with the other members of the Hominidae (chimps, gorillas, etc.), are decended from a common ancestor. The Hominidae along with the Old and New World Monkeys have an ancestor in common, that ancestor was possibly more monkey-like than ape-like but it wasn't exactly either.

      It's a nice, bite-sized lie to think it went bacteria, fish, amphibian, reptile, mammal and culminated in the towering pinnacle of evolution that is exemplified by the lesser spotted slashdot reader but it's not truly correct, the phylogeny of life is a little more complex (a lot more if you start getting into horizontal gene transfere within the Archaea).

      Sure some reptile-like creatures became bird-like (maybe with a dinosaur bit in between) but the reptile-like creatures kept evolving too, evolution isn't a one way path from simplest to most complex it's about the best fit for any given niche.

      So in summation, yes I've made my point badly, no I can't make it clearer at this time, no evolution isn't a race and if it is we didn't win (we aren't even the latest result), and yes you are a kind of monkey, sort of.
    195. Re:In unrelated news... by coopex · · Score: 1

      Evolution basically say a population of organisms changes over time to adapt to the environment. We know from geology and the fossil record that conditions have been very different in the past, and that there were organisms then that aren't around today, however this is evidence for evolution, not the theory itself. It doesn't say there there must have been a single first organism, we've inferred that from the evidence. Abiogenesis deals with how life began, and to my knowledge is pretty unsubstantiated.

      --
      The road to hell is paved with good intentions.
    196. Re:In unrelated news... by Lije+Baley · · Score: 1

      Science is only as complex as what it is studying. And there are some of us who believe that the global environment is extremely complex. So complex, in fact, that we can't help but be skeptical about level of certainty "everyone" is reaching about the "facts" of human effects on it. Humans, in science and in everything, rely on simplifications/models because reality is often too complex. Consider the evolutionary reasons for this kind of behavior. It is no mystery that the general public relies upon religion, stereotypes, and soundbytes. Scientists actively work to overcome the urge to make judgements based on faulty or incomplete information, but they still have human needs and aspirations, and instincts evolved to ensure their fulfillment.

      It is only the adoption of narrow perspectives that put science, religion, evolution, conservatives, liberals, etc. at odds with one another. From a broader perspective, all of this quite consistent, intuitive, elegant, and strangely amusing.

      --
      Strange things are afoot at the Circle-K.
    197. Re:In unrelated news... by Mr.+Bad+Example · · Score: 1

      > What it all comes down to is: Most (50%+) of people are stupid.

      "You know how dumb the average guy is? Well, by definition, half of them are even dumber than that."

      --J.R. "Bob" Dobbs

    198. Re:In unrelated news... by Anonymous Coward · · Score: 0


      Typical religious nutt-job zealot response. Ignore all the points he made that you can't defend against (i.e. the bulk of his response) then zoom in on the one smallest thing you think he's going to have the hardest time supporting and try and make the conversation all about that. Seen this hundreds of times and recognise it instantly now.

      I swear you people must get special training on how to twist and warp arguments.

      Read what he said again. Evolution is NOT about the creation of life, it's about how life has changed and adapted over time.

      Of cause you have a hard time with that because you think we all just popped out of thin air 10K years ago, because you un-questioningly believe another bunch of nutters who tell you that the bible is a literal text, instead of a metaphorical work constructed by comittee from parchments written (in some cases) hundreds of years after a man called jesus christ lived.

    199. Re:In unrelated news... by Anonymous Coward · · Score: 0

      "In fact, it makes perfect sense."

      Uhm, no it does not, perhaps you need to be reminded about Haldane's Dillemma? And other mathematical embarassments of Darwinian evolution? If anything natural selection will be replaced with a more coherent theory. NS is so far and away not the driver of evolution, one only has to see lateral gene transfer and network computation in bacteria to know that the scientists are barely scratching the surface in how life developed, the state of biological science is emybryonic.

    200. Re:In unrelated news... by coopex · · Score: 1

      I seriously doubt he is referring to chemical evolution, stellar evolution, nucleosynthesis, evolutionary algorithms, the evolution of rock music, or anything other than biological evolution.

      --
      The road to hell is paved with good intentions.
    201. Re:In unrelated news... by iamstretchypanda · · Score: 0, Troll
      Please note that both reasons I gave both had purpose to them; None of the reasons were 'just because he felt like it'.

      The bones being there for fuel... The reason is a given, if you can't figure it out go /wrists now please.

      The bones being there to give some geologist something to do... Something to do in the sense of an occupation. In French we often use the verb that means 'to do or to make' in this context.

      Why stop at thousands of years? if the deity likes to plant false evidence, how about creating the Earth three years ago, and planting false memories in your head? Or three hours ago. Or three seconds. Anyone supporting creationism must support this argument too.



      Your counter-argument does not answer my question. Your counter-argument is simply flamebait and should be modded as such. Simply put I was stating, why couldn't the 'diety' have created the earth with fossil fuels and fossils developing into fossil fuels etc. I haven't seen this question asked nor answered on slashdot and would like a logical response.
    202. Re:In unrelated news... by glwtta · · Score: 1

      It is perfectly possible to have a proposition that can never be conclusively proven, but can be conclusively disproven.

      That is actually the only kind of scientific hypothesis you can have. Science can't absolutely prove things, just fail to disprove them for a really long time.

      --
      sic transit gloria mundi
    203. Re:In unrelated news... by Anonymous Coward · · Score: 0

      For some people its easy to believe in evolution because the people geographically closest to the apes and monkeys are blacks in Africa, and they see monkey-like characteristics in their features. Of course this is a false observation but it shows how medieval it is to believe people descended from apes.

    204. Re:In unrelated news... by GeffDE · · Score: 1

      No, mathematics can be proven to be logically consistent. What Godel said was that it is impossible for a logical system (like Mathematics) to be both provably consistent and provably complete; so basically, because mathematics is provably consistent (that's where the whole idea of a proof comes from...), there are things that you cannot prove with that system. Whoops...but that hardly reduces it's usefulness.

      --
      It has been a nervous year, with people beginning to feel like Christian Scientists with appendicitis.
    205. Re:In unrelated news... by nuzak · · Score: 1

      Yesterday may be a perception to you, and the name is even pegged to the rotation of our chunk of rock, but things like carbon decay show pretty definitively that the events happened.

      I'm not going to get into a George Berkeley thing with you. I refute it thus *whack*.

      --
      Done with slashdot, done with nerds, getting a life.
    206. Re:In unrelated news... by TommydCat · · Score: 1

      Since win did teh prevue buton haf a spelcheck funkshun?

      --
      This comment does not necessarily represent the views and opinions of the author.
    207. Re:In unrelated news... by jasen666 · · Score: 2, Insightful

      Close. Their business model is more about making people feel guilty about everything, and extorting money from them. The protestants have taken the other, feel-good route.

    208. Re:In unrelated news... by Clock+Nova · · Score: 2, Insightful

      And that's what always rubs me in this debate. At some point, evolutionists take a lot of things on faith, because quite simply, given the lack of actual evidence, it is easier to believe than an external being creating life in its full form. But at some point, faith and belief in something that can't be proven is just as much like believing in a God that created us, which also can't be proven (oh, I know, at least one side is "scientific" about its beliefs).


      I don't think that it's faith that scientists go on; it's probability. We simply accept what is likely to be true based on evidence already collected and analyzed. In fact, we're quite happy to be proven wrong, nearly as happy as when we're proven right, because both bring us closer to the truth. And truth is the ultimate goal, is it not?
      --
      There they were, sitting in the van with all those dials, and the cat was dead. -V. Marchetti, CIA
    209. Re:In unrelated news... by NeverVotedBush · · Score: 1

      But thinking that evolution isn't supported by evidence, or isn't widely accepted by scientists, is just plain ignorance.

      Not it's not. It's just plain stupidity.

      I am very afraid for this country. This is like the Dark Ages Part II.

    210. Re:In unrelated news... by Dun+Malg · · Score: 1

      The exact same thing happened before, when religious poeple were prosecuting scientists who said that the earth was not flat. When was that? I think perhaps your thinking of the church rejecting heliocentrism. Even the greeks knew the earth was round.
      --
      If a job's not worth doing, it's not worth doing right.
    211. Re:In unrelated news... by ArtDent · · Score: 5, Insightful

      Hobo sapiens, meet science. Science, hobo sabiens.

      One of the many neat things about the way science is practiced, with numerous independent scientists continuously challenging each other's theories and discoveries, is that it doesn't tend to produce Big Lies.

      It's conceivable, though highly unlikely, that one day evolution will be disproven completely. If that happens, it will be entirely to science's credit.

    212. Re:In unrelated news... by Anonymous Coward · · Score: 0

      The emptiest pot bangs the loudest.

    213. Re:In unrelated news... by synjck · · Score: 2, Interesting

      good job, on yet a further misinterpretation. einstein stated that he believed in spinoza's god, which is basically a deistic god. though he didn't believe in a personal god who interfered and interacted directly with humans, he did believe in some creative force.

    214. Re:In unrelated news... by cheater512 · · Score: 4, Informative

      Of course love is made up of matter. Its a combination of molecules in your brain.

    215. Re:In unrelated news... by Clock+Nova · · Score: 2, Insightful

      Jeez. Semantics. The ability to adapt is a function of many things, not just genetics. My explanation was meant to be as simple as possibly, but it's not wrong.

      --
      There they were, sitting in the van with all those dials, and the cat was dead. -V. Marchetti, CIA
    216. Re:In unrelated news... by phrasebook · · Score: 4, Funny

      So you're better than what, parts of Africa and the Middle East?

      Have a gold star.

    217. Re:In unrelated news... by Anonymous Coward · · Score: 0

      And the common ancestor of humans and modern apes is.... wait for it......

      Another (premodern) ape!

      There are countless examples of apes that existed long before humans, chimps, gorillas, and orangs ever saw the light of day.

      So yes, we ARE descended from (and ARE ourselves)apes. As the granparent post said, we came from (premodern) apes, who came from (premodern) monkeys, who came from (premodern) rodents, etc.

    218. Re:In unrelated news... by shaitand · · Score: 1

      'Science is meaningful and helpful, and it would be a real shame if its pursuit were to be abandoned, but calling science truth is just as bad as calling it a lie.'

      Not at all, there are two facets to science. The first is the one everyone focuses on. The formation of theories. The part everyone ignores is the observation phase. While the formation of theories to explain observations is the process of creating models and not to be confused with truth (it isn't even supposed to be truth); I view the theories as a means to gather more observations. The primary function of science is to collect observations and establish new observations by postulating behaviors and then subsequently observing those behaviors. Observations are fact, and fact is also truth.

    219. Re:In unrelated news... by Alien+Being · · Score: 1

      I was tempted to mod you ++1, but I'd rather say, as a PATRIOTIC AMERICAN, "Amen".

      Freedom of religion is a concept that is drilled into our heads as U.S. children. Somewhere along the line, it got confused with freedom to believe in the Easter bunny.

    220. Re:In unrelated news... by FiniteElementalist · · Score: 1

      The poll numbers themselves suggest that faith in God and belief in evolution are not even close to mutually exclusive: http://www.msnbc.msn.com/id/17875540/site/newsweek /

      Scroll down to numbers 12 and 13, those relevant to this discussion. Evangelical protestants are the only group which are overwhelmingly against evolution. Majorities of the other Christian groups believe that evolution did occur, but that God probablity had his hand in it. The nonevangelical groups answered the evolution being well founded/accepted question significantly more in the affirmative than in the negative.

      The issue is that the evangelical protestants constitute the largest Christian group in America.

    221. Re:In unrelated news... by cheater512 · · Score: 1

      1. God cannot be disproven for dead people. They are dead.
      2. You cant prove that your Big Mac is real either.
      3. Only one person has to imagine it. Everyone else can blindly follow it. Ever read about some cults?

    222. Re:In unrelated news... by Just+Some+Guy · · Score: 1

      I'm using a Particle Swarm Optimization routine to determine a randomly optimized satellite constellation for imaging,

      I worked with peers to develop a simulation of a self-balancing telephony network.

      It's amazing how many ways there are to make homework sound good on a resume.

      --
      Dewey, what part of this looks like authorities should be involved?
    223. Re:In unrelated news... by Opportunist · · Score: 1

      No, but as usual the US try to monopolize it.

      And this is the only monopoly they can have in my opinion. I'd willingly hand it to them.

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    224. Re:In unrelated news... by Anonymous Coward · · Score: 0

      You're obviously trolling, but I'll bite anyway...

      This sounds exactly like something from a socialist with penis (USA) envy.

      Yeah, just mod me down already, I know.

    225. Re:In unrelated news... by SEMW · · Score: 1

      What Godel said was that it is impossible for a logical system (like Mathematics) to be both provably consistent and provably complete You're thinking of his incompleteness theorem. That it is impossible to prove that 'Mathematics' (or even arithmetic) is self-consistent is a corollary of his second incompleteness theorem. because mathematics is provably consistent (that's where the whole idea of a proof comes from...) Well, no. Mathematics is not provably consistent (see above). Mathematical proofs are by definition corollaries of the set of axioms you choose. Obviously, if the axoims are inconsistent then your proven theorem is rubbish, even though it may be "correct" given the axioms. If your axoims are consistent, then your proven theorem is correct if your axioms are "correct", which is a very bad way of saying that it is a corollary of the axioms (obviously, axioms don't need to be 'correct' in any meaningful sense as long as they're not inconsistent).
      --
      What's purple and commutes? An Abelian grape.
    226. Re:In unrelated news... by David+Rolfe · · Score: 2, Insightful

      The origin of the earliest forms of "life" (simple single "cells", pre-DNA, pre_RNA) is surely one of the easiet things to answer - this is nothing more than self-sustaining chemical reactions occuring in a lipid bubble (maybe naturally occuring - oily froth by the sea shore, or maybe the fatty polymers being a product of the chemical reactions that occured inside them). I

      Ahh, no its not. [...] The simplest organism [has] millions and millions of base pairs of DNA, which could not come randomly together by chance.

      'Could not'? Could not come together or did you really mean could improbably come together (even as a result of a chain of improbable events)? The great thing about the uncomprehensible vastness of both time and the universe is that improbable events still happen. I think this is the 'real' problem people have with non-supernatural origins. For some improbability is equivalent with impossibility, and they have no problem with that. To those people, I suggest this: imagine the odds of winning a 6-49 lottery (i.e. your odds of winning are better than 49*49*49*49*49*49, but still a really huge number, right?). Now, why is it that it makes the news when someone DOESN'T win the lottery in Florida in any given week? It's mostly because even though the chance that you will win is small, the chance that someone will win is pretty good! Now, if you can, expand this idea to the whole giant incredible hugeness of the universe and time*. Even though the chance that some particular random winning "mutation" (used loosely to cover abiological reactions as well) is small those "mutations" still win.

      Improbable events still happen!

      *I apologize for our lack of words to convey the quanities involved here. How do we even talk about the number of chemical reactions that happened in the whole of the universe for the billions of years that these pre-life reactions where taking place in the millions of billions of planets that could sustain them? What this all means to me is that life in the universe is not all that unlikely. Life like us is, but life isn't.
      --
      Read Heinlein's 1953 Revolt in 2100, now more than ever.
    227. Re:In unrelated news... by Opportunist · · Score: 1

      A fact is in fact just that: What the majority of people believe as truth.

      A few hundred years ago it was a fact that the sun revolves around earth. It was false, we know that now, but back then it was simply a fact. Undisputed for centuries.

      The difference between religious and scientific facts is simply that the former cannot be tried and tested. The key feature of scientific facts is that they offer tests against themselves. You can test them, you can verify them, you can repeat the results and thus prove for yourself that they are true. Religious facts can only be believed.

      That makes religious facts much more convenient. It doesn't take hard work to actually believe them, you can simply lean back and nod your head.

      Maybe that's why they're so well liked with lazy people.

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    228. Re:In unrelated news... by SEMW · · Score: 1

      Apologies, that was supposed to read "You're thinking of his first incompleteness theorem. That it is impossible to prove that 'Mathematics' (or even arithmetic) is self-consistent is a corollary of his second incompleteness theorem."

      --
      What's purple and commutes? An Abelian grape.
    229. Re:In unrelated news... by jd · · Score: 1
      It would be slightly more correct to say that species boundaries depend on your perspective. Genetics is a continuum. Species merely refer to points on that continuum that are sufficiently distinct that they must be classified distinctly, with rather crude circles then drawn round those points to enclose everything that is more related to the central point than to a different central point. One reason that species keep being reclassified and recategorized is that classifications have been somewhat crude and based on incomplete data. Another reason is that the edges aren't simple, they're more analogous to fractals. Combinations that "should" work don't, and some that "shouldn't" have.

      The whole debate over evolution (micro or macro) is a meaningless one until there is an accepted, standard baseline from which to argue. At present, there is not. I can claim evolution exists all I want (and I have every reason to believe it does), but I might as well be claiming it in Klingon. If communication is impossible, debate is impossible.

      The only thing I find despairing is that Britain has a much better educational system than the US, but almost 30% of people in Britain reject evolution. This is sickeningly high and shows that Western educational systems have totally broken down.

      --
      It's a small world and it smells funny; I'd buy another if it wasn't for the money; Take back what I paid (SoM)
    230. Re:In unrelated news... by GeoSanDiego · · Score: 1

      Global Warming possibly not caused by PEOPLE!!! http://www.youtube.com/watch?v=XttV2C6B8pU

    231. Re:In unrelated news... by Anonymous Coward · · Score: 0

      "Personally I am agnostic, it is possible that a being created everything."
      "As far as any religion on Earth being correct. Of course not, that is just silly."

      'A being'. 'No one got it right'.

      Conditional/weighted agnostic, with emphasis on western hemisphere current religious trend/undertone, and only monotheistic views as legit? :o
      Personally I wouldn't call you an agnostic, at all.

    232. Re:In unrelated news... by init100 · · Score: 2, Insightful

      I know how fashionable it is to bash the USA, but if you think we're ahead in that race, then you need to visit a few more countries.

      The difference is that the USA aspires to be a world leader in almost every field. Compared to other western countries, the USA certainly has the most religious influence on politics and daily life. The high-tech profile and the importance of religion looks somewhat strange in the eyes of other industrialized/high-tech countries.

    233. Re:In unrelated news... by coopex · · Score: 1

      The blowing up 747s was actually from FOX, though from season 1 of 24...

      --
      The road to hell is paved with good intentions.
    234. Re:In unrelated news... by Anonymous Coward · · Score: 0

      America continues to worry about losing its edge in the high-tech industry. But that couldn't possibly be related to poor science education, could it? Through public high school and college, I learned the ins & outs of evolution, it's evidence, it's conclusions, it's proponents, and the civic aspect of the debate surrounding it. Despite this, I have never once used my vast trivial resources concerning the manner in any context other than this kind of debate. Unless you're working in a specialized field like biology or paleontology, being able to recognize the chart with the stages from ape to caveman won't get you a higher salary. Half the kids in my graduating class couldn't explain what a paragraph is, let alone read one, and yet they all understood and believed in (and I mean "believed in") evolution. If you subscribe to evolution, then be satisfied that science has unlocked an ancient mystery. If you believe in creationism, then praise Jehovah or Allah. If you believe in Sitchin, set your telescopes for planet X, but most of all, get over it.
    235. Re:In unrelated news... by Anonymous Coward · · Score: 0

      USA == easily less ignorant than most of the rest of the world

    236. Re:In unrelated news... by coopex · · Score: 1

      If I didn't know people like that, I'd believe you were bullshitting me. That seriously disturbs me that someone can be so off their rocker that they sound like a bad skit from SNL and yet have millions of followers. In another note, the blowing up 747s was actually from FOX, though from season 1 of 24...

      --
      The road to hell is paved with good intentions.
    237. Re:In unrelated news... by Antique+Geekmeister · · Score: 1

      You don't meet many bible-thumping Baptists, do you? They do some serious hellfire and damnation in their sermons, especially when talking about the Catholics.

    238. Re:In unrelated news... by Opportunist · · Score: 1

      The existance of God can neither be proven or disproven. God is no scientific entity. It (he, she, whatever) doesn't offer a test for its existance, and this is a requirement for scientific findings, that you can repeat a test and reproduce the results. Now, I can't create a new earth in 6 days, and since there ain't been a nobel prize for it, I doubt anyone else can. I also doubt anyone can create a new God (no, I don't mean just fabricate some bunk, I mean create an allmighty, omniscient being).

      Whether it's proven to someone who died plays no role in our universe. It's as important as the question what happens in a black hole, or what was before the big bang. We (the living ones) cannot test the results, thus it is ridiculous to discuss it. There is no fact, not even a hypothesis, to found the discussion upon, there is no way to test the thesis, so it is impossible to base a scientific discussion upon it.

      It is quite easy to prove that yesterday happened, actually. That Big Mac you suggest is in sales records and, if you are so inclined, you can examine your feces and find the digestive waste products of said burger. The question whether someone else exists is a matter for philosophy, not natural science because, again, there is no test offered against it.

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    239. Re:In unrelated news... by init100 · · Score: 1

      The most blatant example is rage which is pumped by adreanline.

      I think an even more blatant example is the effect various ingested substances (such as food or drugs) can have on your mind.

    240. Re:In unrelated news... by init100 · · Score: 1

      Your link is wrong. Remove the last slash and it works fine.

    241. Re:In unrelated news... by GeffDE · · Score: 1
      There are a few logical inconsistencies with what you wrote, which is ironic. But anyway, if your axioms are consistent with each other (i.e. are self-consistent), then anything proven with those axioms is consistent with those axioms, and so is self-consisent.

      This is what Godel's First Incompleteness Theorem

      For any consistent formal theory that proves basic arithmetical truths, an arithmetical statement that is true, but not provable in the theory can be constructed. That is, any theory capable of expressing elementary arithmetic cannot be both consistent and complete.
      OK, and the second one states:

      For any formal theory T including basic arithmetical truths and also certain truths about formal provability, T includes a statement of its own consistency if and only if T is inconsistent.
      Now, mathematics does not state it is consistent or inconsistent, therefore, it is not inconsistent. Because, I mean, from the first thing I said, the axioms of mathematics are consistent, and so mathematics, which is not self-referential, is not inconsistent. Godel implies nothing about the group of theories that we call mathematics; what Godel shows is that it is futile to try and build a logical system without axioms. That is not mathematics.
      --
      It has been a nervous year, with people beginning to feel like Christian Scientists with appendicitis.
    242. Re:In unrelated news... by Nyeerrmm · · Score: 1

      I'm sorry, I wasn't intending to sound like I was bragging, that was just the most succinct way I could think of to describe what I was doing (and thus give context to my comment.) Hell, I only learned what PSO was last week and have been relying heavily on luck and a grad student who is doing her thesis on the topic (optimization of satellite constellations) to get any results at all.

      Again, sorry if I sounded like I was bragging.

    243. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Actually... Aquinas has quite a bit to say on the subject: http://www.newadvent.org/summa/1.htm

    244. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Sure, if you consider "most of the rest of the world" the most miserable in Africa and some countries around other continents. (well, sadly they actually are most of the world, but I'd expect you to try to compete with those who have some at least vaguely similar oportunities)

    245. Re:In unrelated news... by Anonymous Coward · · Score: 0

      True, but in mathematics you can conclusively prove something. They're called theorems. Of course, you have to accept the basic axioms, but those are the same axioms you have to have in order to be able to do math at all.

    246. Re:In unrelated news... by Opportunist · · Score: 1

      That's the difference between science and religion. Science does not claim to have the end-all truth in it. It is an open end model that was built through try and error, through the construction of theories and proving (or falsifying) them, and that allows anyone who doubts it to test against it. Everything we claim as 'fact' through science offers a test that allows you to repeat the results and come to the same conclusion (or to prove that it was wrong). You can tell a good scientific 'fact' from a bad one such that the good fact offers itself to good tests that you can repeat (provided you have access to good enough equipment).

      You can prove Newton's laws of gravity. Take a hammer, drop it. It will fall directly towards the center of Earth's gravity. It's harder to prove that earth moves towards the hammer as well because you're standing on the planet yourself (and thus don't notice its movement), but this can be proven by putting two items in a zero gravity environment and observe their movement towards each other.

      Scientific facts can be tested and falsified. If such a test that allows you to 'break' it if it's not true is not offered, you may not call it science.

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    247. Re:In unrelated news... by thryllkill · · Score: 1

      Except for the fact that the whole spinoza's god thing is explained in the link I cited. Not misinterpretation, just not significant to the discussion.

      --

      Note to self: No more arguing with the faithful.

    248. Re:In unrelated news... by jZnat · · Score: 1

      Well I believe in both stories, although I also believe that the creation one is filled with metaphors and isn't literal, legalese-esque fact. Do you think people thousands of years ago would be able to comprehend what we know now about the Big Bang and evolution? Hell, a lot of people still can't comprehend it; just imagine trying to explain it to Moses for example. I feel that the story of creation is a metaphorical, simplified version of what has actually happened.

      --
      'Yes, firefox is indeed greater than women. Can women block pops up for you? No. Can Firefox show you naked women? Yes.'
    249. Re:In unrelated news... by Tyler+Durden · · Score: 1

      Errr... no, you are mistaken. Spinoza's God is a pantheistic God. (Meaning God and the universe are the same thing). I also read that Einstein wanted to combine the pantheism of Spinsoza with atheism. Not sure how that could be possible but hey, I'm no Einstein.

      --
      Happy people make bad consumers.
    250. Re:In unrelated news... by Anonymous Coward · · Score: 0

      The title "over 50% of all Americans believe in evolution" would have been an inacurate title. For this poll, ~48% said evolution was wrong. The other ~52% fall into at least two other groups: 1) yes, evolution is correct and 2) I don't know if evolution is correct or not. Then there is this chart originally from Science Magazine which says ~60% of Americans either think evolution is wrong or don't know. Only about ~40% believe it is true, a minority in that study. Also note the position of the USA in relation to the other countries on that chart. Sad, really.

    251. Re:In unrelated news... by KKlaus · · Score: 1

      And actually there were a few notable attempts to replicate that many millions (billions) of years by creating simple organisms that have very very short generations, but in every case (I believe) what was selected for was the simplest organism, because it could reproduce and therefore consume as quickly as possible, essentially eating its competitors out of town.

      Anyhow, just for safety's sake I will note here that the experiments hardly constitutes a disproof as they weren't really what is believed to have have taken place, and also because multicellularity is thought perhaps to be an unlikely evolution, but anyway thought you might like to know. I'm sure you can find the specifics with google, or I originally read about it in SA.

      Cheers.

      --
      Relax I just want some peanuts.
    252. Re:In unrelated news... by some+damn+guy · · Score: 1

      Religion has done a lot of good for humanity, and I think it gets scapegoated by people like Dawkins when we rightly should be blaming the people involved. Higher primates can be very nasty to their own kind, and this is can hardly be blamed entirely on religion. There is a lot of evidence that religion has brought people together and has helped to build large complex societies by providing a glue that might have otherwise kept people more divided along tribal lines.

      What we should hope for is not a world free of religion but a world where the religions have a more empirically accommodating world view, like the Buddhists do.

      People like Dawkins (and you I'm afraid) should know better than to spew hatred. This sort of thing just further inflames the ridiculous culture wars and creates more noise for more thoughtful, and constructive voices to have to shout over. I don't believe in hocus-pocus either but such either or treatment of something that has historically been of central importance to people lives creates unnecessary tension where we would benefit from more harmony.

      I urge people to read Nicholas Wade's excellent book on human evolution, Before the Dawn. In the age of genetics we are learning an amazing amount about our history. It is an incredible story that is simply awe-inspiring whether you are religious or not. It would be a shame if we turned our history, not American history, European history or African history, but this history of all mankind into a political football. We should not forget that this history is the story not only of our evolution, but also of our faith.

      I see your point, sir, but we would get farther if we questioned people's assumptions rather than their faith.

    253. Re:In unrelated news... by juuri · · Score: 1

      This was an excellent post. I hope more people read it.

      --
      --- I do not moderate.
    254. Re:In unrelated news... by DavidApi · · Score: 1

      No no no gentle friend.

      You're describing Lamarck's theory. Animals don't adapt to their environment. That's like saying giraffes stretch their necks (and so make them physically longer) to reach higher leaves. This extra stretch is then passed onto their offspring.

      Darwin says the opposite. Those giraffes that just happen to have a longer neck - to begin with, and through a random mutational change affecting their phenotype - are better able to take advantage of leaves higher up in a tree. They are more successful in staying alive & breed, and so are better able to pass these traits to offspring. Off course, there are evolutionary pressures to keep the neck short too. Shorter necks are better for running with - away from predators for example. So (simplistically), a compromise is reached between long and short necks.

      Cheers

    255. Re:In unrelated news... by fineghal · · Score: 1

      We came from apes. Apes came from monkeys. This is the kind of thing you normally hear from a creationist or pop culture, that tries to rouse our human superiority complex."That must we wrong. Humans are amazing! We couldn't have come from an animal.

      Humans did NOT come from apes. Apes and Humans had a common ancestor. This is an apparently subtle but important difference.
    256. Re:In unrelated news... by init100 · · Score: 1

      The problem is that macroevolution is the aggregate of thousands of steps of microevolution. The whole notion of microevolution but not macroevolution is absurd.

    257. Re:In unrelated news... by Anonymous Coward · · Score: 1, Insightful

      Do you think people thousands of years ago would be able to comprehend what we know now about the Big Bang and evolution?

      Yes. They were just as intelligent then as we are now but they didn't have the advantage of our relatively recently acquired scientific method. The scientific method is the best bullshit detector we've devised yet. Besides, an all-knowing and all-powerful creator god would have been able to impart that knowledge if it had wanted to do so.

    258. Re:In unrelated news... by rohan972 · · Score: 0, Troll

      Hebrews 11:1 ... faith ...

      one problem here being that like in law, the bible sometimes has particular ways of using words that are not the common use. In the context of the bible, faith is not "the thing you believe" it's "the thing spoken by God that you believe". Misinterpretations, errors and other religions are not described as "faith".

      So "... faith ... is the evidence of things which are not seen", when translated into common use of language, becomes "God saying something is evidence that it is so". Which, if you presuppose an omnipotent, omniscient God who creates everything by speaking, it follows that if God says something, if it's not true yet, it's about to be and can therefore be believed in spite of contrary evidence.

    259. Re:In unrelated news... by hogsWild · · Score: 1

      That's great. But it's still addressing a different question as to whether there is a God at the beginning of all of that 'soup' to say go. If there is a God who created everything, then He is outside of it all. The only way we could 'discover' Him would be for Him to somehow let us know.

    260. Re:In unrelated news... by Millenniumman · · Score: 1

      Doesn't that apply just as much to science, especially established scientific theories?

      The only reason you believe in the central concepts of science, and established theories, is because you grew up among people that do. What makes you think observable evidence tells you anything about anything? Even beyond that, what makes you think there are atoms? Did you see one? Maybe you saw a picture? Cause I bet you saw a picture of the power rangers too.

      --
      Stupidity is like nuclear power, it can be used for good or evil. And you don't want to get any on you.
    261. Re:In unrelated news... by nugneant · · Score: 2, Interesting

      If the vast majority believes something for long enough, it becomes the truth.

      Bullshit there, Dr. Epistilogics. The vast majority believed that the Earth was flat and that the Sun revolved around the Earth. Did that somehow compress the planet into a plane? Did it alter the workings of mass and gravity as we now know it? No? You mean even back in the middle ages, the Sun was still giant and the Earth was still relatively small, and the latter revolved around the former, and that both were basically round? It wasn't? Gee! So, basically, you're just huffing some killer dope and trying to sound educated? Go figure!
    262. Re:In unrelated news... by 75th+Trombone · · Score: 1

      I don't understand how evolution can be either proven OR disproven, as it deals with things that happened in the past and that therefore aren't now observable or falsifiable. It's half science, half history, and (imo) it deserves to be classified differently from all the other empirical theories that we can disprove at any moment if we come up with the right technology and the right experiment.

      --
      The United States of America: We do what we must because we can.
    263. Re:In unrelated news... by TapeCutter · · Score: 1

      Pity you were moderated as a troll, I belive your post is a genuine reflection of your opinion, (actually it's someone else's opinion but that discussion is best left for another post). I do agree with one point in your post, it is futile to attempt to (dis)prove god's existance, the question is irrelevant on all but a personal scale.

      "Evolution has been forced on and indoctrinated into youth today and yet these figures seem to show that young adults are growing up with a faith in a higher power. Interesting that no matter how much science you push on somebody, people still see the beauty and power that surrounds everything in the scientific world that is not definable by any empirical means."

      Try reading Unweaving the rainbow by Richard Dawkins (a rabid Atheist), the title comes from Keats accusation that Newton had somehow destroyed the poetic beauty of the rainbow with his prisims. Contrary to what Keats wrote, Newton's insights into the nature of light have inspired wonder for centuries and have given the poets more (not less) to write about. Like myself Dawkins despises this condesending attitude (held by many religious people) that posits it is the sole preserve of the faithfull to see, (and feel), awe inspiring beauty in the world that surrounds them.

      Similarly I despise the notion that science is out to crush the thrill of life by "looking behind the curtain". Science does not dampen the sense of "religious awe" you are eluding to, if this is your experience of science then you have missed the point. Science relies on, promotes and extends that feeling of wonder to other worlds that we didn't even know existed, it strips away unimaginative superstitions and confronts arrogant minds that cling to the false notion that: given a sufficent measure of "faith" philosphy can somehow define reality.

      "There is only one truth and being "open" to other ideas is completely contrary to having faith."

      An unwavering belief in one particular interpretation of one chapter in the Bible that runs contrary to the evidence of one's "god given" perceptions and logic is refered to as "dogma". It should not be confused with "faith in a higher power". Dogma is neither science nor faith, it is a cancer that attacks the mind and soul, robing it's victims of their "god given" curiosity to explore, delight in, and worship the mircale that we mere mortals call "the Universe".

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    264. Re:In unrelated news... by SEMW · · Score: 1

      There are a few logical inconsistencies with what you wrote Apologies; italics tag missed a bracket. Corrected version here

      if your axioms are consistent with each other (i.e. are self-consistent), then anything proven with those axioms is consistent with those axioms, and so is self-consisent. True.

      Now, mathematics does not state it is consistent or inconsistent, therefore, it is not inconsistent. Because, I mean, from the first thing I said, the axioms of mathematics are consistent, and so mathematics, which is not self-referential, is not inconsistent. When Godel talks about a set of axioms "including a statement of it's own consistency", he's rferring to whether it is possible to deduce, using only those axioms, that the axioms themselves are consistent -- in which case, by the theorem, they are in fact inconsistent.

      So, I think, the logical flaw in your argument is when you state "mathematics does not state it is consistent". This is something no-one has proved, and in fact, something that is impossible to prove, if I understand the theorem correctly. So it is impossible to prove that the axioms of mathematics are consistent, and so impossible to prove that mathematics is consistent.

      Godel implies nothing about the group of theories that we call mathematics ...Why on earth not? The theorems can be applied to "any consistent formal theory that proves basic arithmetical truths". The framework we understand as basic Mathematics (i.e. arithmetic) certainly seems to qualify.
      --
      What's purple and commutes? An Abelian grape.
    265. Re:In unrelated news... by Khomar · · Score: 1

      We came from apes. Apes came from monkeys. Monkeys came from lemurs. Lemurs came from rodents. Rodents came from some earlier mammal. That mammal came from reptiles. Reptiles came from amphibians. Amphibians came from fish. And so on. In fact, the biggest evidence of this IS embryology. Do some research on it some time. There's a reason human embryos have a tail, and are indistinguishable from nearly every other land dwelling embryo for quite a large amount of it's development.

      This is simply not true. There are no "leftover" organs from evolution. The "tail" is extremely important for balance among other things. Doctors are learning more and more about the importance of every single organ in the human body. Check out the link above for a very detailed discussion on the topic.

      It frustrates me that we Christians are so often criticized for our ignorance when there is just as much ignorance among evolutionists -- probably because of the poor excuse for education in America today. A large percentage of the evolutionary "facts" they teach in schools today have been disproven by evolutionist scientists decades ago, but these lies continue to be propogated. That is not to say that there is not still a lot of evidence that points toward evolution, but rather that creationists do not have a monopoly on ignorance and misleading "evidence".

      --

      I believe in de-evolution. God made the world perfect, man fell, and its been going downhill ever since!

    266. Re:In unrelated news... by Eternauta3k · · Score: 1

      They are stating a falsehood; whether they do so out of malice or wishful thinking has no bearing on the falsehood of the claim.
      Evolutionists are stating a falsehood; whether they do so out of malice or wishful thinking has no bearing on the falsehood of the claim.
      Maybe you need to open your mind.
      --
      Yeah. Would you choose a neurosurgeon who pokes around people's brains in his spare time? I wouldn't.
    267. Re:In unrelated news... by gordo3000 · · Score: 1, Insightful

      it probably looks strange because unlike almost every other major country, the US is hardly 1 demographic(the only other country like this is England in my opinion). India, China, S. Korea, Japan, are all very homogeneous countries with India being the least so(though, as high tech development in that country is limited to two or 3 places, the diversity of the entire country is unimportant).

      It wouldn't look nearly as strange to Europe if they realized that the US is larger than the combination of England, Spain, France, Germany and Italy. Its about par if you add in Portugal. Now look at the diversity across those countries and see if your surprised that people get arrested for disturbing the peace when handing out religious flyers at a gay pride meeting in england while abortion remains a very hotly debated issue in Portugal(and still, I think, illegal though there is a movement to change that).

      Now, take out the UK as a country with its own incredible diversity as I said above, and you can then add in about 6 smaller European countries. And still, the land area of those countries would be trivial in comparison to the US. Distance definitely breeds different opinions on issues.

      The real problem is people try to talk about the US in generalization because those same generalizations work well in a country with a much more homogeneous population(for example, the influence of the roman catholic church in Italy cannot be compared to the influence of religion in the US simply due to the diversity of Christian beliefs in the US ranging from roman catholics to southern baptists to Mormons to far more liberal groups).

    268. Re:In unrelated news... by Evilest+Doer · · Score: 1

      Most of them just use the tactic of saying things longer and louder than everyone else in the room and eventually people will believe you.


      In America this has worked.

      Well, I hate to say this, but shouting things again and again is what passes for debate in the States. People who try to explain things in a detailed and/or subtle way usually have people going "Boring!" or saying that you don't have strong beliefs.
      --
      I feel like death on a soda cracker.
    269. Re:In unrelated news... by init100 · · Score: 1

      The only difference between micro and macro evolution...

      ...is the timespan involved. Macroevolution is just an aggregate of thousands of steps of microevolution.

    270. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Laziness is thought to be a property of higher life forms since it gives them urgency to come up with explanations for "things as they are" which allows them to create/take "short cuts."

      Some feel the shortest cut is no cut at all,... but they're often perceived as too lazy, and sometimes branded as foolishly faithful when they pretend to an understanding of their faith.

      The final test for all (for me) is some golden rule equivalent as it has evolved.

      [very, very mild sarcasm early on, meant to fade to honest sense of co-humanity,... and empathy]

      warm regards in this adventure

    271. Re:In unrelated news... by baboo_jackal · · Score: 0

      Most of them just use the tactic of [modding down comments that don't agree with their political beliefs] and eventually people will believe you. [On Slashdot] this has worked.

    272. Re:In unrelated news... by adrianmonk · · Score: 2, Insightful

      Jeez. Semantics. The ability to adapt is a function of many things, not just genetics. My explanation was meant to be as simple as possibly, but it's not wrong.

      Apologies. What I meant to emphasize was that your explanation (being short) wasn't able to convey evolution exactly right. Not because your understanding is wrong or because you aren't good at explaining things, but because evolution has subtleties that are nontrivial to grasp.

      It's not immediately obvious how it could work considering that an individual's DNA can't change in response to the environment. It takes some deeper thought to grasp that, through breeding and mutation, the population's DNA makeup is shifting so that it explores the search space of DNA sequences (actually, the search space is broader than that in a way) and creates a mix that favors the sequences that are useful in its environment.

    273. Re:In unrelated news... by ChatHuant · · Score: 1

      Why stop at thousands of years? if the deity likes to plant false evidence, how about creating the Earth three years ago, and planting false memories in your head? Or three hours ago. Or three seconds. Anyone supporting creationism must support this argument too.

      Also known as Last Thursdayism

    274. Re:In unrelated news... by LordNimon · · Score: 1

      Doesn't that apply just as much to science, especially established scientific theories?

      No, it doesn't. With science, I can study the scientific method. I can read the research and reproduce the experiment. I can see for myself what the evidence is. I can think about the evidence and come up with the same theories.

      However, nothing I do or say will make God appear. Nothing I do or say will show me that the earth is truly 10,000 years old, or that man lived with the dinosaurs. The only source of information I have on Creationism is the bible, which was written by several people, many of whom had agendas, and has been translated and edited dozens of times before it came into my hands. In addition, the bible has many obvious contradictions, so therefore it cannot be considered an infallible text on its own right. Since it is impossible to believe in the entirety of the bible, one must use reason to decide which parts of the bible should be believed. Once you accept the possibility of ignoring parts of the bible that don't make sense, it's very easy to believe in evolution.

      --
      And the men who hold high places must be the ones who start
      To mold a new reality... closer to the heart
    275. Re:In unrelated news... by Clock+Nova · · Score: 2, Insightful

      And, of course, that's exactly what I meant. The word 'adapt' doesn't have to mean direct action on the part of the organism. If it's neck is longer, and it can reach the food, while the other one can't, it has "adapted" to fit its environment.

      --
      There they were, sitting in the van with all those dials, and the cat was dead. -V. Marchetti, CIA
    276. Re:In unrelated news... by gordo3000 · · Score: 1

      http://www.thearda.com/mapsReports/reports/US_2000 .asp

      a bit old, but this shows evangelicals are still about 2/3 of the catholic population. now as loudest and more arrogant goes, that's a different matter...

    277. Re:In unrelated news... by shaitand · · Score: 1

      'only monotheistic views as legit'

      Multiple beings are a possibility as well. Although that introduces greater complexity yet and is therefore even less likely.

      'Personally I wouldn't call you an agnostic, at all.'

      I prefer to stick with the dictionary myself. I also don't think one has to ignore the fact that the introduction of a creator makes for greater complexity in determining the origins of the universe and the more creators the more complexity therefore the less likely. Unlikely is not impossible. Unlike some I am satisfied to be aware of those facts without feeling some compelling need to arrive at an opinion or to choose a side.

      'No one got it right'

      Of course no one got it right. The odds of a man making up a creation myth that happens to match the truth out of the billions of possibilities are phenomenally poor. I am less sure of previous observances of gravity reoccurring upon the next experiment than I am of that one.

    278. Re: In unrelated news... by Dolda2000 · · Score: 1

      That is the beauty (or curse) of the Bible, almost everything in it can be interpreted in so many ways that you can disprove interpretations until the end of time.
      It could be argued that the vast majority of written material can be interpreted in virtually infinitely many ways, not just the Bible. However, few other works have seen any need to be so very re-interpreted as the Bible has. Interpret that as you will. ;)
    279. Re:In unrelated news... by init100 · · Score: 1

      but there are some holes in evolution just like there are some holes in creationism

      There ain't just "some holes" in creationism, the whole idea of creationism is simply one enormous hole. There isn't a single shed of evidence for creationism. The creationists don't care though, since it is based on faith, not science.

    280. Re:In unrelated news... by badenglishihave · · Score: 1

      This topic has turned into yet another religion bashing post. Nearly all the comments I have seen that support the non-evolution point of view have been marked as trolling. Hmm. Why is it that those who do not believe in the creation story have such a hard time accepting that other people believe it? And even more intriguing, why do I hear names like "stupid" and "ignorant" being tossed around? It seems to me that someone who is so "rational" and "in-tune" with the scientific world would calmly explain their point of view instead of lashing out against anyone who doesn't accept their theory.

      The best solution I can come up with is that it makes these people afraid. Afraid that their beloved science, their "facts" that they hold so dear, may be the very things to drag them down in the end. I can find no other explanation for it. Why sit around and waste your time telling these obviously delusional people that they are wrong? Instead you feel the need to spend a lot of time and effort attacking those who have a faith that you do not understand. There have been good pieces of scientific evidence that surfaced in this post. So you have to ask yourself: "Why do so many people believe this stupid idea that macro evolution is not fact and that the world was created in 'X' days versus 'Y' days, as science clearly tells us?" Well, think about this. How many scientific ideas have we been told are "fact" and yet only a few years later we see new evidence that proves our previously held ideas completely wrong? There have been many. Consider the structure of an atom, or the quantum versus wave view of particles. Theories on both of these subjects (and many more!) have been tossed back and forth for centuries, but we still have much to learn and discover about them.

      But I digress. There is an underlying issue here. Why is it that as soon as someone rears their religious head, everyone is so quick to tear them down instead of constructing a sound argument about why they believe there ISN'T a God and a creation? I find it highly amusing that it is found "alarming" that many people believe the earth was created in 10,000 years. So what if they do? I myself am inclined to believe scientific evidence. Sure, why not, right? I don't care what scientists find. Just because the world appears 2.5 trillion years old (or maybe 2 billion, or 1 million, or 20,000 for all I care) does not mean there is no God. Just because I have an alternative belief does not mean I am ignorant. I highly respect that 48% that reject evolution as fact, not because they are necessarily religious but because they realize that they do not need to accept something just because it is popular. Stand up for what you believe and get stoned; I guess it's as true in Bible times as it is nowadays at /. .

    281. Re:In unrelated news... by nuzak · · Score: 1

      > I don't believe in organized religion, but I don't have the hubris to claim that my beliefs are not faith based.

      Unlike the case with religious faith, scientists are still looking for the answers to these questions as opposed to claiming they already have them (let alone making up new phenomena like "souls" to justify them)

      --
      Done with slashdot, done with nerds, getting a life.
    282. Re:In unrelated news... by exp(pi*sqrt(163)) · · Score: 1

      Higher primates can be very nasty to their own kind, and this is can hardly be blamed entirely on religion.
      Oh right, your argument is that humans are nicer than primates, humans have more religion than primates, therefore religion makes people nicer. I'm not sure that needs any effort to debunk.

      Here's a far more convincing difference: humans are much better than primates at tracking complex sequences of events and make better projections of the outcomes of those events. So humans can make much more complex agreements that sacrifice short term gains for much larger longer term benefits. Like "I could just whack you over the head with my club, but instead I'll swap these nice soft sheepskins for your arrowheads and meet you here next full moon to see if you have any more stuff to swap". Because humans can enter into these complex and long-term non-zero sum games humans have much more to gain from being civil than other primates.

      Religion has rarely offered anything that a bit of enlightened self-interest didn't have to offer.

      --
      Doesn't it make you feel good to know that our freedoms are protected by politicans, lawyers and journalists.
    283. Re:In unrelated news... by hyperquantization · · Score: 1

      Check the dictionary. Love isn't just a noun, it's a verb. Too many people seem to lose touch with how deep the meaning of love can be. But that follows suit with how shallow and narrow-minded our culture has become, much to the chagrin of people in the past who tried to eradicate such things through education. Dare I say today's belief system based upon the all-insightful Science has something to do with that? After all, science wasn't meant to be a replacement for God, just a way to define His creation. In fact, it's been suggested that relying upon Science requires no less faith than relying upon the Bible--I'm inclined to agree.

    284. Re:In unrelated news... by Anonymous Coward · · Score: 1, Informative

      Humans did NOT come from apes. Apes and Humans had a common ancestor. This is an apparently subtle but important difference.

      What you probably meant is that no current living ape looks much like our ancestor from say, seven million years ago. That's probably true, but it doesn't mean it wasn't an ape. Not only did we come from apes, we *are* apes. Our common ancestor with chimpanzees lived before our common ancestor with gorillas, so chimpanzees are actually more closely related to us than are gorillas.

      This means that there is no sensible biologically-based way to define the word "ape" that excludes us. Saying we are not apes would be like saying that birds ought to be defined as any feathered flying thing other than an eagle. An eagle and a hawk have a lot more in common than either do to a pigeon.

      The fact I cited above about chimpanzees and humans has been proven by DNA evidence; if you dispute that, you might as well forfeit the use of DNA evidence as a diagnostic tool for any purpose.

    285. Re:In unrelated news... by notnAP · · Score: 1
      Evolution is easy to grasp in it's simplest form - your oversimplification is a good example.


      The aspects of evolution which are difficult to grasp for are the things that Intelligent Design proponents push. It takes millions and millions of microscopic changes to make a macroscopic difference. The eye cannot just appear as one fluke evolutionary change. Flight wasn't a one step process. The process that allows for their development are not intuitive at all for the same reason that people cannot comprehend the true size of the solar system, let alone the universe.(1)


      It's the concept of millions and millions that most people find unintuitive. I submit state lotteries as proof.


      (1) reference Douglas Adams and the walk to the local chemist.

    286. Re:In unrelated news... by nuzak · · Score: 1

      Not so fast ... the current pope is a fan of Intelligent Design: http://www.msnbc.msn.com/id/10007382/

      --
      Done with slashdot, done with nerds, getting a life.
    287. Re:In unrelated news... by init100 · · Score: 1

      the question evolution fails to answer and which makes it counterintuitive is "Where/How/When did it all start"

      Evolution does not deal with the origin of life. It rather covers how life have evolved from the first instance of life and onwards.

    288. Re:In unrelated news... by GeffDE · · Score: 1

      There is no logical flaw in that argument. The theorem states that a formal theory is inconsistent if and only if it says something about its own consistency. The axioms of mathematics do not do this; this is why Bertrand Russell famously tried to throw them out in the search for a provably complete and consistent theory of arithmetic. Godel's Theorems proved it was impossible to do this. It is possible to prove that the axioms of mathematics are consistent because its axioms do not contain any references to their consistency. And I do believe that the 2nd theorem can be applied to mathematics; however, it says nothing about math because, well, it contains no statements about its consistency. Whoops. Again.

      --
      It has been a nervous year, with people beginning to feel like Christian Scientists with appendicitis.
    289. Re:In unrelated news... by Anonymous Coward · · Score: 0

      That's not a strawman. It's reductio ad absurdum.

      The idea that we reject what we have repeatedly and consistently observed to be true, and instead believe that God is messing with us, planting false "evidence" to throw us off the trail, is absurd and utterly unhelpful, since it means we shouldn't believe *anything* at all.

    290. Re:In unrelated news... by myyrk · · Score: 1

      Are you talking about only the part that deals with humans and how they evolved or are you talking about evolution in general? Because evolutionary thought deals with much more than just humans.

    291. Re:In unrelated news... by transporter_ii · · Score: 0

      I don't think that it's faith that scientists go on; it's probability. We simply accept what is likely to be true based on evidence already collected and analyzed.

      Well, I think we can both agree that animals adapt to their environment and improve both themselves and their offspring to thrive in said environment.

      But I would disagree that scientists go on probability. The odds that cells improved, joined together and then turned into what we see today, are astronomical.

      Now this doesn't prove the existence of God. For all we know, a UFO could have come down and seeded the earth. But it does prove that scientist take a lot of things on faith. I will stand by my former "flambait" on this: if someone walked in out of the desert and had never heard of Darwin, they would not look at the scientific evidence we have now and come to the conclusion that man evolved from cells on rocks. And funny, a lot of people will say that man evolved from apes, but if you start asking them about cells on rocks turning into monkeys, they usually start to have a lot of doubts, as any logically-thinking person should.

      --
      Doctors destroy health, lawyers destroy justice, universities destroy knowledge, religion destroys spirituality
    292. Re:In unrelated news... by Evilest+Doer · · Score: 1

      Doesn't that apply just as much to science, especially established scientific theories?
      The scientific method produces measurable, testable results. And yes, atoms have been seen using special equipment see this for example. Conflating belief in religion and "belief" in science is like conflating belief in religion and "belief" in proper methods of home repair. I'm a religious man myself (though certainly no fundie), but your ignorance of what science is is appalling.
      --
      I feel like death on a soda cracker.
    293. Re:In unrelated news... by rohan972 · · Score: 1

      Uh, too bad evolution is about how life is changing, and completely unrelated to how life started

      Without life starting there is nothing to evolve. Surely refusing to consider how life started when discussing evolution is not good. People who agree with evolution think it's a good point (+5 informative?), people who believe creationism can laugh (hey look, he's avoiding the issues he can't answer, ha ha, silly evolutionists) and people who aren't sure are left with vocal creationists and people who refuse to talk.

      Avoiding the issue is not a way to make a convincing point.

    294. Re:In unrelated news... by init100 · · Score: 1

      Even the greeks knew the earth was round.

      Not to mention the egyptians. They even managed to compute the circumference of the earth with an astonishing precision.

    295. Re:In unrelated news... by Xyrus · · Score: 1

      Indeed, ignorance is an equal-opportunity employer.

      ~X~

      --
      ~X~
    296. Re:In unrelated news... by Millenniumman · · Score: 1, Insightful

      No, it doesn't. With science, I can study the scientific method. With power rangers, I can watch the show.

      I can read the research and reproduce the experiment. I can see for myself what the evidence is. First of all, there is no way of verifying that what you see indicates reality. There isn't really any reason to believe it is, except that most people do to some extent. Second of all, it is not possible for anyone to do all the experiments and gather all the evidence to indicate any complex theory is correct.

      I can think about the evidence and come up with the same theories. Once you accept a lot about power rangers, the rest makes sense. Woohoo.
       

      However, nothing I do or say will make God appear. Nothing you say or do will make bacteria become humans before your eyes.
       

      Nothing I do or say will show me that the earth is truly 10,000 years old, or that man lived with the dinosaurs. Nothing you say or do will show you that the earth is billions of years old. Any evidence you can gather to that effect will be based on accepting a lot of what others have said.
       

      The only source of information I have on Creationism is the bible, which was written by several people, many of whom had agendas, and has been translated and edited dozens of times before it came into my hands. There are more sources of scientific information, though I'm not sure what that proves, but they are also written by many people with agendas.
      --
      Stupidity is like nuclear power, it can be used for good or evil. And you don't want to get any on you.
    297. Re:In unrelated news... by Oligonicella · · Score: 1

      Um, no. Macroevolution is a term used by creationists to be able to move goalposts. Found a new species? Just ask for examples at the genus level. Repeat as needed to sustain disbelief in evolution.

      Evolution is the change in living organisms over time. Ta, da. The evidence is that this is a predominantly gradual process and has left a very well documented trail as to the manner in which it has occurred.

    298. Re:In unrelated news... by hogsWild · · Score: 1

      Widely accepted doesn't mean it is correct. It could be, but it might not be either. It is a theory, in science that means an idea supported by evidence, not an indisputable fact. Many theories are held for long periods of time until other evidence comes along later that leads to a new theory. Sometimes the new evidence disproves the old idea, sometimes it doesn't. But theories are created so the scientific community can compare new evidence to it, then alter the theory as appropriate. The original question has two parts, 'Is evolution well-supported by evidence AND widely accepted within the scientific community?'. You can harp on the second half all you want, but since evolution is still a theory, and there are other theories out there that do have valid evidence, then it is logical to disagree with the first half of the question and become part of the 48% that /. can look down upon. Scientists and others can have the same problem that religious folks do. They become so attached to their theories, maybe they spent their life's work researching it, that they can't let go of it and ignore other valid evidence. Our country's science education could benefit more by including other, maybe lesser known or less supported, theories. It would be better for the students to look at the different alternatives and decide for themselves based on the evidence. Much better than showing only evidence to support one theory. In a non-politically correct world, this would also be a good approach regarding religion. But the schools mainly choose to pretend religion doesn't exist at all.

    299. Re:In unrelated news... by Blakey+Rat · · Score: 1

      Wow. You live in a dark, dark, depressing world if that's all you think there is to the world.

    300. Re:In unrelated news... by Lord+Crc · · Score: 1

      The fact that you have just explained it in a way which is subtly wrong supports the idea that it is counterintuitive. An animal does not adapt. It is born with a certain set of DNA, which it cannot change or control, and it lives or dies as a result what DNA it has (along with other factors like chance).

      Most organisms don't express all of their genes all the time. They got regulating mechanisms which responds to it's current state and the environment. So in that case I would say it's perfectly possible that one organism can adapt, since it's regulatory mechanisms could mutate and thus respond to some external cue, allowing the organism to survive while it's "brother" dies.

    301. Re:In unrelated news... by nuzak · · Score: 1

      Evolution is the term given to "Macroevolution" or evolution on a large scale, involving creating new species that cannot interbreed, and that is what is disputed in the religious world.

      Frankly, Evolution is the term most people give to that timeline-drawing showing a blob in the water on the left, going to fish, lizard, chimp, homo erectus, then finally homo sapiens sapiens on the right (and often, adds a guy hunched over a computer keyboard as a punchline). It's a poetic statement, but it's hardly an accurate picture.

      Speciation happens through microevolution, and usually there's no clear dividing line where one species is formed that cannot interbreed with its predecessor. Only the hardcore fundies require the belief that an evolutionary line goes "pop" and there's suddenly a new species, and only so that they can deride it. Why they can't accept that "God makes 'em go pop" is sort of beyond me, but ultimately it all speaks to motives rather than honest inquiry.

      --
      Done with slashdot, done with nerds, getting a life.
    302. Re:In unrelated news... by hobo+sapiens · · Score: 2, Insightful

      Appreciate the response. Not sure if I should talk your post as condescending or humorous/informative, so I'll choose the latter. I wasn't sure what I'd get from saying what I did. A flamebait mod evidently, but there are lots of Morons With Mod Points out there. I was not trying to say anything inflammatory. I guess you're not allowed to question groupthink.

      Anyhow, I digress.

      I understand the scientific method and how peer review works and so forth. What you say makes my point exactly, though: I don't think anyone is questioning the basic tenets of macroevolution. I don't work in the field, so I don't know with any certainty. I'm just a regular programmer type guy. Just guessing based on what I read here. Every time I read a discussion here on /. on the topic, I see about ten comments that say something to the effect of "Evolution is an unimpeachable fact". When I see statements like that I start to wonder if science is taking place anymore.

      I think the scientific method is one of the best detectors of rubbish-disguised-as-truth there is. All I am saying is that I hope it's being adhered to. I hope people don't blindly push evolution like some people blindly push religion.

      --
      blah blah blah
    303. Re:In unrelated news... by SpinyNorman · · Score: 1

      Good grief! As an ex-Brit living in the US who's considering relocating back to get away from this type of ignorance, that's pretty disheartening.

    304. Re:In unrelated news... by dannywahlquist · · Score: 1

      Having been an observer of evolution teaching for 40 years, it takes more faith to believe in something that constantly changes, than to believe the God of the Bible created the universe as He said a few thousand years ago.

    305. Re:In unrelated news... by Oligonicella · · Score: 1

      "Truth and fact are two seperate ideas. They can very well be mutually exclusive."

      truth, n., pl. truths.
      1. the true or actual state of a matter: He tried to find out the truth.
      2. conformity with fact or reality; verity: the truth of a statement.
      3. a verified or indisputable fact, proposition, principle, or the like: mathematical truths.
      4. the state or character of being true.
      5. actuality or actual existence.
      6. an obvious or accepted fact; truism; platitude.
      7. honesty; integrity; truthfulness.
      8. (often cap.) ideal or fundamental reality apart from and transcending perceived experience: the basic truths of life.
      9. agreement with a standard or original.
      10. accuracy, as of position or adjustment.
      11. Archaic. fidelity or constancy.
      12. in truth, in reality; in fact; actually: In truth, moral decay hastened the decline of the Roman Empire.

      Can you point out the definition where truth and fact can be mutually exclusive?

    306. Re:In unrelated news... by nuzak · · Score: 1

      Rene Descartes based his epistemology on the fact that he just couldn't stand that he didn't have a soul, so he decided to start over again with the assumption of a soul in mind. Being exceptionally smart just made his lame justifications all the more loquacious.

      --
      Done with slashdot, done with nerds, getting a life.
    307. Re:In unrelated news... by hogsWild · · Score: 1

      Good point, and since you would never know if God really did that, it is an irrelevant argument. You are arguing that any creationist supports the idea that God is all powerful and can create things the way He wants to. I think they'd all support that idea.

    308. Re:In unrelated news... by notwrong · · Score: 1

      Some might say dinosaurs became extinct X years ago, where X is a number greater than 10 000. This is proved by there bones and carbon dating etc. My question is, why exactly couldn't the 'diety' have created the earth with dino bones burried in the earth. Maybe he just happened to know they would be useful for fuel or he wanted to give some geologist something to do or Y (where Y is some other reason).

      It is logically possible that, if a deity created everything at some point in the recent past, they could have created things such that they look much older. This does not make it likely, and more to the point, does not make it testable. There are an infinite number of reasons that can be invented to explain any phenomena. Some people find it desirable to be able to have a better way to choose from among the available explanations than "the one that prevents me from having to re-evaluate what I already believe". Science is one such, very successful, methodology. It requires us to make testable (or more precisely, falsifiable) predictions if our explanations are to be assessed. It also means we must be ready to change our minds if the evidence requires it.

      I'm not a scientist or high level scholor, but there are some holes in evolution just like there are some holes in creationism, but saying that just because there is some evidence to support evolution doesn't mean that creationism is bunk either.

      Can you name some of these "holes" in evolution as the underlying theoretical framework that all of the rest of biology fits into? There are always details in any theory that are incomplete, but I am sure the scientific community would be very interested if you can point to some evidence you're aware of that falsifies evolution.

      You are mostly right in saying that creationism isn't bunk just because there is some evidence to support evolution. Creationism is bunk all on its own. There is abundant evidence that falsifies pretty much all of its claims (such as the age of the universe/Earth, the fossil record, geological evidence against a recent global flood). The situation is not so much that evolution and creationism are two decent explanations for the life we observe, each with its own flaws; instead evolution is the only known explanation that fits the evidence, and creationism is a bronze-age hangover that, according to TFA, blocks 48% of Americans from realising this.

    309. Re:In unrelated news... by Evilest+Doer · · Score: 1

      instead of a metaphorical work constructed by comittee from parchments written (in some cases) hundreds of years after a man called jesus christ lived.
      Not to quibble too much, but the books of the old testament were compiled about 5 to 6 centuries before Christ and the books of the New Testament, while not *compiled* until around the fifth century (the Council of Nicea (sp?) to be exact), they were written not long after the death of Christ. Well, except maybe for the Gospel of Luke, but that is because Luke's Gospel was the result of research and not a contemporaneous accout, a fact which the beginning of the Gospel of Luke states.
      --
      I feel like death on a soda cracker.
    310. Re:In unrelated news... by mclaincausey · · Score: 1

      Matter AND energy. The matter is inert without electro(chemical) activity.

      --
      (%i1) factor(777353);
      (%o1) 777353
    311. Re:In unrelated news... by nuzak · · Score: 1

      > We came from apes. Apes came from monkeys.

      ARRRGH no we did not. Apes came from monkeys. Our ancestors came from monkeys. We are siblings to modern apes, who I guarantee are quite adapted in ways we're not.

      --
      Done with slashdot, done with nerds, getting a life.
    312. Re:In unrelated news... by dlthomas · · Score: 1

      When I said that it is something that evolution can't explain, this is not indicative of flaw in the theory, in the way that it would if, say, human skeletons were found dating from the Jurassic. It is simply outside the scope of the theory. The fact that gravity tells us little about the burning of gunpowder doesn't detract from it's accuracy in predicting the path of a bullet once it's left the gun. The theory of evolution makes verifiable predictions about what we expect to see in the world around us, both on the micro-level where we can actually do experiments as well as the macro-level where we've on many occasions thought to look for something or question the accepted view because we'd predict evolution to lead to a different outcome - and this is typically borne out (color vision in bees, for example). Saying evolution hasn't been going on for the past many millions of years leaves you with a lot of evidence to explain away. We do not take *evolution* on faith. Now, given evolution, the question still stands how life came to be. At this point, I need to add the caveat that I am speaking from my present understanding of the science, and may well be missing recent developments, but it does reflect my own "beliefs" and I would assume those of others. The state of our scientific knowledge of the world is always expanding - that's what science does. Presently, there is not much in the way of evidence as to *how* life, prior to evolution, came to be. This does not mean, however, that it is a matter of faith to say that life *did* come to be. Look around. We are. There are a number of theories. To choose one would be faith - be it God, or chance, RNA-world type theories, or an interesting notion involving evolution between forms of mud which I recall reading about. There isn't enough evidence to make a determination. What evolution *does* do - in our explanation of life as we know it - is provide a way of getting from any of those starting points to where we are today, and it leaves a lot less explaining to be done.

    313. Re:In unrelated news... by Manchot · · Score: 2, Informative

      If you believe in something, then at least stand by it. If you can't or won't stand by it, then why do you believe in it?

      The Catholic Church has never believed in a literal interpretation of the Bible. As the entity which basically created it, why should it? It would be like me writing down an instruction manual for a product and then claiming that whatever the manual says must be true, even if I know parts to be false. No, the Church's main source of "divine knowledge" comes from the papal lineage, and has done so since it was founded.

    314. Re:In unrelated news... by louzerr · · Score: 1

      BING!!!

      Let's see, if you can't measure it, what good does scientific method do us here?

      See, that's what science is, a method. Once people start "believing" science, rather than "using" science, THAT's where we run into trouble.

      I believe in God. Science is just one of many tools I use to learn about Him.

      --
      "The large print giveth, and the small print taketh away" -- "Step Right Up", Tom Waits
    315. Re:In unrelated news... by nuzak · · Score: 1

      > Not really. I have several Jesus freak and/or Pentecostalist acquaintances who believe the earth is 4,000 years old

      That doesn't even account for all the time in the Bible. Unless they believe Jesus was born yesterday. Are you sure it's not 6,000?

      --
      Done with slashdot, done with nerds, getting a life.
    316. Re:In unrelated news... by Karthikkito · · Score: 1

      A falsehood "becoming the truth" doesn't mean that the actual facts or data change. However, it DOES mean that what's accepted as the truth changes when the falsehood is perpetuated for long enough. So no, the earth didn't compress into a plane -- but people certainly believed that it did and based their actions on that belief. Likewise, the longer and more pervasive this "anti-evolution" movement becomes, the more likely it becomes that someone trying to "choose" between the two will see creationism/ID as the truth...even if it's not.

    317. Re:In unrelated news... by Millenniumman · · Score: 1

      The scientific method produces measurable, testable results. Measurable how? What in the world makes you think your apparent measurements show you anything about reality? Because you have grown up with that as an universally accepted idea?

      And yes, atoms have been seen using special equipment see this for example. Power rangers have been seen with special equipment, also. Ooh, but your special equipment is sciency and at MIT. And maybe you understand how it works based on what other people have told other people have told other people (ad nauseam) have told you.

      Conflating belief in religion and "belief" in science is like conflating belief in religion and "belief" in proper methods of home repair. That there is a broken analogy. Science (working towards greater understanding) is very different from home repair (working towards a solution to a problem).

      but your ignorance of what science is is appalling. I know what it is. You don't seem to.
      --
      Stupidity is like nuclear power, it can be used for good or evil. And you don't want to get any on you.
    318. Re:In unrelated news... by Evilest+Doer · · Score: 1

      If the real world was anything like public school, we'd all be in trouble.
      Here! Here! Public schools in the States are more like prisons than anything else. Also, one advantage of homeschooling (at least for the non-fundie homeschooled) is that the homeschooled children tend to be *more* sociable since they do not feel restricted to interacting only with children who are within a year of age difference.
      --
      I feel like death on a soda cracker.
    319. Re: In unrelated news... by Dolda2000 · · Score: 1

      Only 51% of physical scientists believe in any form of Darwinian evolution.
      But what about the virtual scientists, then? I think you're being pretty narrow-minded to just exclude them from your data!
    320. Re:In unrelated news... by mclaincausey · · Score: 1

      1: The existence of God is proven (or disproven) definitively to every dead human being.
      How can you prove or disprove something to inert, decaying tissue that lacks any sentience (i.e., a corpse)? You can't prove anything to inanimate objects. I can't prove to my television that I hate Bud Light commercials, no matter how many times I change the channel.


      2: You cannot prove that yesterday happened; are you calling my Big Mac imaginary? I cannot prove you exist; are you calling /. imaginary?
      You don't have to "prove" it, if you can come up with a framework that falsifies the existence of the past, then the past will be rejected.


      3: If you can't even be bothered to understand the basic context of the word "imaginary" -- that is, "intentionally conceived without basis in reality" -- then you shouldn't use it. When you say that God is imaginary, you are implying that everyone who believes in God is intentionally stating a falsehood, which there is zero support for. The correct term you're thinking of is "false" or "wrong", which have the proper connotation of earnest belief but incorrect result.)
      No, "imaginary" works fine: "fanciful: not based on fact; dubious." Just like a kid with imaginary friends. Or you could use the sociological definition of the word: "matrix of ideological meaning common to a social group."
      --
      (%i1) factor(777353);
      (%o1) 777353
    321. Re:In unrelated news... by SRA8 · · Score: 1

      Fundamentalists in the South are also adept at the political process. They start right from the school boards. So while scientists think that the truth will convince people, they are running for school boards, winning, and chocking off opposition to Intelligent Design. Face it, the truth doesnt work these days. The Religious Right has hijacked the political system and its paying dividends.

    322. Re:In unrelated news... by asilentthing · · Score: 1

      Frankly, even the rabidly fundamentalist anti-evolution junkies are aware that evolution is widely accepted in the scientific community.

      It's interesting that Newsweek seems to have posed a question the forces the surveyed to respond to two conclusions (Evolution being supported by evidence and it being widely accepted in the scientific community) with one answer - either agree or disagree. Even more interesting is that people were dumb enough to let them pose a question like that. Having grown up in a fairly conservative Christian culture, I'd say it might be more accurate to say many fundamentalists believe that there are many holes in the theory of evolution but understand it is well-accepted in the scientific community.

      --
      --- these days, what with business and stuff, you gotta get your emails...
    323. Re:In unrelated news... by NMerriam · · Score: 5, Informative

      I don't understand how evolution can be either proven OR disproven, as it deals with things that happened in the past and that therefore aren't now observable or falsifiable.


      Evolution, like all scientific theories, makes statements that can be used as predictors for future discoveries, even though the process in question happened in the past.

      If evolution says that some specific sequence of events is impossible, then finding any evidence that those events occurred would instantly disprove the theory. There are numerous things that could be discovered at any moment that would call into question the most fundamental aspects of evolution, yet in nearly two centuries no evidence of the sort has been found.

      Conversely, evolution says that many things pretty much must have happened a certain way to get from point A to point B, and that is prediction. It has in fact happened that scientists have had fossil A and fossil C, but no luck in finding the presumed to exist fossil B. By using the principles of evolution they've determined where the most likely place to find fossil B was -- and found it!

      It should also be noted that evolution predicted (in fact REQUIRED) the existence of DNA (or something similar) a century before it was actually found -- indeed, when evolution was first discussed the very lack of something like DNA was one of the biggest criticisms against it. The notion that ALL life on Earth including plants and animals shared some fundamental building block that was completely unknown, eons old yet randomly changeable for no discernible reason, was considered absurd by many. Watson and Crick did more to confirm the accuracy of evolution than almost any other group in the 20th century.
      --
      Recursive: Adj. See Recursive.
    324. Re:In unrelated news... by socerhed · · Score: 1

      It always amazes me to hear people talk about how "religious zealots" have to be wrong and that they have no understanding of science. Yes I am a Christian and yes I believe in creation. However I also read Slashdot because I want to keep current in the newest scientific ideas. I don't believe in God because my parents do or because I live in Southeast America. I believe in God because, in my opinion, there is an abundance of information that points to not only creation but also a young Earth. Evolution however is held together with loose ideas and bad science. I'm open to discussions about religion and science however, as so many people on here claim about us "religious zealots", as soon as I start a discussion the other person just dismisses me saying that I'm closed minded.

      In case your wondering about what evidence I'm talking about, I'm referring to all the evidence for a world wide flood(petrified upside down forest, the idea of the Grand Canyon being formed in a day), the lack of lunar dust, and the speed of the Earth's rotation. Those ideas are the more scientifically oriented ideas. The bad science I would be referring to is the utter reliance on flawed Carbon dating, using Murchison's meteorite, and just the fact that science can't even come up with an even half believable theory on how everything came to be.

      Now here is your chance to decide whether or not you want to make cheap shots at a so called "religious zealot" or actually say something worth discussing.

      --
      LostHobo.com
      Soup Kitchen of the Internet
    325. Re:In unrelated news... by oztiks · · Score: 1

      I remember a Jay Leno episode not so long ago where he was asking religious questions on the street.

      The question "when did Jesus die?" people said 200 years ago, 450 years ago .. one person said 250 million years ago.

      Need i say more :)

    326. Re:In unrelated news... by servognome · · Score: 1

      Observations are fact, and fact is also truth.
      Observations are trivial truths, and such truth only exists for the observing individual.
      They meaningless until they are incorporated (whether to prove/disprove/develop) into some sort of theory.
      --
      D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
    327. Re:In unrelated news... by Anonymous Coward · · Score: 0

      My defence against the bible is, do you think an angle coming down 10,000 years ago could just explain the milions of complicated systems god used to create the earth (big bang, dark matter, evolution, the 7 dimensions of quantum space...) to a guy who would then repeat the story to his children and so on for a hundred generations... or do you think that actually, it might just be a story which gives the basic idea that god created everything in a way people could understand.

    328. Re:In unrelated news... by bitingduck · · Score: 1

      If a programmer wants to create a construct, he sits down with a piece of paper (or whiteboard), charts out what he wants it to do, and writes some code, hopefully (if he has any training) in a nice, orderly manner. If he's any good, he makes it modular and separates concerns so that (say) code for the GUI is not mixed in with code for the filesystem.

      Kinda like this?

      You can't start from a box of blocks and program up a person yet, but you can certainly customize some E. coli, or order up a modified virus (or build a simple one up from scratch), and that starts out with sitting down and scribbling out a bunch of genetic code. IGEM (linked above) is about developing a kit full of more or less plug replaceable tools and documenting the hooks that they have, much like a software library.

    329. Re:In unrelated news... by SEMW · · Score: 1

      The theorem states that a formal theory is inconsistent if and only if it says something about its own consistency. The axioms of mathematics do not do this Sorry, but you haven't proved that (and neither is it possible to). You seem to be saying that a set of axioms is inconsistent if and only if it actually explicitly proclaims its own consistency in the axioms themselves (!). This is obviously untrue; e.g., I could take the basic axioms of arithmetic and add on one which contradicts it (e.g. "2=3"). This will then say nothing explicitly about it's own consistency in the literal sense, but will be inconsistent nevertheless; and by Godel 2, it would be possible to *directly deduce* from that set of axioms that they are consistent -- and thus, prove that they are not consistent.

      Quite obviously, the basic axioms of mathematics do not include an "Axiom X: These Axioms Are Consistent". But that doesn't mean that someone has proved that there is no possible way to deduce from the axioms that they are internally consistent. And, in fact, it is impossible to do so.

      this is why Bertrand Russell famously tried to throw them out in the search for a provably complete and consistent theory of arithmetic. That makes no sense. Modern axiomatic set theory, on which the fundamental axioms of arithmetic etc. are based, was developed after Russell. Indeed, it was developed quite a lot in response to Russell (who pointed out some flawes in the old system).
      --
      What's purple and commutes? An Abelian grape.
    330. Re:In unrelated news... by Anonymous Coward · · Score: 0

      >With power rangers, I can watch the show.
      Which is EXACTLY his point about just passively absorbing your information from one source. Because then he says "I can read the research and reproduce the experiment. I can see for myself what the evidence is." which is something you cannot do if you are relying on a revealed source (e.g. the bible, revealed by God to the prophets).

      The only thing you can come up with is:
      >First of all, there is no way of verifying that what you see indicates reality. There isn't really any reason to believe it is, except that most people do to some extent.

      Do you REALLY mean that or are you just diving for cover. This is as pathetic as the "God put the fossils their to test our faith" or "God only made the world LOOK like it is 5 billion years old" arguments. If you don't believe that your senses aren't giving you a pretty good idea of reality, get checked out.

      I was going to argue the rest, but I'm bored now. It's lunchtime, and the kids are hungry. Me too. If only some loaves and fish would magically appear...

    331. Re:In unrelated news... by @madeus · · Score: 1

      I find it disappointing how many people miss that love is a series of chemical reactions, or are uncomfortable discussing it as such.

      Though I suspect it's also true majority of people (in most countries) believe in 'life after death', as if you don't lose neurons as you get older (which we know to be the case) but they really go off to some sort of alternate dimension, and the rest of your brain is re-united with them when you eventually pass on. Or maybe they you only take with you what you have when you die (and Heaven is filled with confused old people who don't know who or where they are).

      It seems major religions are very much in denial about the physical aspect of the mind, particularly when it comes to things like love and death.

    332. Re:In unrelated news... by servognome · · Score: 1

      Can you point out the definition where truth and fact can be mutually exclusive?
      There are different types of "truth".
      The fact that I observe the sun rise then float across the sky (like a balloon) is truth, however, the "truth" is the sun isn't actually physically moving in that manner.
      Facts are always true, however, we don't always understand facts enough to put them in the correct context for overall truth.
      --
      D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
    333. Re:In unrelated news... by Evilest+Doer · · Score: 1

      Measurable how? What in the world makes you think your apparent measurements show you anything about reality? Because you have grown up with that as an universally accepted idea?
      So, you don't believe your car's speedometer when it tells you your speed relative to the road? It would seem here that you are not only denying evolutionary theory, but all scientific knowledge as well. Or perhaps you don't believe in reality?


      Power rangers have been seen with special equipment, also. Ooh, but your special equipment is sciency and at MIT. And maybe you understand how it works based on what other people have told other people have told other people (ad nauseam) have told you.
      That has got to be one of the dumbest things I have ever read on slashdot. I understand how it works not just because someone told me, but because I have used optical measuring equipment and understand the principles involved in measuring extremely small objects like atoms (I do have a degree in physics and a doctorate in electrical engineering). If you don't believe laser measuring equipment works as it does, then you must not believe that modern technology even exists!


      That there is a broken analogy. Science (working towards greater understanding) is very different from home repair (working towards a solution to a problem).
      My rather obvious point was that science does not require a belief. Science only requires practice, study and observation (well, and tons of coffee, but I digress).


      I know what it is. You don't seem to.
      Ha! You remind me of one of my students (back when I taught). Upon failing his exam and not understanding in the least why he got anything wrong, he boldly declared to me "I know physics!" He didn't and he didn't do very well.
      --
      I feel like death on a soda cracker.
    334. Re:In unrelated news... by onlyfacts · · Score: 1

      Exactly. "(with modifications)" - meaning, once it gets falsified, just chanage the premise and start over again. How many times do you get to falsify a theory before it is no longer true? Supposedly the key evidence for evolution would be when you have a continguous fossil record showing the actual traces of evolution from one species into another - never even close to having shown to happen and when they finally gave up on this idea they produce something really insane to "fix" their theory - Punctuated equilibrium - wow a species that appears out of nowhere with no history - sounds like you need a lot of faith to believe that. I don't have enough faith to believe in evolution - just give me the facts.

    335. Re:In unrelated news... by Anonymous Coward · · Score: 0

      http://en.wikipedia.org/wiki/Literacy#Illiteracy

      Americans continue to have an absurdly low literacy rate, and at those low levels it's unreasonable to even suggest the population is educated. There is just enough cream at the top, largely from families imported from Europe, to glue the country together. And just enough absolute rubbish at the very top, like, say, Bush, to reduce the quality of the world as a whole.

    336. Re:In unrelated news... by troff · · Score: 1

      > I still want to anthropomorphize it and believe its doing > it intelligently instead of just randomly selecting > points and discarding those that don't give good results. Erm... "discarding those that don't give good results"... ... isn't that intelligent behaviour? Your anthropomorphisation is actually correct... simply because the process of Evolution IS intelligent - natural selection makes decisions based on circumstances. The ID crowd, of course, don't get this... simply because they're too busy pushing their agenda. There have been discussions on sites like The Panda's Thumb and PZ's Pharyngula, and no less that website "Uncommon Descent". A good Christian woman said she had no problem with calling Evolution a kind of "Intelligent Design" anyway BECAUSE of the mechanisms of natural selection. She was always polite, she'd followed the entire debate, responded to every single point they'd raised with actual science AND references. They claimed she didn't know what she was talking about. She was, of course, banned by the Uncommon Descent moderators.

    337. Re:In unrelated news... by mrob1 · · Score: 1

      I wonder how the same people feel about Boyle's Law.

    338. Re:In unrelated news... by sigzero · · Score: 0

      Some of the greatest scientists in the history of mankind were religious.

      If by evolution you mean micro-evolution. Yup I believe that. If you mean macro-evolution, then nope I don't and there is zero proof of it. Most people throw evolution out there with no understanding of the differences between the two. Do I believe that I got here from the goo through the zoo? Nope, even if the universe were trillions of years old science won't and doesn't support that.

    339. Re:In unrelated news... by GrumpySimon · · Score: 1

      I find this quite interesting - certain religious groups appears to be determined to attack evolution, while they're busy tilting at that windmill, they completely failed to see that Neuroscience is creeping up behind them and is going to have a much larger effect on what we consider humans to be.

      Let's see - apart from direct research into religious or magical beliefs (in some circumstances linking them to say, temporal lobe epilepsy), there's been work on morality, which, to a large degree appears to be built-in. If people *are* moral without a crusty old religious book, then there goes one major crutch that religion depends on.

      Then there's the whole freewill issue.

    340. Re:In unrelated news... by Anonymous Coward · · Score: 0

      This is the trouble with pure text and no subtle, spoken inflection and body language: you can't tell if someone's trolling or is really just an ass.

    341. Re:In unrelated news... by GrumpySimon · · Score: 1

      "Check the dictionary. Love isn't just a noun, it's a verb. Too many people seem to lose touch with how deep the meaning of love can be."

      Do people often check the dictionary before falling in love? I certainly don't. What a word is defined is has no effect on what people experience

    342. Re:In unrelated news... by Mad+Marlin · · Score: 1

      Any God that created all of existence would be outside of existence and necessarily not exist. Us trying to prove God's existence would be like this posting trying to prove my existence. The word just doesn't imply the correct meaning if it applied to humans as well as to God. If I exist then God doesn't; if God exists then I don't: the word can't adequately describe both conditions at the same time.

    343. Re:In unrelated news... by Anonymous Coward · · Score: 0

      I would like to point out that the US didn't invent all this God nonsense and I believe, for example, the Vatican lies firmly in Europe. And the Eurasian continent seems to foster more than it's fair share of religious zealots eh?

    344. Re:In unrelated news... by ppanon · · Score: 1

      The current pope, like the last one, also believes that it's a good idea to preach against prophylactics in sub-Saharan Africa where AIDS is making ravages among his flock.

      Think of it as memetic evolution in action.

      --
      Laissez lire, et laissez danser; ces deux amusements ne feront jamais de mal au monde. - Voltaire
    345. Re:In unrelated news... by Anonymous Coward · · Score: 0

      For anyone just interested in understanding the Theory of Evolution, and why it offers a /natural/ explanation I recommend Richard Dawkin's book "The Blind Watchmaker". He does a really good job of explaining the theory and why other arguments for diversity such as the Argument From Design simply don't hold water. Sure, he plugs atheism a bit near the end, but you are always free to ignore that and focus on the biology and sensibility.

    346. Re:In unrelated news... by Score+Whore · · Score: 1

      You are certainly pigeonholing both religious people and scientists. There are plenty of scientists who think they know the truth and are not longer searching, and there are plenty of believers who are still looking for the truth. Take a look at the number of people believe the big bang without any experimental evidence and no observational evidence that can't be explained by other theories. Just because an authority told them it was true. Don't rail on the religious for not personally investigating every aspect of their faith unless you're willing to do the same to every secularist. How many of the anti-religious here can describe Hawking radiation and its significance? How can you explain the rapid expansion period? It's a useful phenomena that has been created to make the math work.

      Personally I'd prefer that some scientists just take their shit on faith instead of, for example, spending $30 million pumping energy into the upper atmosphere just to see what it does.

      And, while I'm a big fan of scientific research, I sometimes wonder about the rationality of the world spending $2.5 billion creating a device to look for a particle that may or may not exist and which, as yet, not a single scientist can even suggest practical spin-offs of the search for the Higgs boson.

    347. Re:In unrelated news... by geminidomino · · Score: 1

      3. Only one person has to imagine it. Everyone else can blindly follow it. Ever read about some cults? I think I just did, in the form of the summary.
    348. Re:In unrelated news... by petermgreen · · Score: 1

      True, but in mathematics you can conclusively prove something. They're called theorems.

      remember this from a VERY famous scientist
      As far as the laws of math refer to reality, they are not certain, as far as they are certain, they do not relate to reality.

      or to put it another way mathematics can prove that a group of equations and/or conditions implies other equations and/or conditions but it cannot prove that when you characterised the real-world relationships you knew about by a set of equations that you got it right.

      --
      note: i'm known as plugwash most places but i screwd up registering that here somehow in the past and now can't register
    349. Re:In unrelated news... by gordo3000 · · Score: 3, Insightful

      Second of all, it is not possible for anyone to do all the experiments and gather all the evidence to indicate any complex theory is correct.

      buddy, after this line, you should have stopped. no scientist will ever call any theory correct. all theories are models that accurately(to a certain level of experimental precision) describe what will be your physical observation when you do 'x'. Now,theories have evidence to support them by making unique predictions that other theories do not and then having those predictions be born out in an experiment.

      now with science, you only need to base what you think on what others have said to the extent you do not wish to recreate the entire body of human knowledge. the main difference is that with the bible, you will only ever have what another person has said. To give a more specific example, I have at least 3 distinct choices I can make about Jesus Christ. 1) he is the some of Jehovah as his disciples have said, 2) he is a prophet of Allah, one of a long line of prophets leading up to Muhammad, the last prophet, or 3) that he is a Bohdisattva who, after achieving enlightenment, fabricated a more easily believable tail for those far from enlightenment to start them down the correct path. All three have equal evidence supporting them, hearsay. One may give greater weight to the story given by Jesus's disciples simply because they were in close proximity to him, but that does not make much sense simply because the oldest copy of a gospel is from about 160 years after Jesus died.

      Now take a scientific case, carbon dating of organic materials. choosing to what extent you wish to recreate previous science, I can find various amounts of organic material from different time periods and measure the concentration of C-14. I can also do experiments in the lab and measure empirically the decay rate of C-14. I can do this in one of many ways and check for consistency with previous data on the decay rate of C-14(to check for consistency in this rate for the last 100 years).

      I can then choose whether or not to apply this decay rate to C-14 over all of history or not or I can limit myself to a certain number of years that the precision of my experiment lends to using. Now, I can gather various organic material from different sites to check concentrations for C-14 over time and see if 1) concentrations of C-14 are the same for all organic material of a given age and 2) if the data lends credence to the belief that the concentration of 'new' organic material 1000 or 10,000 years ago is the same as it is today. Once I have shown 1 and 2 to be correct(if I do), I can then go search for organic material which is similar to other materials but can be shown through the decay in the concentration of C-14 is older than 10,000 years(really I only need to do ~6,000 years to show the lack of consistency in a literal reading of the bible). Now at this point, you can merely show that the concentration of C-14 is x, and it is up to the reader on how to interpolate the data. but given the other data behind C-14 dating and whether or not it has held accurate for dated human remains of the last 3000 years(marked graves help in this) lends credence to the hypothesis that this object is probably more than 6000 years old. of course, you can reject this, but then it will be up to you to show evidence as such. If your net evidence is saying that what scientist 'y' said was influenced by his agenda, you have basically ignored the mountain for the grain of sand.

      Now, this was just a series of experiments to show that object x may be older than 6000 years. it neither requires a belief in a complex theory nor basis in the hearsay of 1 particular scientist(or any subgroup of scientists). now, there may exists a more complex over arching theory that can take all these observations and predict them in a more fluid manner, but that is irrelevant to the facts presented. Complex theories are not required to study radioactive decay. The complex microscopic theories are required to understand mechanisms of radioactive decay but the mechanism is unimportant to the conclusion that object x is older than a certain interpretation of the bible says it should be.

    350. Re:In unrelated news... by socerhed · · Score: 1

      You know all that really matters is that when you die you better be right. I mean really, if those of use that do believe in God are wrong what do we have to lose? However if you are wrong and there is a God...well then my friend there is hell to pay.

      And no I'm not trying to preach a fire and brimstone kind of way. I'm just saying. I mean really we both could be wrong and Zeus is the one in the sky and we have to go pay a trip to Hades when we die. In the end we all have choices to make. Its just that in hope of "helping" you, I try to convince you of my way and vice versa. The people that get my respect though are those that can have a real discussion about this without walking away saying that the other is a complete idiot because in the end neither really knows 100%.

      --
      LostHobo.com
      Soup Kitchen of the Internet
    351. Re:In unrelated news... by orcus · · Score: 1

      I know how fashionable it is to bash the USA, but if you think we're ahead in that race, then you need to visit a few more countries. I could tell you about places where people believe in witchcraft and have been known to hack their neighbors to pieces over it, and I'm not talking about things that happened centuries ago.

      Actually - there are quite a few folks who believe in and practice witchcraft in the good ol' US of A - and they don't go around hacking their neighbors to bits while doing it.

      Since this probably is a big surprise to you - check out www.witchvox.com some time - you'd be amazed how many groups there are - maybe one in your own home town :-)

      And yes - it is quite fashionable to bash the USA for it's right leaning politics.
      It's also fashionable to try to do something about it - like raising awareness, instead of pointing fingers at other countries like a small child and saying "but look at what they are doing!"

      --
      First they burn books, then they burn people.
    352. Re:In unrelated news... by servognome · · Score: 1

      America continues to worry about losing its edge in the high-tech industry.
      But that couldn't possibly be related to poor science education, could it?
      How long does it take to lose the edge, poll numbers in 1982 were the about the same. I'm guessing more than 48% of Americans have lives where it doesn't matter if they believe in evolution or the Easter Bunny.
      --
      D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
    353. Re:In unrelated news... by PitaBred · · Score: 1

      As long as you also don't try to claim that evolution isn't a commonly accepted scientific fact, you're entitled to it.

    354. Re:In unrelated news... by am+2k · · Score: 1

      The fact that you have just explained it in a way which is subtly wrong supports the idea that it is counterintuitive. An animal does not adapt. It is born with a certain set of DNA, which it cannot change or control, and it lives or dies as a result what DNA it has (along with other factors like chance).

      I think you misunderstood the way the GP used the word "adaption".

      Actually, an animal can adapt. For example, the same human can either live in the Sahara desert, or in Greenland. There are similar patterns for other creatures (for example, certain rodents adapted to life on Australia when the first ships went there). Every animal has a certain base adaption ability, but that varies hugely (for example, humans can adapt to nearly every environment on earth and close by, while the great panda is dependent on a single plant which only grows in a certain region and height on earth). The real question is, is the animal able to adapt to the environment it is born in. If you're living in an environment that happens to be exactly what you need, you can be as specialized as possible, which would be a great benefit to you (because you aren't wasting any energy on being adaptable). On the other hand, you risk death/extinction when the environment changes.

      The reason behind the greater population of humans compared to great pandas is that humans are better at adapting to new environments (this might have resulted from the fact that the humans have always been migratory).

      Then again, the reason why insects are more successful than humans is that their shorter lifespan allows greater mutations in the same timeframe, which is the point you made.

      This is a bit counter-intuitive because it's not how people solve problems. Humans generally apply intelligence to a problem. If you're a car company and you want to sell a new model of car, you don't make a bunch of new types of car at random without any direction, then ask potential customers if they suck or not, then throw out the ones that suck. That would be enormously wasteful and slow given limited resources, so humans rarely ever do that. Instead, you figure out what you want, you apply theory, and you make a plan to go directly where you want to go (or as directly as possible).

      Actually, that only applies when doing things manually. There's a concept in computer science called "genetic programming". This concept exploits the fact that computers are much faster than humans, so they can simulate many many many generations of a program in mere seconds. The only thing the human programmer has to do is to create a rating system in order to compare solutions to each other and be able to kill the bad ones, and define how the program is able to evolve. That's very hard to implement though, I haven't seen any application outside of research for this yet.

      Neural networks use a similar idea to mimic the human brain. This is used extensively in pattern recognition.

    355. Re: In unrelated news... by servognome · · Score: 1

      However, few other works have seen any need to be so very re-interpreted as the Bible has.
      The Constitution probably has :) Changes in society, whether technological or philosophical will always require such social documents to be re-interpreted.
      --
      D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
    356. Re:In unrelated news... by socerhed · · Score: 1

      Ummm, actually the argument on morality being built in helps the argument on religion because it shows that the ideas of what is right and wrong was put there in order to guide us in the direction that God wanted us to go. However, morality comes from experiences and lessons as a child as much as, if not more than, what is already "programmed" in. THAT idea is tried and true.

      --
      LostHobo.com
      Soup Kitchen of the Internet
    357. Re:In unrelated news... by falconwolf · · Score: 1

      I'm not a scientist or high level scholor, but there are some holes in evolution just like there are some holes in creationism, but saying that just because there is some evidence to support evolution doesn't mean that creationism is bunk either.

      Can you point out these holes?

      Falcon
    358. Re:In unrelated news... by hyperquantization · · Score: 1

      That's exactly my point. Nobody wants to recognize the depth of language, because that makes us accountable for what we say vs. what we mean, and nobody wants to be accountable for something they can just as easily get away with. To say "I love you" and mean that you feel a certain way provides no social accountability beyond what the amorphous "accepted social protocol" dictates. The fact is, feelings are not explicitly perceived in communication, so any touchy-feely based language system is, inevitably, bound to fail as it provides no universal definition. Without definition communication is garbled and useless. With garbled communication...well, the story of Babel has something to say about that.
      The importance of a language's integrity should NEVER be underestimated.

    359. Re:In unrelated news... by FenrirTheWolf · · Score: 1

      It depends... was it an acute, right, or obtuse angle?

    360. Re:In unrelated news... by PitaBred · · Score: 1

      "the beauty and power that surrounds everything in the scientific world that is not definable by any empirical means"? I think that the old Norsemen used to say that about thunder and lightning, and came up with Thor and Odin.

    361. Re:In unrelated news... by Opportunist · · Score: 1

      A God (or anything) existing outside of our universe is impossible to prove with scientific means. You cannot prove or disprove anything beyond the scope of your universe.

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    362. Re:In unrelated news... by David+Rolfe · · Score: 1

      That's great. But it's still addressing a different question as to whether there is a God at the beginning of all of that 'soup' to say go. If there is a God who created everything, then He is outside of it all. The only way we could 'discover' Him would be for Him to somehow let us know. That question wasn't raised, was it? I missed it if it was. My apologies.

      Obviously, I'm not describing how God created the universe from outside of the universe. I'm describing how it is possible that life originates without God's direct manipulation and the difference between improbability and impossibility.

      The supernatural is just that.

      Also, I apologize for making a distinction between the creation of the universe and the origination of life. I guess for me those are two separate events. (And two seperate cosmological and philosophical questsions!)

      Thanks for the response.
      --
      Read Heinlein's 1953 Revolt in 2100, now more than ever.
    363. Re:In unrelated news... by mrpeebles · · Score: 1

      My two cents: I would like to think that most of America finds creationism so compelling because it seems to balance the tendencies of the scientific method towards philosophical naturalism, reductivism, towards ignoring questions about first and final causes, towards secularism, etc. Creationism then becomes a sort of heroic optimism against the perceived nihilism of science, even if it is a bit of an over-reaction. However, I frankly don't think that most of us here in the US understand science well enough to be scared of its tendencies. No, I have to understand creationism as the result of bad theology. Creationism is not compelling. Instead, it is needed for a literal reading of the Bible. Without a literal reading of the Bible, it no longer seems be possible to find moral and religious truths in as straightforward a manner as we find scientific and mathematical ones. The person who is not conscientious now seems able to interpret the Bible in whatever way happens to be the most convenient, and the person who is conscientious must now doubt that his or her actions are the right ones. In any case, the average Biblical literalist is still interpreting the Bible. For example, he reads Genesis very differently than, say, a 3rd century BC reader did. This article says it far more convincingly that I could http://www.religion-online.org/showarticle.asp?tit le=1917 . Creationism, then, is not about defending theism. Instead, it is about trying to keep the doubt of modern life sequestered from certain religious principles. Unfortunately, religion has always involved doubt. It is certain aspects of the modern scientific method that do not involve doubt- we do not doubt, for example, that a jet will take off (barring some sort of catastrophe), or that an apple will fall towards the Earth. This kind of certainty is what needs to be kept separate from religion.

    364. Re:In unrelated news... by Amiga+Trombone · · Score: 1

      America continues to worry about losing its edge in the high-tech industry.

      But that couldn't possibly be related to poor science education, could it?


      Not that I want to defend this situation, but keep in mind that this has always been the case in this country, even while having an edge in the high-tech industry.

      Our edge owes more to having a great economic environment for innovators and entrepreneurs than it does to having the brightest of populations. This has been a country of crackpots, idiots and religious cranks right from day one.

    365. Re:In unrelated news... by Anonymous Coward · · Score: 0

      The only dark, depressing world is inside your head. I don't have to believe unconditionally in a higher power to see the beauty in the universe, or feel love, or be motivated to do good. People who seem to think they need a god to appreciate life puzzle me.

    366. Re:In unrelated news... by mcknation · · Score: 1

      (Cancer rats, fruit flies, albino psylocybe cubensis mushrooms,

      PF? Is that you? Did you do that with a blacklight...or woods lamp...or whatever they are called today?
      /McK

    367. Re:In unrelated news... by Gazzonyx · · Score: 1

      ...dating processes scientists use that result in objects older than that?
      I've got karma to burn, and I feel that I'm in the minority on this one, but I'll go ahead anyways...
      That, my friend, is a can of worms. There are a great many problems with carbon dating in particular. I'll leave it up to the scholarly of you to look it up, but isn't the 'benchmark' for carbon dating, carbon dating itself? When you ask a lab to date an object, why does the form ask you what age you 'think the object is', isn't this technique solely based on the speed of light never changing? Isn't the actual range of carbon dating only a few thousand years due to our ability to measure after a few half lives, yet we use it for millions of years... Wasn't there a case where the carbon dating of an animal's bones showed that it was many magnitudes of age older than the very hair found by the animal (I think it was a tiger, IIRC). Doesn't carbon dating yield results in opposition of something around 94% of other dating techniques?

      I'm not trolling, and I don't realistically expect to change anyones opinion (opinions are tough, if not impossible, to change), but as this is an open forum to discuss things, I thought I would throw my hat in the ring. If we are an objective community, we can discuss things objectively without the gradeur of waving hands and being dismissive of others ideas. Unfortunately, I've found that open debates seem to be 'won' by the poster who is most dismissive in the grandest way possible. Anyone sufficiently versed arguing can convince you of most anything. To be honest, I don't have any of the answers, and I don't pretend to.

      --

      If I mod you up, it doesn't necessarily mean I agree with what you've said, sorry.

    368. Re:In unrelated news... by GrumpySimon · · Score: 1

      From memory (I'm not religious, so don't take my word for it), but the whole point of the Christian religion is that people have fallen, and needed to be shown the error of their ways.

      Also keep in mind, the "morality" that these studies are uncovering is not "the ten commandments", but more along the lines of how many people is it ok to kill in certain circumstances. There's a good introduction by Carl Zimmer here

    369. Re:In unrelated news... by grub · · Score: 1


      Awesome reply, thanks for the most humourous yet insightful post in the thread so far.

      --
      Trolling is a art,
    370. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Intelligent design is not anti-evolution creationism.

    371. Re:In unrelated news... by buffer-overflowed · · Score: 1

      That's Pascal's Wager, and it's crap. Any entity, divine or not, that predicates judgement based entirely upon belief in said entity, isn't worthy of worship, it is worthy only of contempt. That's petty, and a very human quality to find in a supposedly nigh-ununderstanble divine being.

      You people demean god.

      --
      The key to the enjoyment of pop music is to replace any instance of "love" with "C.H.U.D."
    372. Re:In unrelated news... by socerhed · · Score: 1

      Right I get that. What I'm saying though is like in Nazi Germany, Nazis killed Jews and so children growing up thought that was ok from the experience. The same with slavery and racism. People aren't racist because they were born thinking its ok, their racist because thats how they are grown up to think or what they are taught to think. I'm not saying that people aren't born with some kind of barring on right and wrong, but I don't think it is the major guiding force for their ideas of right and wrong.

      --
      LostHobo.com
      Soup Kitchen of the Internet
    373. Re:In unrelated news... by Das+Modell · · Score: 2, Insightful

      So are you saying that the poll is inaccurate? If 48% of Americans reject evolution, does it matter that the country is highly diverse?

    374. Re:In unrelated news... by servognome · · Score: 1

      Expecting some one with below average (and average isn't something to be proud of either) intelligence
      I don't think being above average intellegence with no ability to socialize due to a sense of superiority is something to be proud of either. ;)
      --
      D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
    375. Re:In unrelated news... by hogsWild · · Score: 1

      you are right, I think I pulled others comments into my one post as a reply to yours. sorry.

    376. Re:In unrelated news... by Das+Modell · · Score: 1
      How dare those nefarious scientists "indoctrinate" youth and "push" scientific facts on them! We'd all be better off without science.

      You should immediately unplug your computer and throw it out the window. You wouldn't want to support the Global Scientific Conspiracy, would you?

      What I believe in cannot be proved correct scientifically, therefore it cannot be proven wrong scientifically.

      QFT! It's not like evolution is science or anything!

      On a more serious note, just what exactly are you doing on Slashdot?
    377. Re:In unrelated news... by cyphercell · · Score: 1

      I don't know let's try polling the European Union then we can test 1/4 of the US population, if the results don't favor the US we'll just test a different quarter.

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    378. Re:In unrelated news... by WatchTheTramCarPleas · · Score: 1

      If only someone would create a program that could detect that...

    379. Re:In unrelated news... by Anonymous Coward · · Score: 0

      ...

      If something is large and complex, like say a car, do you throw it away if a few small parts are defective, like say a windshield wiper?

      Its really hard to see the distant past in detail (duh). Unless we find a way to do something incredible like travel back in time there will always be obvious holes in whatever theory you come up with. That does not mean the theory is completely without merit. There is a difference between falsifying something, and finding a point you do not understand. This is a point where the predictive part of science helps some.

      Oh and yes, evolution does make useful predictions. I'd go into detail, but I might as well leave it to you to research. Its easy to find information on and you might actually learn something.

    380. Re:In unrelated news... by eli+pabst · · Score: 1

      The common ancestor of humans and chimps would be considered an ape. So the GPs comment was correct. The fact that people get so upset at that has more to do with our own arrogance than anything else.

    381. Re:In unrelated news... by MattHaffner · · Score: 4, Insightful

      I think the scientific method is one of the best detectors of rubbish-disguised-as-truth there is. All I am saying is that I hope it's being adhered to. I hope people don't blindly push evolution like some people blindly push religion.

      Typically, and especially in our modern era where the method has been practiced for many decades now, seasoned scientific theories are not radically overturned. There may be grand new insights into the underlying reason why a current theory works as well as it did before the new discovery, but that "old" version of our understand still works to explain the same things it did before. We just might understand even better why it worked so well for the conditions or environment we were trying to describe at the time.

      Newton's universal law of gravity still is a great description of how massive bodies respond to each other, but it doesn't say anything about how photons--massless particles--respond to massive bodies. Einstein gave us a deeper understanding of gravity that applied even more universally than Newton's law, but it didn't invalidate Newton's law. It's still the best formulation to use for non-relatavistic, massive bodies.

      Evolution is a sound scientific theory because it has made predictions and stood the testing of those predictions. When new discoveries are made outside of those predictions, it has still held up as the best theory to explain the similarity and diversity of life on the planet. When we discovered what makes life distinct through DNA and genetics, we didn't throw out our idea of evolution at the species-scale. Instead, we gained a deeper understanding of how the more obvious physical differentiations happen through the everyday chemistry that drives living things.
    382. Re:In unrelated news... by socerhed · · Score: 1

      No, I'm not saying you should believe in God because its the safe choice. You should never believe in something based on one reason and one reason only. However, there are some reasons that outweighs others, and when it comes down to believing in God because you don't want to go to hell or not believing simply because you want to live life however you want to and not live under certain rules, you should really think about your choices.

      Also, it does matter in what God you believe in and whether you believe in one over the other. Hindus and Christians very greatly in their beliefs. Even the differences between the Jewish faith and Christian faith makes a large difference. I mean if you were to have you son go through unbearably amounts of pain for someone to live wouldn't you want that person to at the very least say thank you? Or if you told someone to follow certain traditions as a price for eternal life? Or if you told your people to pray 5 times a day and go on a pilgrimage once in there life in order to get to live in paradise? Ideas are different in each religion and whichever God is the true God he has all the right to judge someone based on their belief in said God.

      --
      LostHobo.com
      Soup Kitchen of the Internet
    383. Re:In unrelated news... by Eli+Gottlieb · · Score: 1

      But which set of Power Rangers? The world must know who protects us!

    384. Re:In unrelated news... by gordo3000 · · Score: 1

      the diversity of the US points out that the US can lead the world in scientific endeavors while having a large portion of its society ignorant to that very science. its not hard when you have the differences in culture and location between Alabama, California, and Massachusetts.

      the exact quote I was replying to was:

      "The difference is that the USA aspires to be a world leader in almost every field. Compared to other western countries, the USA certainly has the most religious influence on politics and daily life. The high-tech profile and the importance of religion looks somewhat strange in the eyes of other industrialized/high-tech countries."

    385. Re:In unrelated news... by notwrong · · Score: 1

      What it all comes down to is: Most (50%+) of people are stupid.

      That is a reasonable observation, but it is surely the case for every country, including all the other modern, developed ones. Although I don't have exact figures for the level of belief in creationism in other countries, I am quite confident that, at least for other industrial/developed/democratic countries it is far lower than in the USA. The interesting question (to me at least) is then "why is this viewpoint so widespread in the USA, as against other comparable countries?".

      I don't necessarily have a simple answer. I suspect it is related to the much higher prevalence of devout religious belief, which is turn due to historical factors.

    386. Re:In unrelated news... by Barlo_Mung_42 · · Score: 1

      Wanted to dig you up for the D. A. ref but alas, I have no mod points.

    387. Re:In unrelated news... by gweihir · · Score: 1


      One of the many neat things about the way science is practiced, with numerous independent scientists continuously challenging each other's theories and discoveries, is that it doesn't tend to produce Big Lies.

      It's conceivable, though highly unlikely, that one day evolution will be disproven completely. If that happens, it will be entirely to science's credit.


      I applaud you on both statements. Very, very insightful and yet compact. Impressive!

      --
      Most ACs are not even worth the keystrokes to insult them. Be generically insulted by this and ignored otherwise.
    388. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Or you could take the least controversial route, he was a guy who said it'd be a good thing if we were nice to each other for once, and for his trouble got nailed to a piece of wood.

    389. Re:In unrelated news... by gweihir · · Score: 1

      No, mathematics can be proven to be logically consistent. What Godel said was that it is impossible for a logical system (like Mathematics) to be both provably consistent and provably complete; so basically, because mathematics is provably consistent (that's where the whole idea of a proof comes from...), there are things that you cannot prove with that system.

      Two notes: 1) Incompletness according to Goedel cannot be prooven, but may be possible to disprove if it turns out to be wrong 2) It only holds for resoning systems of ''sufficient complexity'', which commonly is thought as at least predicate calculus (which, incidentially is not yet powerful/complex enough to describe a bit more advanced mathematics)

      So, yes, it is fais to say that incompleteness is likely to be encounterd in a lot of the mathematics known tody. Interesstingly program semantics are very likely heavily affected.

      --
      Most ACs are not even worth the keystrokes to insult them. Be generically insulted by this and ignored otherwise.
    390. Re:In unrelated news... by Saint+V+Flux · · Score: 0

      "We've shown that every prerequisite for life can be synthesized by processes known to happen on Earth prior to life."

      And that "experiment" has been proven to be a fake and does not work if you try to re-create it.

      Before you go on some rant about me being a "religious fanatic" - I have no religious bias keeping me from believing in macro-evolution. All I want is some solid evidence. Evolution is statistically impossible. Sure, there may be that .00000000001% chance or whatever that is did happen, but it takes WAY more blind faith to think that the dice might've rolled JUST RIGHT trillions of times than it does to believe in the FSM. When I see fossils that truly back up macro-evolution as opposed to huge creative leaps between the fossil and the creature that TIME or whatever group is showing the "this is what the creature looked like" article and biology textbooks no longer require faked "experiments" as proof of evolution, I'll consider it.

      I know I'll get modded down for defying the hive mind here, but on something so fantastically outrageous, I want real proof before I'll believe it. I'd say the same thing if we were talking about the transporter from the starship Enterprise or if someone said they found a way to modify their DNA to make themselves bullet-proof. Are these things possible? Sure, but they're incredibly unlikely. I don't have an explanation for how things came to be and all that. However, until there is real, 100% no one (even psycho nutjobs) can deny this proof, I place macro-evolution in with the Bible and mythology as just another story for how the world came to be.

    391. Re:In unrelated news... by aqk · · Score: 1

      Thanx !

          Gotta remember the "Power Rangers" analogy.

        Too old to watch that nonsense; I don't think even my kids ever watched it, but maybe I'll start a "Power Rangers" church.
      Tax-free of course.

          I had a favourite uncle, lonng since dead, who said, if he had his life to live over, he'd be a US televangelist.
        All that money! All that tail! Wow.

          Now, in MY old age I feel rather the same way. Just have a glass of Pinoqachole and remember- Fully 50% of Americans have an IQ of less than 100. Let's go get 'em, Power Rangers! And ummmm... send me money for your Power Rings.

    392. Re:In unrelated news... by OpenGLCoder · · Score: 0, Flamebait

      My friend, there is no way to prove to you that my God exists if you are unwilling to open your heart to allow him to show you. You can only call people like myself fools because you have not experienced my loving God.

      I believe that my God made a creation through a design that is perfect. Part of that perfection is organisms being able to adapt to their environment. Adaptation is a part of perfection.

      That being said, humanity did not evolve from an ape. We were designed special so that we can have a personal relationship with God. We're the only creatures who can. If anything, apes devolved from humanity - I see the chain of devolution beginning every day at work.

      There is nothing foolish about believing someone who stands to gain nothing by you believing what they say. I believe my God and believe that Jesus Christ is the true savior of the world who came to Earth, lived a perfect life, and died on the cross to pay yours and my sin debt in full. I stand to gain nothing if you choose to persue this truth my friend.

      --
      Jon Davidson
    393. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Love your sig

    394. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Catholics are descendants of apes!

    395. Re:In unrelated news... by Anonymous Coward · · Score: 0

      This is the Wedge strategy; its goal is to convince people that evolution is not supported by the scientific community, and the media helps it in its goal by being stupid and not doing proper fact checking, which is easy to do but would alienate their more idiotic watchers. The simple solution is to deal with it similarly; ignoring it is not sufficient. What needs to happen is a campaign against these zealots, basically saying they don't know what they're talking about. If this was done, it could be dealt with.

      The other thing would be having nationwide standardized tests testing on such knowledge, and failing people who don't understand it. Like No Child Left Behind, but with curriculum requirements - all 5th graders must understand evolution on a basic level, all 8th graders on another, and all high school graduates should understand how it works.

    396. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Without life starting there is nothing to evolve. Surely refusing to consider how life started when discussing evolution is not good. People who agree with evolution think it's a good point (+5 informative?), people who believe creationism can laugh (hey look, he's avoiding the issues he can't answer, ha ha, silly evolutionists) and people who aren't sure are left with vocal creationists and people who refuse to talk.

      Avoiding the issue is not a way to make a convincing point.

      This is not reasonable. All science does exactly what you describe. Without the creation of the universe, there's nothing to move, so how can Newtownian Mechanics not deal with that? It doesn't deal with it because it's not a theory of how the universe began, it's a theory on how objects move. Similarly, Evolution is a theory of how all life evolved from a single life form, it's not a theory on how tht first life form began. It's no different than any other field of science...
    397. Re:In unrelated news... by Millenniumman · · Score: 1
      I didn't deny evolution.

      Or perhaps you don't believe in reality? Might I ask, is that necessary for science? Because if so, it sort of contradicts what you've said.

      I believe speedometers, because I live in a society where that belief is universally accepted.

      understand the principles Meaning you believe what others say, to the point you classify their words as "principles".

      If you don't believe laser measuring equipment works as it does, then you must not believe that modern technology even exists! I do believe that. I believe it. And apparently you do too. But you said science doesn't require belief.

      Yeah, my last comment was asinine. Then again, you said the same thing to me.
      --
      Stupidity is like nuclear power, it can be used for good or evil. And you don't want to get any on you.
    398. Re:In unrelated news... by Verte · · Score: 0

      There's a whole other set of atheistic theories that are usually pushed along with it, like the one you just mentioned. As a mathematician, I know better, but I still know the implications of saying "I believe in evolution". It's more than a theory, it's a mindset, and some have turned it into a strange cult, with its own dogma and clergy.

      --
      We at slashdot are scientists, specialists and kernel hackers. Your FUD will be found out.
    399. Re:In unrelated news... by noldrin · · Score: 1

      I have to wonder that if this survey is flawed. Perhaps they gave people to choices and each one took extreme views and thus people had to pick on of two extreme views when in fact they believed somewhere in the middle.

    400. Re:In unrelated news... by cyphercell · · Score: 1

      ...20% of the world population is illiterate (by the UN definition).
      ...the National Assessment of Adult Literacy (NAAL), conducted by the US Department of Education, found that fourteen percent of American adults scored at this "below basic" level in prose literacy in English.

      Those are from the article you quoted.

      ...cream at the top, largely from families imported from Europe, to glue the country together.

      Just shut up. 6% is a lot on the global average.

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    401. Re:In unrelated news... by The+Wooden+Badger · · Score: 1

      I think that the poll question is flawed, leading to useless results. There are two separate questions there. It should be a poll question of 1. Do you think that evolution is well supported? and 2. Do you think evolution is widely accepted? As written it makes Americans look absurdly foolish, when they probably never got past question 1. Someone might know there is a lot of evidence for evolution, but they might think the evidence is lacking for some reason. That may or may not be ignorance on the part of the individual.

      --
      Heroscape, it's like legos combined with anachronistic wargames.
    402. Re:In unrelated news... by Eli+Gottlieb · · Score: 1

      Why do people flame the Creationists instead of ignoring them? Because they were taught Evolution (note the capital E) in high-school biology class, and they learned it on faith. So when they feel their faith is under attack, they lash out.

    403. Re:In unrelated news... by Evil+Pete · · Score: 1

      What I believe in cannot be proved correct scientifically, therefore it cannot be proven wrong scientifically.

      Therefore, you are not open minded to the possibility of being wrong, you will accept no argument. You're faith is insecure because you don't trust it to be tested by argument.

      Lots of people, including scientists, believe in God. That doesn't mean they aren't willing to listen to ideas that might threaten their beliefs.

      Sorry. I'd say more, but listening and talking to fundies is basically a waste of time I have found. They don't have anything to offer and they don't think for themselves. I've got better things to do.

      --
      Bitter and proud of it.
    404. Re:In unrelated news... by OpenGLCoder · · Score: 1

      The interesting thing about what you said above is that I'm sure you did not do the experiments to prove/disprove carbon 14 dating works. At some point - you believed what some human had written down. It required faith from you in the person writing the information you so readily absorbed.

      Why did you absorb it? Did you question it? - Probably not. Because you were interested and had a mind to build upon it. It confirmed what you were wanting.

      I don't need to believe in my God. My "belief" is more rock solid than yours in C14 dating because as opposed to only reading about him (as you read about C14), I've experienced his grace - as he has changed my life.

      I don't know how old the earth is. I know that God created the Sun before the earth. I also know the Bible states 7 days. Since the Earth did not exist to rotate on the day the Sun was created, You have to conclude that "days" was used by the Biblical writers to explain that which they did not have words to describe. I would define a day back then as an ending and beginning paired together. Who knows how long that was - only God. On that note, The Bible does not contradict C14 dating.

      --
      Jon Davidson
    405. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Look it's quite simple. Take it from the tech's perspective. Someone subverted a law of the system that some dude was tasked with keeping running and he had to come down and explain how EVERYTHING works to some bumpkin who'd never seen a wheel before let alone understands the 7-11 or whatever dimensions he resides within. So he had to simplify some things for him to understand, and since that bumpkin didn't have writing he went on telling his kids "Ok, now this is the way things work because Gob said so," and after a few generations Gob became God and some of the particulars got mixed up. By the time the written word came about nobody knew what the heck God had said to begin with, or even how long he had said things took so they sorta filled in the empty bits like a game of Chinese Whispers.

    406. Re:In unrelated news... by cyphercell · · Score: 1

      Languages:
      English 82.1%, Spanish 10.7%, other Indo-European 3.8%, Asian and Pacific island 2.7%, other 0.7% (2000 census)
      note: Hawaiian is an official language in the state of Hawaii
      https://www.cia.gov/cia/publications/factbook/prin t/us.html

      This would suggest that a good number of US citizens are literate in a language other than English, which is not accounted for in the wikipedia article you linked.

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    407. Re:In unrelated news... by Profound · · Score: 1

      You were shocked at them and felt separate from the community of people there.

      They want to live in their community, and while they may occasionally have bursts of cognitive dissonance - their need to be part of their community and believe what everyone else believes shuts down any skepticism and questioning.

    408. Re:In unrelated news... by Anonymous Coward · · Score: 0

      No, what Einstein said was "Keep your hands off me you damn dirty ape!"

    409. Re:In unrelated news... by sumdumass · · Score: 0

      Believing in evolution or not has little bearing on high tech or other sciences. In fact, there is little to no direct correlation to designing anything electronic and man being the illegitimate son of a monkey.

      I don't understand why this is such a big deal unless a person is in a field doing something directly related to it. The vast majority of science doesn't even touch this or any process involved in it. The percentage of those people are well under the difference in people who believe and no believe. It isn't like it is fact that evolution exists, we haven't witnessed it and one of the most scientific theories of evolution discounts a good portion of evolution which could throw a study like this off if the questions were asked the right way.

      Why is people believing in god such a big problem for some? This is all this is about. Someone believes in a deity more then the generalization of bits and pieces of evidence linked together so form something others believe in. The effect his has on anyone is trivial compared to anything they might do in the future and is in no ways a guage of what a country knows about science or not.

    410. Re:In unrelated news... by cyphercell · · Score: 1

      Great chart. Chalk me up as blue on that chart, otherwise I've never wanted to buy a bumper sticker more in my life. You know a Darwin fish or something classy.

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    411. Re:In unrelated news... by Mr.+Slippery · · Score: 1

      I believe what I believe no matter what science says because of the personal impact it's had on my life.

      You've made the all-to-common error of confusing the subjective and the objective.

      Your religious practices have had a positive effect on your personal, subjective exeperience of your life? Great. Rock on. Pray, chant, dance, meditate, use whatever myths and stories help get you through, that help you understand and deal with the human experience.

      But concluding from that, that the metaphysical dogmas associated with whatever you practice have anything to do with objective consensus reality, is a fallacy. "I chanted Hare Krisha and I felt better about my life" doesn't mean that the ISKCON's allegations that the Apollo missions were faked, since the Vedas state that the Moon is farther from the Earth than the Sun, hold any water.

      There is only one truth and being "open" to other ideas is completely contrary to having faith.

      When dealing with subjective reality, there are billions of truths, because there are billions of subjective universes. You're entitled to your own.

      For objective reality, there may be only one truth; blind faith is no way to arrive at it. Only by being open to and examining different hypothesis can we get closer to the truth.

      If your faith commands you to not look at other ideas, then quite frankly your faith is stupid.

      --
      Tom Swiss | the infamous tms | my blog
      You cannot wash away blood with blood
    412. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Umm... Acceptance of evolution and faith in a higher power are not mutually exclusive. Just ask the Catholics.

      Evelution and a litteral interpretation of Creation ARE mutually excslusive. Don't be an asshat and try having it both ways.
    413. Re:In unrelated news... by bendodge · · Score: 1

      "History is bunk." -Henry Ford

      --
      The government can't save you.
    414. Re:In unrelated news... by shaitand · · Score: 1

      'Observations are trivial truths, and such truth only exists for the observing individual.
      They meaningless until they are incorporated (whether to prove/disprove/develop) into some sort of theory.'

      Technically any truth exists only to the individual. Some would say the difference is that other people corroborate your observation or truth but your awareness that others have done so and indeed the existence of the others at all is merely observation.

      Individually observations are trivial truths although they are the most substantial truths that exist. And indeed, they are useless (not meaningless, you base theories on the implied meaning of the observations) for anything but the formation of a theory. Then again, theories are both meaningless and useless if they are not based upon those trivial truth observations.

      Theories and Observations are both useless without one another. None of that changes that observations are facts, theories exist to coax more repeatable observations and that observations are the only facts that exist.

    415. Re:In unrelated news... by Mr.+Slippery · · Score: 1

      I find it disappointing how many people miss that love is a series of chemical reactions, or are uncomfortable discussing it as such.

      Love is a subjective experience, the objective physiological correlates of which are certain types of chemical reactions.

      To say love is this set of chemcial reactions is the same sort of error as saying that the number 17 is a certain pattern of beads on an abacus or of charge in my computer's circuits.

      --
      Tom Swiss | the infamous tms | my blog
      You cannot wash away blood with blood
    416. Re:In unrelated news... by cyphercell · · Score: 1

      Our political and social leaders have failed us, have you noticed how it was okay for your 7th grade earth science teacher was allowed to talk about evolution but your collegiate level physics instructor will deny belief in order to avoid a lawsuit?

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    417. Re:In unrelated news... by megabulk3000 · · Score: 1, Funny

      Hobo sapiens is what, like some smart guy who hops freights?

    418. Re:In unrelated news... by shaitand · · Score: 1

      Or, like every other religion. It is a tool used to exploit, control, and herd primitive peoples. I just find it depressing that there are still so many primitives that believe it today. I mean seriously, there are bible stories that every bit as ridiculous as the most hokey of Greek mythology. You have spirits, you have Egyptian wizards (who the bible claims had actual powers, moses just had greater powers) you have sea monsters, psychics, giants, talking snakes, flaming bushes, people rising from the dead, walking on water, the sick being healed, etc.

      Those make for great stories but where are any of those things today? You have no real psychics, wizards, witches, witchcraft, giants, talking animals, no magic, no blind men being healed by supernatural forces, no prophets, no flaming bushes, Nada, zip, zilch, not one provable miracle in the age of science and information. There is absolutely no credible reason to believe that any of those things ever existed outside of creative imaginations. What is the difference between then and now? Dissemination of information is it. It is difficult to perpetrate a substantial hoax in this age of increased awareness.

      Today Jesus would be another David Blane or even the homeless guy carrying a sign in the subway.

    419. Re:In unrelated news... by Mr.+Slippery · · Score: 1

      if those of use that do believe in God are wrong what do we have to lose? However if you are wrong and there is a God...well then my friend there is hell to pay.

      Pascal's wager is crap. First its assumes that one can choose one's beliefs regardless of evidence. Second it ignores that problem of multiple contradictory dogmas about god(s). Third it assumes that blind faith is rewarded - what is there's a god who rewards skepticism and intellectual rigor? Finally it assumes that belief has no cost, but holding beliefs in the absense of evidence is inherently intellectually corrosive.

      It's also just a "might makes right" argument. If there was a being that condemned sentitent beings to afterlives of eternal suffering, it would be my ethical duty to resist this evil being, not to worship it. It's not possible to earn eternal suffering in a finite lifetime.

      --
      Tom Swiss | the infamous tms | my blog
      You cannot wash away blood with blood
    420. Re:In unrelated news... by Anonymous Coward · · Score: 0

      I know a guy who calls himself a "Creathiest." You can pronounce it either Crea-theist, or Cre-athiest, depending on which mood you are in.

      It's the believe that the universe is God, or that God is at least no smaller than the universe we know so far, and thus profound respect, veneration, love, and appreciation for the universe, as we grow in our understanding of it as humanity, is utterly admirable, and fully complete; That God is a proper name for the Universe, (it's that amazing,) but if you want to consider it Godless, because there are no angel fairies as far as we can see, that goes too: It's all Creatheism.

      That's how he preached it to me, at least.

      He likes to preach that the traditional religious concept of God is notable for it's smallness, and it's tininess: That the concept that God battles over a small tiny planet, given that there are uncounted many galaxies in (merely) the observable universe, the actual universe we have no concept of it's true size-- that that old God, with his 10,000 year old world, is so pitifully small. That evolution should be rejected, because of the long duration, and myriad transformations of matter between forms, in favor of a little itty bitty story, ... It didn't make much sense to him.

    421. Re:In unrelated news... by onlyfacts · · Score: 1
      Agreed that the origins of life and how we are designed is very complex and any theory will have gaps. However, one must also step back on any theory and give it a bit of a sanity check to see if it is worthwhile. The so-called theory of macro-evolution requires that I have enough faith to believe that if I put all the parts of a watch in a bag and shake it long enough it will assemble itself through ever accumulating random patterns into a completely functional unit that keeps times accurately. This is just insane and time to move on to other theories that have a bit more facts and a lot less wishful thinking.

    422. Re:In unrelated news... by ResidntGeek · · Score: 1

      You compare trusting a method discovered, fully described in terms of known nuclear structure, and used by countless thousands of scientists for half a century to believing the words a pissed-off Jew wrote a couple thousand years ago, because you "experienced God's grace"? You are what is wrong with the world.

      --
      ResidntGeek
    423. Re:In unrelated news... by niXcamiC · · Score: 1

      Did you ever wonder why bunny rabbits only exists in people's houses? (Hint: It's because monks bred them from wild rabbits until they became a new species, incapable of surviving in the wild.

      Some would argue as to whether or not loosing the ability to survive in the wild is evolution.

      --
      Chances are any disscution on Slashdot will degrade into a flamewar about ID/Christianity within 14 posts.
    424. Re:In unrelated news... by Anonymous Coward · · Score: 0

      I have to get out the klaxon.

      Darwin's book was entitled, "On the origin of species by natural selection".

      Natural selection is what you describe here. It is an undeniable fact. Put pressure on a group and only the strongest will survive. Look at the phenomenon of gigantism in the late Cretaceous - critters kept getting bigger because the other critters got bigger.

      The BIG leap in faith you are taking is that this group of critters turned into another type of critter. Despite our years and millenia of breeding horses and dogs, they still come out horses and dogs. Despite thousands of irradiated generations of fruit flies, they still keep having fruit fly babies.

      In this regard, evolution, not natural selection, is a theory.

    425. Re:In unrelated news... by miscz · · Score: 1, Insightful

      At the time Jesus was living he could supposedly do amazing stuff, make dead people alive, change water into wine and he couldn't explain shit? Did he have to resort to vague stories that could mean anything? We're talking about stuff that human being can understand after all. This doesn't make sense, your religion sucks. The methapor thing is the way church wants to stay relevant.

    426. Re:In unrelated news... by kripkenstein · · Score: 1

      Acceptance of evolution and faith in a higher power are not mutually exclusive. Just ask the Catholics.
      I have always thought this, and respected Catholicism for it. Yet TFA says

      Seventy-three percent of Evangelical Protestants say they believe that God created humans in their present form within the last 10,000 years; 39 percent of non-Evangelical Protestants and 41 percent of Catholics agree with that view.
      Odd, given that the official position of the Catholic Church contradicts that view? Or am I missing something?
    427. Re:In unrelated news... by Anonymous Coward · · Score: 0

      This particular statement is one that shows a clear misunderstanding of how evolution works.

      Evolution doesn't state `oh, these things will happen randomly, and after sixteen thousand random combinations happen, we will magically have a working whole, just because'.

      Evolution states, `things will happen randomly. Some will serve a purpose. These things will stay. Then other things will happen randomly. Some of these will also serve a purpose. These will also stay. Eventually, we will get X larger whole that achieves *this* purpose (one not necessarily directly related to the original purposes of the various parts that make it up).'

      Every step of the way in evolution is reinforced by *usefulness*, or at the very least not-hurtfulness. Shaking up a bag with watch parts doesn't mean that every time two parts that are supposed to fit together in the end come together, they stay together. Even if it did mean this, that's *still* a misunderstanding of evolution, because it implies that you are working towards a target goal, which is not how evolution works.

      Evolution is random, insofar as the mutations are random. The effect over time, however, is tailored specifically to give a species advantages. Random, non-useful mutations disappear. This is the foundational concept of evolution.

    428. Re:In unrelated news... by ozmanjusri · · Score: 2, Insightful
      Why is people believing in god such a big problem for some?

      It tells us you are prepared to reject empiricism and make a leap of faith.

      Thought Experiment:
      My project depends on strict conformance to logic and evidence in order for me to be certain of success, and I have two candidates seeking employment.

      One candidate has demonstrated that they will base major life decisions on their belief in an invisible supernatural entity.

      The other candidate has demonstrated that they will use logic and observation to drive their decisions.

      Which would be the greater risk to the project?
      Which should I employ?

      --
      "I've got more toys than Teruhisa Kitahara."
    429. Re:In unrelated news... by darkwhite · · Score: 1

      You understand that you're a bit like someone who knows no programming at all trying to explain, oh I don't know, cache locality patterns in callback functions under virtualization? Or claiming that the Linux kernel can conceivably be obtained by streaming /dev/urandom into a file?

      Sure, a complete archaeal organism (the genomic DNA alone is insufficient for propagation) could arise by chance. But the probability of this event occurring in our universe's lifetime, in its physical configuration, is infinitesimally small. Instead, the (very weak) consensus is that life was born as a self-replicating ribozyme, a string of nucleic acids that gains function by folding upon itself. The thousands of details of how life progressed to and past that step to a population of robust organisms that archaea are, are still very unclear.

      The origin of life is one of the hardest problems in molecular biology. The vast majority of evolutionary increments we have observed between organisms are easily explained on the molecular level. Spontaneous origin of life by no means is. And claiming that "it just happened by chance" in evolutionary molecular biology is absurdly simplistic.

      --

      [an error occurred while processing this directive]
    430. Re:In unrelated news... by Alsee · · Score: 5, Insightful

      I hope people don't blindly push evolution like some people blindly push religion.

      I'm sure that there exist people blindly pushing evolution, just as there are people blindly opposing evolution. The important question is, what do the non-blind people see and say about it? You don't need to understand quantum mechanics to be able to make a reasonable first pass at sorting out who does and does not have a PhD in quantum mechanics and is or is not professionally working in the field at prestigious international physics lab. You do not have to be a rocket scientist to be able to figure out who has a PhD engineering degree and is professionally employed at NASA or one of the other national space agencies as a rocket scientist.

      Newsweek magazine 29 June 1987, Page 23: "there are some 700 scientists (out of a total of 480,000 U.S. earth and life scientists) who give credence to creation-science, the general theory that complex life forms did not evolve but appeared 'abruptly'". That works out to 685-to-1. And what would be the common slang term for a minuscule fraction of one percent scientist who is considered "non-credible" by the other 99.85% of the professional credentialed scientific community? That term would be "crackpot". Approximately one in 685 earth and life scientists fundamentally rejects evolution, approximately one in 685 credentialed earth and life scientists is a crackpot. There seriously does not exist any genuine controversy over the basics of evolution in the scientific community, no genuine controversy amongst the "non-blind", amongst the people who have actually dedicated their lives to studying the subject in school getting a degree and actually analyzing and challenging the evidence.

      I'm just a regular programmer type guy.

      Excellent! Seriously, excellent! I too am "just a regular programmer type guy", and there are few people as well equipped as us to cure "blindness" on evolution directly see just how powerful it is, to witness first hand that it in fact does work. While people generally look at evolution as a physical biological process, it is more fundamentally a mathematical process and an information processing process. Essentially any system possessing the four properties of (1) replication (2) inheritance of traits (3) mutation of those traits and (4) selection, essentially any such system will exhibit the evolution process. Those four traits pretty well define the necessary and sufficient conditions to enable and ensure evolution to occur. There is an entire sub-field of computer science dedicated to evolutionary algorithms and genetic algorithms. Algorithms to harness the information processing power of evolution, to harness the information creating power of the evolution process.

      As a programmer, you really should explore evolutionary algorithms and genetic algorithms. They are critical algorithms that seriously should be in the "toolbox" of any sophisticated programmer. They enable a programmer to tackle and solve certain classes of programming tasks and problems that are virtually impossible to solve in any other way. You wouldn't want to use evolutionary algorithms / genetic algorithms on most kinds of routine programming tasks, they are entirely inappropriate for the vast majority of programming tasks, but where they are appropriate knowing these algorithms expand your range and can give you the ability to program for otherwise "impossibly hard" problems. In fact more than half of all Fortune 500 companies apply these sorts of algorithms somewhere or another in their business.

      You can use DNA analysis in a court of law to map out a family tree way beyond any reasonable doubt. You can use DNA analysis in a science lab to absolutely establish and map out evolutionary family tree of species in the exact same way and with the same "beyond any reasonable doubt" absolute certainty. You and I are not laboratory DNA analysis experts, but if you take the time to look at the qualified experts in the field they will 9

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    431. Re:In unrelated news... by Alsee · · Score: 1

      We came from apes. Apes came from monkeys. Monkeys came from lemurs. Lemurs came from rodents. Rodents came from some earlier mammal. That mammal came from reptiles. Reptiles came from amphibians. Amphibians came from fish.

      Ha HA! Evolution is wrong, it's all a lie. It's right there a hole in your so-called theory of evolution. The non-existant "missing link". "Rodents came from some earlier mammal - that proves it all wrong... some magical "some earlier mammal" that doesn't exist. Evolution is just scientists trying to push their own glorified religion... you just have FAITH that there existed "some earlier mammal" to link between rodents and reptiles. Religion religion religion.

      P.S.
      #include <humor.h>

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    432. Re:In unrelated news... by Profound · · Score: 1

      Look, you can have your beliefs, but trying to justify bronze age stories with modern science is not going to end well. You'll eventually get to some fact then say "god did it" or "God changed things so it looks like that" there's not much point.

      If you hadn't been raised a Christian, and your community wasn't Christian, and you went to the Grand canyon, you probably wouldn't have thought "I bet this was made in a day!"

      >> the evidence for a world wide flood

      Where did all the water come from? I remember someone working out that science said this was impossible, because as water transforms from gas -> liquid, heat is released (the opposite of the cooling you get from evaporation, eg sweating) the amount of heat released for that amount of water would have killed the entire planet.

      Also, Noah must have had a very very large ark (carrying, eg, gum trees for Koalas and huge amounts of specialist meat for carnivores), and we are inbred descendants of his family, who must have been carrying all diseases and viruses known to man.

      >> the idea of the Grand Canyon being formed in a day

      What would be different about it if it was formed in a day vs over millions of years?. Can you point that out then we'll look at how it is today, and make judgement on whether it's possible.

      I've been there, and it looks like that stream at the bottom slowly wore it away into the earth. I remember the stream being quite small, it looks like it would take mroe than a day!

      >> lack of lunar dust

      Please go into more detail.

      >> speed of the Earth's rotation

      Please go into more detail.

    433. Re:In unrelated news... by Profound · · Score: 1

      Don't listen to the blasphemer. The Power Rangers are merely a misled sect who have brainwashed a generation so they no longer accept the truth - which is that the Autobot-Ninja turtle alliance is the true force of good in the world.

    434. Re:In unrelated news... by onlyfacts · · Score: 1
      My simple overview of evolution was essentially correct, time + matter + chance and poof you have "the next best thing" in a long line of other things which get increasing more complex.

      Here's the flaw in evolution - the great anti-designer theory - you quote exactly what other evolutionists state, the whole concept of *usefulness*. Tell me, how does dirt make a decision? How did the first few molecules of stuff decide that one feature was more desirable than another. If a cell splits and produces some kind of variant DNA (not new genes of information mind you, no one has been able to explain how that could happen yet), how does "it" decide that the new DNA is better than the previous DNA? What is "it"? How did "it" decide? In a purely random manner, "its" decision making process should be completely random. If I flip a coin 10,000 or 1 billion times, I will invariably end up with about 50% heads and 50% tails, therefore not making any progress in any direction - try it, you CAN reproduce this fact.

      Of course we can stray into irreducible complexity, but you evolutionists don't like to discuss that since you just state that if you work backwards just enough in the smallest of increments over billions of years you might be able to work around this sticky problem. Not! You still end up with some kind of inherent designer doing some kind of decision making about what is the next best *useful* iteration - dirt doesn't have brains!

      There is also the problem of the Second Law of Thermodynamics and as well the scientific principle that all things tend to degrade over time - completely opposite of the evolutionary logic. Funny though that the first two things mentioned are observable and reproducible, the latter is not.

    435. Re:In unrelated news... by Alsee · · Score: 1

      "genetic programming"... That's very hard to implement though, I haven't seen any application outside of research for this yet.

      Genetic programming is a sub-field of genetic algorithms. I cannot say for certain whether genetic programming is being applied outside of research, but I can tell you that more than half of all Fortune 500 companies make real and valuable use of digital evolution (genetic algorithms) somewhere or another within their business.

      Genetic algorithms would be evolution being preformed on internal things by code, and genetic programming would be evolving code itself. Sometimes there can be an extremely fuzzy line between "active data" and "code", and it can sometimes be hard to define whether the thing you are evolving is itself software code.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    436. Re:In unrelated news... by Anonymous Coward · · Score: 0

      That original DNS sequence that started it all is the name of god.

    437. Re:In unrelated news... by jelle · · Score: 1

      First of all, evolution is not against religion or any church. Evolution is about a scientific theory supported by many scientific findings. The creation story can still be true, even with evolution happening around us. Unfortunately, too many religious people feel there is a conflict and are now in the U.S on a crusade against teaching science.

      The church is not 'against evolution' (see the vatican statement), but there are some very loud religious activists in the U.S. that are (and sadly, 48% of the people in the U.S. appear to be sheeps to the loudness).

      So.... A thousand years from now, people will say that the church never fought against science over evolution, those were mere fringe groups that did so... Sound familiar?

      "When was that?"

      Aristotle did not have the final verdict as far as the church was concerned. The earth being round was accepted by the church in exactly the same way that the vatican supports evolution _today_. Only people that will later be called 'minority' don't accept it.

      During the times of Saint Augustine and later Vergiluis of Salzburg for example. About the latter, the pope said "if it shall be clearly established that he professes belief in another world and other people existing beneath the earth, or in [another] sun and moon there, thou art to hold a council, and deprive him of his sacerdotal rank, and expel him from the church."

      Those 'another world', 'beneath the earth', and 'footprints above your heads' wordings in arguments surrounding 'antipodes' used by the church just shows that they did _not_ at all understand that the earth was round. Maybe they accepted it had a rounded top, but suggesting that there was anything like an other side, or people living there was blasphemy and got people in serious trouble with the church. According to the church, no people could live where we now know Australia is, because they would fall off, so nothing exists 'down there', and that was the scripture to be taught period.

      But, ehm, don't worry, after accepting evolution, they can simply deny they ever not accepted that either. Besides the vatican's statements, they can simply point to the scientific research just like they now point at maps with circles from the Romans and the fact that no respected scolars of the time disagreed and say 'See nobody doubted evolution ever'...

      Just like how now the Internet is filled with people claiming the church never said the earth was flat.

      Right now evolution is accepted in science. Scientist know it today. It's some very vocal religious people and their (unfortunately 48% of the U.S.) followers that don't accept it today... The antipodes story is very similar on that front.

      "Even the greeks knew the earth was round."

      In the middle ages a lot of previous knowledge was tossed out and forgotten. You know, things like sewer systems and little details like that. Religion thrived in the same period.

      --
      --- Hindsight is 20/20, but walking backwards is not the answer.
    438. Re:In unrelated news... by Alsee · · Score: 1

      Aha... and that goes for the entire scientific field of CHEMISTRY too. Because chemistry doesn't explain where the elements came from.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    439. Re:In unrelated news... by ceejayoz · · Score: 1

      Jumped the gun a little on April Fools, didn't you?

    440. Re:In unrelated news... by bdub1982 · · Score: 1

      The God referenced in the bible does, in fact, have a name.

      The Tetragrammaton is the usual reference to the Hebrew name for God, which is spelled (in the Hebrew alphabet): (yodh) (heh) (vav) (heh) or (reading right to left = YHVH, or with the Biblical Hebrew pronunciation, YHWH). It is the distinctive personal name of the God of Israel.

      In Judaism, the Tetragrammaton is the ineffable Name of God, and is therefore not to be spoken, except by the High Priest within the Holy of Holies in the Tabernacle and Temple in Jerusalem on Yom Kippur. In the reading aloud of the scripture or in prayer, it is replaced with Adonai ("My Lords", commonly rendered as "The LORD" in most modern English translations) or occasionally replaced with "Elohim" (GOD).

      Various English spellings of the Tetragrammaton include Iehouah [AD 1530], Iehovah [1611], and Jehovah [1769]. Yahweh, Yehovah, and Y'hovah are also used.

      The following works, either always or sometimes, transcribe the Tetragrammaton as Jehovah:

      -- The King James (Authorised) Version, 1611: i.e. four times as the personal name of God, and three times in combination names: Gen 22:14; Exodus 17:15; Judges 6:24
      -- The American Standard Version, 1901 edition, consistently renders the Tetragrammaton as Je-ho'vah in all 6,823 places where it occurs in the Old Testament.
      -- The New English Bible, published by Oxford University Press, 1970, e.g. Gen 22:14; Exodus 3:15,16; 6:3; 17:15; Judges 6:24
      -- The Living Bible, published by Tyndale House Publishers, IIlinois 1971, e.g. Gen 22:14, Exodus 4:1-27; 17:15; Lev 19:1-36; Deut 4: 29, 39; 5:5, 6; Judges 6:16, 24; Ps 83:18; 110:1; Isaiah 45:1, 18; Amos 5:8; 6:8; 9:6
      -- The New World Translation of the Holy Scriptures, published by the Watchtower Bible and Tract Society, all editions, consistently renders the Tetragrammaton as Jehovah in all 6,823 places where it occurs in the Old Testament.

    441. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Even if it doesn't become believable to people personally, they start thinking that other people could reasonably believe it, since they hear so much about it.

      Sadly, propaganda works, and the methods of making it work are simple and well-understood.

    442. Re:In unrelated news... by asninn · · Score: 2, Insightful

      Challenging established theories is certainly an important part of the scientific method, but I think it *is* justified to say that certain things are actually *true*, even when they can't technically be completely proven.

      Take gravity, for instance. Our understanding of gravity certainly has evolved (no pun intended; I think scientific progress itself is a perfect example of an evolutionary process), and we don't even HAVE a complete theory of gravity right now (IANAP, of course - I am not a physicist -, so please bear with me if I spout rubbish), but nobody would actually dispute that gravity exists, for example.

      I think evolution is similar. Of course, evolution isn't a force of nature in the same way that gravity is, but the basic idea is so obviously correct that I don't see how anyone can reject it; and in fact, even the most rabid creationists do not seem to reject "microevolution", either (which conveniently allows them to benefit from new antibiotics, for example). (Of course, the distinction between "micro-" and macroevolution" is really artificial, so the only way I see how you can believe in one but not the other is to believe that the Earth is literally only a couple of thousands of years old, as some people apparently do. But then you've got other things that you need to account for, and ultimately, you end up with a fragile, artificial construct that only rests on a foundation of "it's like this because god made it this way". But I disgress.)

      In any case, you're absolutely right that we should question our theories - even to the point of questioning evolution itself if data arises that provides some initial evidence that it might *possibly* not be happening. But that doesn't mean we can't still think of it as *true*.

      --
      butter the donkey
    443. Re:In unrelated news... by MPolo · · Score: 1

      This confused me for a long time, so perhaps you have the same misunderstanding. Most Catholics (including the last two Popes) who speak of Intelligent Design are not referring to the same thing that most Fundamentalists refer to as Intelligent Design. The Catholic Church specifically leaves it open to the believer and to science to discover the mechanism through with God's creation and design came about. I think you will find that most Catholics (who have some education) accept some amount of evolutionary theory, although they may dispute the mechanism of selection and the like. In my experience, there are very few Catholics who subscribe to the 10,000-year-old earth theory. It comes very naturally to use the term "Intelligent Design", which seems to only contain the idea of an intelligent creator and his plan for the universe in it. (I see that the article says that 41% of Catholics say that the earth is 10,000 years old and that man was created at the same time... For that I have no explanation, but would like to see the exact wording of the poll, as all the numbers strike me as high.)

      Unfortunately, the term has been co-opted by the creationist movement, which was apparently seeking a term that would be more "sellable" to the general public, so that "Intelligent Design" usually includes a literal interpretation of Genesis in the final analysis. Unfortunately, the Pope's statement was also taken up by the creationist crowd, but if you look at what he actually said, there is nothing that rejects evolution per se.

    444. Re:In unrelated news... by asninn · · Score: 1

      No, it's not. The molecules in your brain form... well, a brain. Love may be an emergent product of the chemical/physical processes in the brain, but it's not made up of the molecules that form the brain. Claiming that is like saying that shininess is made from gold.

      --
      butter the donkey
    445. Re:In unrelated news... by asninn · · Score: 1

      That's easy to explain, too. Just ask them if they have ever travelled to another city (/state/country), for example.

      If they did (and who hasn't), then tell them that it's impossible; after all, at the start of their journey, they were in city A, and at the end, they were supposedly in city B, but you can't just teleport from one city to the other. If you do this, they will likely tell you that they, well, *travelled* from A to B; that they got into their car (for example), drove off, and spent a couple of hours on the road, slowly getting from their origin to their destination.

      If they're smart, realisation should probably start to sink in by then. If not, you can always give it a nudge until it does.

      --
      butter the donkey
    446. Re:In unrelated news... by OriginalArlen · · Score: 1
      There are three main factors that result in this statistic:
      • ignorance
      • stupidity, and
      • nothing else.

      ((c) Douglas Adams 1979)

      --

      Everything I needed to know about life, I learnt from Blake's Seven
    447. Re:In unrelated news... by Copid · · Score: 1

      No, I'm not saying you should believe in God because its the safe choice. You should never believe in something based on one reason and one reason only. However, there are some reasons that outweighs others, and when it comes down to believing in God because you don't want to go to hell or not believing simply because you want to live life however you want to and not live under certain rules, you should really think about your choices.
      How do the consequences of a fact make it more or less likely to be true? The only reason I "believe" in something is because I think that it is likely to be true. I can't believe in something that I think is not likely to be true, essentially by definition of belief. Perhaps it would be fun or rewarding for me to believe that somebody has deposited $100M into my bank account, but that doesn't have any bearing on the truth of the idea, and I doubt I'd be able to convince myself of it.

      Also, it does matter in what God you believe in and whether you believe in one over the other. Hindus and Christians very greatly in their beliefs. Even the differences between the Jewish faith and Christian faith makes a large difference. I mean if you were to have you son go through unbearably amounts of pain for someone to live wouldn't you want that person to at the very least say thank you? Or if you told someone to follow certain traditions as a price for eternal life? Or if you told your people to pray 5 times a day and go on a pilgrimage once in there life in order to get to live in paradise? Ideas are different in each religion and whichever God is the true God he has all the right to judge someone based on their belief in said God.
      In that case, I'm likely to believe in the god or gods who appear to be most vindictive. I don't want to piss those types of gods off The kind and forgiving gods can wait in line while I pray to the gods who will roast me over the coals for upsetting them.
      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
    448. Re:In unrelated news... by houghi · · Score: 1

      Actually, I've run into a lot of people who have problems with evolution even though they aren't Christian or religious.


      I have problems with Perl, but that doesn't say anything about Perl, it just tells me about my ability to understand it. The same thing I see with people who have problems with evolution. That does not mean that evolution is the wrong way. It just means that those people do not understand it.

      And that is perfectly ok. You still see people saying we are decendents from monkeys and we are not. We just have a common ancestor.

      There also is no reason as not to be a believer in $DEITY and a believer in evolution.

      The Bible was written after a lot of word of mouth. Here is the order of the days of creation:
      Day 1: The heavens, the earth, light and darkness.
      Day 2: Heaven
      Day 3: Dry land, the seas, and vegetation.
      Day 4: The sun, the moon and the stars.
      Day 5: Living creatures in the water, birds in the air.
      Day 6: Land animals and people.

      Change day 3 and 4 and use a period, instead of a day.
      Period 1 is the big bang.
      Period 2 is the expantion after the big bang
      Period 4 is the formation of the planets
      Period 3 is the formation of this planet so it becomes inhabitable
      Period 5 is the formation of sealife
      Period 6 is the formation of land-life

      Exept for the swap of 3 and 4, it looks pretty similar to me. To me one does not exclude the other. This is not an OR/OR situation, this could be an AND/AND situation.

      It is probably obvious that I am an agnost.
      --
      Don't fight for your country, if your country does not fight for you.
    449. Re:In unrelated news... by KDR_11k · · Score: 1

      Besides, an all-knowing and all-powerful creator god would have been able to impart that knowledge if it had wanted to do so.

      Perhaps he just got fed up playing tech support for all the millions of users of his product that won't even RTFM. "No ma'am, that is not a pizza you're standing on, no, it's not edible and no, throwing yourself off a cliff won't put you into cotton candy land."

      --
      Justice is the sheep getting arrested while an impartial judge declares the vote void.
    450. Re:In unrelated news... by Anonymous Coward · · Score: 0

      So you prefer "a wizard did it" as an explanation?

    451. Re:In unrelated news... by bckrispi · · Score: 1

      No, I'm not saying you should believe in God because its the safe choice.
      Any god who would damn me for using the mind he allegedly 'gifted' me with to show the modicum of critical thought required to challenge his existence is certainly no god worthy of worship or even fear.

      That god can lick my asshole.

      --
      Xenon, where's my money? -Borno
    452. Re:In unrelated news... by catprog · · Score: 1
      --
      My Transformation Website
      Kindle Books http://www.catprog.org/rev
      Interactive CYOA http://www.catprog.org/st
    453. Re:In unrelated news... by houghi · · Score: 1

      Given the chance, they would gladly do that - it's just that it's a little hard in this day and age to get away with doing stuff like that.


      Just watch the news. There is a difference. In the middle ages, witches were tortured to confession, now they don't ..., never mind, just watch the news.
      --
      Don't fight for your country, if your country does not fight for you.
    454. Re:In unrelated news... by fyngyrz · · Score: 1

      ...and the classic "History is written by the winners."

      --
      I've fallen off your lawn, and I can't get up.
    455. Re:In unrelated news... by Copid · · Score: 1

      That, my friend, is a can of worms. There are a great many problems with carbon dating in particular. I'll leave it up to the scholarly of you to look it up, but isn't the 'benchmark' for carbon dating, carbon dating itself?
      Well, no, it's not. Thanks for asking, though.

      When you ask a lab to date an object, why does the form ask you what age you 'think the object is', isn't this technique solely based on the speed of light never changing?
      It's based on constant rates of radioactive decay, which has consequences for the speed of light. Fortunately, evidence indicates that those constants are pretty darned solid.

      Isn't the actual range of carbon dating only a few thousand years due to our ability to measure after a few half lives, yet we use it for millions of years...
      It is only good for a few tens of thousands of years, yes. And NOBODY uses it for millions of years. Full stop. Where do you get this stuff?

      Wasn't there a case where the carbon dating of an animal's bones showed that it was many magnitudes of age older than the very hair found by the animal (I think it was a tiger, IIRC). Doesn't carbon dating yield results in opposition of something around 94% of other dating techniques?
      Do you usually pull unsupported anecdotes and random figures out of your ass to cast doubt on a position you disagree with, or is radiometric dating a particularly touchy subject for you?

      Anyone sufficiently versed arguing can convince you of most anything. To be honest, I don't have any of the answers, and I don't pretend to.
      You don't seem to have the most basic facts about the topic you just "threw your hat into the ring" on. Millions of years? What? You're clearly parrotting something you read on the web somewhere, but it's pretty clear that you haven't done your homework. You might want to start here.

      The reason I'm sounding so grouchy about this is that you're casting aspersions at a lot of professionals here, and it's pretty obvious that you're out of your depth. It's kind of a rude thing to do. It's also clear that you're not looking for answers to your questions (although you clearly don't seem to know the answers), but rather trying to muddy the waters with accusations phrased as questions. That's not especially nice either.
      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
    456. Re:In unrelated news... by Anonymous Coward · · Score: 0

      >I hope people don't blindly push evolution like some people blindly push religion.

      Not really, let me explain what the GP said, which goes to answer what you just said.

      Scientists are not "blindly" pushing Evolution. Evolution is as widely accepted as gravity, to put an example. But what does that mean? Take Newtonian mechanics, they're widely, even today, accepted, but we know they're not exact, but an approximation of a more general law. Evolution is in the same wagon, it's entirely possible that evolution may one day be shown to be part of a more general phenomena, but that won't really prove it "wrong", in the sense that Newtonian mechanics aren't wrong, just incomplete.

    457. Re:In unrelated news... by catprog · · Score: 1

      If I have a mutation that means I can get more energy from food then you. I need less food means more time to pass on my genes and therefore my genes have been selected over yours. OR 2 types of Moths a black and a white. When most trees are white the black moths are eaten. When a new factory is built that makes the trees black through smoke the white moths get eaten. 'dirt does not have brains' and dirt does not change. Second Law of Thermodynamics: How much chaos did you create to produce offspring (including random energy like heat) "irreducible complexity" http://en.wikipedia.org/wiki/Irreducible_complexit y The examples offered to support the irreducible complexity argument have generally been found to fail to meet the definition and intermediate precursor states have been identified for several structures purported to exhibit irreducible complexity.

      --
      My Transformation Website
      Kindle Books http://www.catprog.org/rev
      Interactive CYOA http://www.catprog.org/st
    458. Re:In unrelated news... by Anonymous Coward · · Score: 2, Insightful

      but nobody would actually dispute that gravity exists, for example Gravity was never the issue. Gravity is the hypothesis, it is the observed action we see. That is like saying that when investigation how light works that we are talking about proving whether light exists or not. Light is the label on the observation we see. Of course that observation exists because it is...observable. With gravity it is how the relationship works not that the relationship exists at all. It is the same thing with Global Warming. Global Warming is an observed action. Temperature rising across the globe? The cause for debate is WHY.
    459. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Beautifully written. Essentially, you're saying that DNA 'programing' was done by the worst Microsoft programmers! Hmm... you a programmer and your sis a geneticist... I could stand talking to you two over drinks! (I'm a MIS pro w/ a degree in Anthropology who dabbles in physics.)

    460. Re:In unrelated news... by Copid · · Score: 1

      ". . . Large changes such as speciation are mearly [sic] the sum of smaller changes over time."
      Which is considered, albeit without 100% consensus in the scientific community, to fall under the umbrella of microevolution.
      Which, speciation or "the sum of smaller changes"? And how, exactly, did you come to that conclusion?
      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
    461. Re:In unrelated news... by Gazzonyx · · Score: 1

      Listen, dude, I've clearly hit a nerve; it wasn't my intention.
      I did just fire a post off from my hip, in the heat of the moment and I clearly do need to do my homework. I am quite a bit out of my league and in over my head.
      Anyways, I also didn't mean for the tone of my post to be accusational, although, I could see how it could be taken that way.
      I'm truly sorry if I've rubbed you the wrong way. My (no sarcasm) sincere appologies.

      --

      If I mod you up, it doesn't necessarily mean I agree with what you've said, sorry.

    462. Re:In unrelated news... by fyngyrz · · Score: 1
      What I am referring to is deeper than your sadly shallow point of view

      Gullibility, fear of the unknown, and the need for a parental figure often are. These very deep feelings don't limit themselves to the uneducated or the unintelligent; people with every level of cognitive ability, every level of education, and every degree of communications skills are subject to the overwhelming pressure brought to bear by one of these, or various combinations of more than one. Add in the joy of participating in group-think, and you've got a social abscess in the making.

      The bottom line is that things are what they are, and no degree of belief will change the underlying natural facts. That's the sad news for worshippers; as someone else mentioned up above, the belief that the sun spun 'round the earth by nearly the entire population did absolutely nothing to alter the reality, and eventually, the reality won over the preconception - no matter the degree of belief. The same will happen with your "god", only unfortunately, it'll take long enough - like the sub belief - that you will almost certainly waste your entire life following an illusion.

      Unfortunately, as a social force, religion does a great deal of harm, serving to retard morals (by promoting homophobia and misogyny for just two examples) and promote laws that are harmful or progress-retarding for society. The rest of us put up with the social retardation religion spills all over everything in the name of tolerance, because we know that tolerance has a higher social value than getting rid of religion does. Until religion really gets out of hand, of course. No one is going to put up with an actual theocracy in the USA; we're too close to that as it is.

      Anyway, don't worry about your deep feelings. You probably can't change your situation, and the rest of us will tolerate your delusions just so long as you keep your nose out of our lives in terms of laws and so forth.

      --
      I've fallen off your lawn, and I can't get up.
    463. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Because they were taught Evolution (note the capital E) in high-school biology class, and they learned it on faith. So when they feel their faith is under attack, they lash out.

      That might actually be true of some Slashbots, but when actual scientists get involved, it's not an issue of "faith in evolution" vs. "faith in the Bible." If anything, it's faith in the ability of critical thinking and the scientific method to sort through what evidence is found, come up with an explanation, and see if the explanation fits.

      The history of science is full of cases where new evidence was found, or new explanations were given for existing evidence, leading to new theories replacing old ones. The heliocentric solar system replaced the geocentric one because it better explained the observed motions of the planets, sun and moon. Elliptical orbits replaced circular orbits for the same reason. Plate tectonics. Relativity.

      Okay, there is one more kind of faith involved: faith that the evidence you're working from (both first-hand and second-hand) is reliable. When you get into the idea that God created the world thousands of years ago to look like it was billions of years old, you've just set up God as Descartes' Great Deceiver, at which point you can't trust anything you see, hear, feel, smell or taste, including speech and writing.

    464. Re:In unrelated news... by jericho4.0 · · Score: 1

      Damn right! I'm sick of living in a world run by people who belive in leprechauns and fairys, or the logical equivalent, and I applaud your frontal attack on such.

      --
      "A language that doesn't affect the way you think about programming, is not worth knowing" - Alan Perlis
    465. Re:In unrelated news... by alphamugwump · · Score: 1

      I'd argue that science isn't really about finding the "truth"; it's about producing useful models. Otherwise, you can't get around Descarte's demon. So, even though a model might be wrong, it is usually still useful. I mean, look at how widely used newtonian mechanics is.

      But yeah, it does usually give the right answers.

    466. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Essentially you are right, but US-Americans are trying very hard to achieve this.

    467. Re:In unrelated news... by Copid · · Score: 4, Informative

      Here's the flaw in evolution - the great anti-designer theory - you quote exactly what other evolutionists state, the whole concept of *usefulness*. Tell me, how does dirt make a decision? How did the first few molecules of stuff decide that one feature was more desirable than another. If a cell splits and produces some kind of variant DNA (not new genes of information mind you, no one has been able to explain how that could happen yet), how does "it" decide that the new DNA is better than the previous DNA? What is "it"? How did "it" decide? In a purely random manner, "its" decision making process should be completely random. If I flip a coin 10,000 or 1 billion times, I will invariably end up with about 50% heads and 50% tails, therefore not making any progress in any direction - try it, you CAN reproduce this fact.
      Simple answer: Selection is the result of different survivability of the two traits. If, for example, the cells live in a junk yard and one of the two child cells acquires a gene that allows it to "eat" nylon, then it's going to do a lot better than its sibling as it has a bunch of food available to it with very little competition for it. That cell reproduces like mad and suddenly you have a small population with a nylonase where one did not exist before.

      Of course we can stray into irreducible complexity, but you evolutionists don't like to discuss that since you just state that if you work backwards just enough in the smallest of increments over billions of years you might be able to work around this sticky problem. Not! You still end up with some kind of inherent designer doing some kind of decision making about what is the next best *useful* iteration - dirt doesn't have brains!
      IC isn't exactly the strongest of ideas to begin with (for example, there's no meaningful way to show that a structure is irreducibly complex), but it does have one fatal flaw: Even if it's not possible to take away a part of a system without destroying it, it's likely very possible to add a part and then take away one of the original parts without destroying the system. One might say that an arch is irreducibly complex because removing a stone from it makes it collapse. Does it follow that an arch can't be built? No. It simply ignores the fact that the precursor to the arch had more "stuff" attached to it (supports and scaffolding) than we see now. The arch didn't go from N-1 stones to N stones, because with N-1 stones it would have collapsed. It went from N-1 stones + supports to N stones + supports to N stones with no supports, creating the "irreducibly complex" structure we see today.

      There is also the problem of the Second Law of Thermodynamics and as well the scientific principle that all things tend to degrade over time - completely opposite of the evolutionary logic. Funny though that the first two things mentioned are observable and reproducible, the latter is not.
      I weep for the future of physics if this is the common understanding of the second law of thermodynamics. Please explain this to me: How does evolution violate the second law of thermodynamics but a seed growing into a tree not violate the law? What is the difference between the two. Bonus points if you use math or actually quote the second law in a meaningful way.
      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
    468. Re:In unrelated news... by servognome · · Score: 1

      Technically any truth exists only to the individual. Some would say the difference is that other people corroborate your observation or truth but your awareness that others have done so and indeed the existence of the others at all is merely observation.
      This could turn into a long (But interesting) philisophical discussion.
      I believe there is a universal truth, seperate from the "truths" of inviduals, though it is unknowable because of our limitations. Scientific method provides a structure for us to try and understand the truth, by rigorously cataloging and testing the sum "truths" of individuals.

      Individually observations are trivial truths although they are the most substantial truths that exist. And indeed, they are useless (not meaningless, you base theories on the implied meaning of the observations) for anything but the formation of a theory.
      I believe you have it backwards. Observations are meaningless - me dropping a bowling ball and observing it fall has no meaning. They are however useful - I can use the observation, alone or in combination with other observations to create an infinate number of theories.

      Then again, theories are both meaningless and useless if they are not based upon those trivial truth observations.
      All theories are based on some sort of observation, therefore are useful. Even completely fabricated conjecture is somehow based on the experience (personal observations) of the person who developed the theory. They may not shed light on the subject at hand, but they give insight into the thought process of humans.

      Theories and Observations are both useless without one another.
      Agreed

      --
      D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
    469. Re:In unrelated news... by catprog · · Score: 1

      Name one fact.

      --
      My Transformation Website
      Kindle Books http://www.catprog.org/rev
      Interactive CYOA http://www.catprog.org/st
    470. Re:In unrelated news... by frostband · · Score: 1
      I agree that most people are stupid, unfortunately. But I also think that if people were brought up in homes and schools that "believed" (and I used the term loosely) in evolution, then most people would take evolution without any basis (as they take creationism now). It's all part of cultural conditioning.


      Here's one example to illustrate: if you're a Repub/Demo, it's likely based on your parents' position (or the dominate parent's position) with little or no thought on your own.

      I think the same thing would happen if all parents "believed" in evolution (rather than truly knowing it is "correct").

    471. Re:In unrelated news... by Anonymous Coward · · Score: 0

      i disagree with you, the idea that you cant be different from your parents its totally idiotic. not only does it totally ignore the concept of free will, which is convenient if you dont believe it exists, but it totally ignores any system where two parents are of different backgrounds. it also ignore any events that may occur in ones life.

      its a flawed viewpoint, and this is the intellectual snobbery crap that pusses the idiotic and unwashed masses away from science. its always like this on slashdot, something sounds like it should be right, but what is right is always better then what sounds right. when your model doesnt correlate with reality, reality isnt at fault.

    472. Re:In unrelated news... by init100 · · Score: 2, Insightful

      In fact, there is little to no direct correlation to designing anything electronic and man being the illegitimate son of a monkey.

      Except that both electronics and evolution are subfields of natural science. If you are prepared to reject evidence of evolution in biology, why not reject scientific evidence in physics (of which electronics is a subset) too if it goes contrary to your belief?

      Furthermore, the "man being the illegitimate son of a monkey" part says a good part of your picture of the fact that man descended from monkeys. Why is this so offensive to some people? I don't see why.

      It isn't like it is fact that evolution exists, we haven't witnessed it

      Yes we have, just not in the way the creationists try to misrepresent it. We have seen evolution happen in bacteria and viruses, and in animal domestication and plant horticulture. The creationists excuse this by calling it microevolution, while claiming that macroevolution (evolving a new species from another to the point that they cannot interbreed) does not exist. The difference between the two is just the timespan involved though, as macroevolution is just the aggregate of a large number of steps of microevolution. Arguing that we have one without the other is therefore absurd, which gives the creationists the credibility they deserve, i.e. very low, among the educated part of the population.

      Why is people believing in god such a big problem for some?

      Actually, believing in god is not the problem. The problem is rejecting evidence of and old earth and gripping for straws to fit the evidence into the creationists' world-view. Genesis could actually be a metaphorical description of the creation of the earth, and does not have to be at odds with the scientific evidence. It is all based on interpretation.

    473. Re:In unrelated news... by misanthrope101 · · Score: 3, Informative
      Scientific theories are unseated when a better explanation of the facts comes along, one that is better at predicting outcomes and so on. I think skeptics vastly underestimate the size of the mountain of evidence supporting evolution, and vastly overestimate the validity of the claims made by creationist, ID, or Fixed Earth type sites.

      That being said, your argument is a common one. The problem is that the evidence we have supports evolutionary theory, the counterclaims made by evolution skeptics (the bombadier beetle, and so on) were answered years or even decades ago. If other evidence came up, scientists would look at it. Evolutionary theory is constantly being revised, in that we are learning more about sexual selection, types of speciation, rates of change, and so on--it's quite an interesting field, even to a layman.

      Then you have a lot of noise from the predominantly (though not exclusively) religiously-motivated community who say that evolution isn't really science because common descent and so on isn't being challenged in the science journals. Even Behe, the ID bigwig, accepts common descent, because the evidence is so overwhelming. What skeptics want is a complete grounds-up reappraisal of common descent, natural selection, and so on, in spite of the fact that no data calls those things into question.

      The religious "skeptics" will never accept evolution, and for that matter will never accept methodological materialism, because they want their bible-based explanation taught as science. So much of the "skepticism" is just a PR campaign, as per the well-known Wedge Strategy.

    474. Re:In unrelated news... by alphamugwump · · Score: 1

      With a sig like yours, I don't know why I bother arguing with you, but...

      I personally know a bunch of religious people who are incredibly intelligent. For example, I knew this 16 year old homeshooler going to law school. He could argue the leg off a chair, without any evidence, either.

      It really just depends on how you were brought up. If you accept the bible as your standard of truth, there isn't really a whole lot you can do to argue with that. Their beliefs seems to make them feel better, and it doesn't really hurt anyone, so why not?

      It's when they start interfering with my life that it becomes a problem.

    475. Re:In unrelated news... by Anonymous Coward · · Score: 2, Funny

      but I'd expect you to try to compete with those who have some at least vaguely similar oportunities)


      Now now, that's not the American way.
    476. Re:In unrelated news... by joto · · Score: 2, Insightful

      What if evolution were the big lie? What will we think in 100 years? Will we laugh at evolution like we laugh at Phrenology or Lobotomy? [snip] Most if not all ancient legends and myths have been shown to be totally untrue. But, so have theories and teachings that had the backing of the scientific community of the time. So let us not think that just because evolution has the approval of the scientific community now that it always will or that it is infallible.

      That we will laugh of evolution in the future is highly unlikely. Just because some scientific theories have turned out to be wrong in the past (e.g. geocentrism, the luminiferous aether, static earth (no plate tektonics), Lamarckism), doesn't mean that it is equally likely that any scientific theory turns out to be utterly wrong. The theories that have been shown to be wrong, have often had serious problems associated with them, even before a better theory out-competed their brainshare. Typically they would either not make much sense (the theory could be made to predict the outcome of experiments, but no mechanism suggested itself for why it was that way), or didn't fit reality (the theory made sense, but couldn't predict the outcome of experiments).

      Darwinian evolution makes sense. In fact, it makes so much sense, that many scientists considers it a tautology. In other words, it's self-evident to the same degree as the logical expression "A or not A, is true". It also fits experimental data. And we have observed it happening in both nature and in genetic laboratories. Not only has it been observed, it's probably observed new cases daily. We can discuss and discover new mechanisms for transfer of genetic material, discover refinements to the theory, such as inter-species transfer of genes through viruses and bacteria, and so on, but Darwinian evolution remains. Just like things didn't stop falling down even though Einstein refined Newtons theory of gravity, Darwinian evolution won't cease to exist even if scientists discover other mechanisms of evolution.

      Or will we finally get past the genesis creation account and look at it as some silly old superstition?

      Most intelligent and educated people have looked at it as some silly old superstition since the renaissance. That's when science was "invented" as a discipline.

      I will point out that Hitler was a perfect example. Normal, everyday people went right along with his plans. Why? Because nobody stopped to think. They all fell for The Big Lie.

      This is incorrect. There are many factors involved in Hitlers success, and the most important is not that people "accepted" him. Hitler was a very good motivator and speaker. He had a propaganda ministerium that was even better. This made him able to say one thing to the people, and do something else (i.i. he could say "we take care of disabled people in special camps" which really mean "we systematically kill non-aryan people, homosexuals, and disabled people in special camps"). He used childhood indoctrination, i.e. Hitler-Jugend, so that kids would accept him blindly. And he used plain old coercion ("if you do not accept these new policies, we will break into your house at night and arrest you and your family"). Also, he had been able to stay in power for a long time, which gave him the opportunity to concentrate more political power for himself.

      Many people who believe in creation do so because it's what they were raised to believe and haven't thought about it. Lots of people who believe evolution do because their high school science teacher told them it is correct, or because they are afraid of public ridicule.

      There are a lot of blind followers in both camps. The question is: Are you one of them?

      If you believe in something because you haven't given it much though, doesn't mean that you are a blind follower. A blind follower is someone who has made a choice to believ

    477. Re:In unrelated news... by lordholm · · Score: 1

      "Multiple beings are a possibility as well. Although that introduces greater complexity yet and is therefore even less likely."

      Not really, assuming that the hypothetical creator have evolved from single celled life, it is easy to hypothesise that the creation was instansiated by a team of extra dimensional scientists and engineers. Having a multiple of beings working together thus makes the hypothesis more plausable.

      --
      "Civis Europaeus sum!"
    478. Re:In unrelated news... by Ash+Vince · · Score: 2, Insightful

      There certainly are alot of morons with mod points out there as this doesn't strike me as a troll in the context of this debate.

      I thoroughly agree with this sentiment. Religion is just an easter bunny story for adults. Jesus probably did exist but like all of the muslim prophets (yup, for those who don't know he is also a prophet of Islam) he was just another guy trying to suggest better ways of living 2000 years ago. Some of his suggestions will still be valid, some of them are not so useful now.

      Another thing to remember is that the bible was not written by Jesus. It was drafted several hundred years later when the Roman Empire adopted Christianity as a means of holding the empire together. This is what religion has always been very good at, getting people to live the way you want them too. Sometimes it will be for the good of the society, sometimes it is just for the good of the people running the religion. The first few popes were also the roman emperor by some coincidence.

      I could carry on, I could post lots of links to the things that Jesus said regarding organised religion and how they are similar to the sentiments Karl Marx repeated more recently ("Religion is the opiate of the masses") but whats the point. All it does it make god botherers more entrenched in their ridiculous faiths (As far as I am concerned all organised religion is utter rubbish, Christianity and Islam are just as bad as each other).

      --
      I dont read /. to RTFA, I read /. to offend people in ignorance.
    479. Re:In unrelated news... by David+Rolfe · · Score: 1

      And claiming that "it just happened by chance" in evolutionary molecular biology is absurdly simplistic. But is it wrong? Regardless of how infinitesimally small the probability of even each stage, it seems pretty clear that in a universe as unimaginiably vast and an amount of time unimaginably long that these events do occur. The fact that we sit here today though is that evolution is essentially exponential in its growth of complexity. Right? On a logarithmic graph successful mutations over time go in a straight line back to this 'random' (though inevitable) event.

      But to humor you, let's say there are only as many atoms in the universe as there are bits in the image of your favorite Linux kernel. If these atoms could only occupy one of two places, and momentarily and randomly oscillated (or not) since the beginning, then at some time the probability of a working kernel image did at some point is certain (or will be, assuming time has no end or the oscillations suitably quick). Fortunately, the evolution of life from its precursor reactions is much more likely since it's "compounding" over time. Anyway, the Linux kernel can conceivably be obtained by streaming /dev/urandom into a file, that's the whole point of the distinction between improbable and impossible. I do not equate improbable with impossible. Other non-ID, non-creationist theories like, say panspermia or whatever really aren't any better as far as I can tell. If life came to Earth from somewhere else in the universe, how did it start there?

      Until there's evidence to the contrary, like God popping out and saying 'life started here!', I don't see any other conclusion beyond "it just happened by chance". That's where the evidence as I understand it rests. Of course that's kinda disparaging, and not at all grandiose, but it is true. Or rather, I accept it to be true.

      I could be wrong. I don't mind. There could be a supernatural force that made life happen, but again, that's beyond our scope as actors in the natural world. God willed those molecules to self-replicate in a vast universe with little competition, if you like.

      Or is your real gripe that saying 'it just happened' undermines the human ego? Or wait, where you just chiming in to say, "I know more about it than you do"? Either way, thanks for taking the time. Finally, if it's just about getting the last word, go ahead, I won't reply again.
      --
      Read Heinlein's 1953 Revolt in 2100, now more than ever.
    480. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Without a program every computer is just an arrangement of matter.
      A program running on a computer isn't material as well.

      Same with the human brain, except that the program/thought/mind/love can change the matter which it runs on.

    481. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Evelution and a litteral interpretation of Creation ARE mutually excslusive. Don't be an asshat and try having it both ways.

      Dear Superior Intellect Asshat: It helps if you can type and spell.

    482. Re:In unrelated news... by Anonymous Coward · · Score: 0

      ... and I'm not talking about things that happened centuries ago.

      like Warwickshire, England, 1945

    483. Re:In unrelated news... by Anonymous Coward · · Score: 0


      Quibble all you like, but before you do read this. Note the table about two-thirds down listing eight new testament manuscripts that are dated A.D 200 at the very earliest. Do you really think it's possible to write with any degree of accuracy about the life of someone who lived 200 years before hand in an age where litteracy is rare. Well nutters and zealots will believe anything.

      As for the books of the old testament, well you don't really want to go there do you. It always amazes me how christians cherry pick what they like from the old testament (like the 10 commandments) and yet ignore those parts that advocate killing, corporal punishment and slavery. The old testament is as barbaric as Sharia Law.

    484. Re:In unrelated news... by Inverted+Intellect · · Score: 1

      Christianity's god is actually named, originally spelled YHWH, it is now variably pronounced, the one I typically use is Yahweh, though others exist, such as Jehovah or Yaoweh.

      It was originally taboo to pronounce the name out loud, it was only allowed to be written, AFAIK. The titles of "God" and "Lord" are continuations of this taboo, though the original reason is lost on many.

    485. Re:In unrelated news... by KDR_11k · · Score: 1

      However, even the Vatican doesn't say that evolution is wrong or that the creation happened exactly as described in the Bible. They're running this business for long enough to know that the bible has to be taken as a metaphor for the largest part.

      --
      Justice is the sheep getting arrested while an impartial judge declares the vote void.
    486. Re:In unrelated news... by Anonymous Coward · · Score: 0

      ``Evolution is unproved and unprovable. We believe it only because the only alternative is special creation and that is unthinkable.'' Sir Arthur Keith, a famous British evolutionist

    487. Re:In unrelated news... by conman90 · · Score: 1
      It's also not nice to base facts of science off of only speculations.
      You can only speculate that
      1. The amount of carbon-14 (or whatever element used) in the atmosphere has always been the same
      2. The rate of decay has always been the same

      In the past sience has always been based off of observations. Let's keep it that way and keep specluations and guesses (with no observable evidence) out of science.

    488. Re:In unrelated news... by aggressor-on · · Score: 1

      We came from apes. Apes came from monkeys. Monkeys came from lemurs. Lemurs came from rodents. Rodents came from some earlier mammal. That mammal came from reptiles. Reptiles came from amphibians. Amphibians came from fish. And so on. In fact, the biggest evidence of this IS embryology. Do some research on it some time. There's a reason human embryos have a tail, and are indistinguishable from nearly every other land dwelling embryo for quite a large amount of it's development.

      Okay, here's some research (emphasis mine):

      Quoted from "M.K. Richardson, Haeckel's Embryos, Continued, letter to Science 281(5381):1289, 28 August 1998":

      "The core scientific issue remains unchanged: Haeckel's drawings of 1874 are substantially fabricated. In support of this view, I note that his oldest "fish" image is made up of bits and pieces from different animals, some of them mythical. It is not unreasonable to characterize this as "faking." ... Sadly, it is the discredited 1874 drawings that are used in so many British and American biology textbooks today."
    489. Re:In unrelated news... by jcr · · Score: 1

      the USA aspires to be a world leader in almost every field

      People have aspirations, countries don't.

      Aspirations are really beside the point. The USA is the leader de facto in nearly every field of human endeavor, whether its technological, political, military, or economic. Religion is far stronger in the USA because our constitution prohibits government from interfering with it, leading to a great degree of religious diversity, unlike countries with an established religion which tends to make it either atrophy (Church of England) or fester and metastasize (Saudi Wahabbism.)

      -jcr

      --
      The only title of honor that a tyrant can grant is "Enemy of the State."
    490. Re:In unrelated news... by ultranova · · Score: 1

      Of course love is made up of matter. Its a combination of molecules in your brain.

      Love is an emotion, or possibly an abstract concept. It is no more made of molecules than mathemathics or philosophy is; chemical reactions simply happen to be how your brain processes these concepts.

      Or to put it in another way: your brains are made of brain cells, but that doesn't mean that everything they can think about is.

      --

      Forget magic. Any technology distinguishable from divine power is insufficiently advanced.

    491. Re:In unrelated news... by jcr · · Score: 1

      Maybe you need to open your mind.

      Oh, that's rich coming from someone arguing against the evidence. Hope you enjoy your superstitions, you're welcome to them.

      -jcr

      --
      The only title of honor that a tyrant can grant is "Enemy of the State."
    492. Re:In unrelated news... by Kjella · · Score: 1

      P.S. Science has not disproven Christianity, Science has disproven many of MAN'S interpretations of what is found in the Bible. That is the beauty (or curse) of the Bible, almost everything in it can be interpreted in so many ways that you can disprove interpretations until the end of time.

      That is an understatement. Science has disproven many of the statements in the Bible, chapter and verse. But even then Christianity has another line of interpretations - the Bible was not written by God but collected by men. But I'd go so far as to say science has even disproved a few of the things explicitly laid out by central texts in the Bible. No, science can't disprove religions as such. But it can most certainly contradict specific claims made by a religion, the interpretation part is really a cop-out of the core issue. Doesn't faith come as a package deal? It's not like Christians say they believe in God and the Bible except chapters X, Y and Z which we now know are false. Instead you see increasingly more creative interpretations to make it fit the facts.

      As for that being a blessing or a curse, look at Islam. They consider the Quran to be the literal words of Allah as revealed to Muhammad. There is only one definitive written version which leaves very little room for interpretation. That is their lock-in to 7th century thinking, not only towards science but towards social and cultural development too. At least with Christianity you can argue that the interpretation is wrong or in the historical context and that you're missing the grander message of tolerance and love. Of course we've managed to make the same text say we should go on holy crusades to capture Jerusalem too, but at least it's flexible. With Islam it's more "I hear what you're saying about cruel and unusual punishment, but Allah said amputation of hands and feet is ok so I'll ignore any secular arguments". I'd call that a curse.

      --
      Live today, because you never know what tomorrow brings
    493. Re:In unrelated news... by jcr · · Score: 1

      You know all that really matters is that when you die you better be right.

      Only if you buy into that whole god-as-the-ultimate-bully school of theology. That "ha, ha, god's going to kick your ass when you die" line of argument is pretty fucking tedious.

      . I mean really, if those of use that do believe in God are wrong what do we have to lose?

      Well, I might say your rationality, but since you insist on asserting your superstition as fact, you've already abandoned that.

      -jcr

      --
      The only title of honor that a tyrant can grant is "Enemy of the State."
    494. Re:In unrelated news... by The+One+and+Only · · Score: 1

      Who the fuck modded this informative?

      • While the Pope does have the authority to promulgate infallible dogma whilst speaking ex cathedra, this is exceedingly rare, on the order of perhaps once per century. Most Popes live and die without claiming to provide any "divine knowledge"--the last one who promulgated dogma ex cathedra was Pius XII, five popes and 57 years ago. The dogma in question was Mary's assumption into heaven, which seems perfectly reasonable if you've already spent the past 2,000 believing she was Jesus's mom.
      • The Church is considered to be authoritative in its interpretation of scripture, but the vast majority of dogmas and doctrines are defined by the community of bishops in council and not by the Pope individually.
      • The various books of the Bible were written in ancient times before the Church was really founded (claims that the Church was founded by Christ's mandate to Peter notwithstanding). The Old Testament was pretty much canonized by the Jews, although Catholic synods added a few books to it at the same time they canonized the New Testament. The Protestants ended up un-canonizing the books the Catholics added to the Old Testament, though.
      --
      In Repressive Burma, it's not just your connection that dies. slashdot.org/comments.pl?sid=314547&cid=20819199
    495. Re:In unrelated news... by Anonymous Coward · · Score: 0

      1500/1600: Most believed in a geocentric solar system, but most scholars and priests knew that the earth was round. The "flat earth" view is a myth... just like Gates' "640k memory" statement.

      "The modern misconception that people of the Middle Ages believed that the Earth was flat first entered the popular imagination in the nineteenth century, thanks largely to the publication of Washington Irving's fantasy The Life and Voyages of Christopher Columbus in 1828."

      http://en.wikipedia.org/wiki/Flat_Earth

      My Captcha was "misled". Cool :-)

    496. Re:In unrelated news... by sumdumass · · Score: 1

      Well, lets see. In your thought experiment, unless your willing to discriminate on the basis of religion which is a protected against by law thereby opening your company to lawsuits and loss of all government contracts, grants and such, you will move on to another question to base your hiring practice on.

      What you just described is highly illegal in the US. I would love someone in the real world to do this just so I could see them sit in a court of law and explain how someone's religion is so important to your projects that you have to use it to exclude any otherwise qualified candidate.

      This probably happens quite a bit since science has become a religion to some. Unfortunately anyone doing it are probably to chicken shit to state that as the reason they hired someone else so little can be done about it.

    497. Re:In unrelated news... by Anonymous Coward · · Score: 0

      And furthermore, the C14 method of dating (and others) weren't "invented" to date objects, calculate the age of the earth or annoy religious folk. The science behind it built on previous science that described radioactive decay. This, in turn, is built on previous discoveries ... and so on.

      It just so happens that some bright spark saw a possible connection between something like radioactive decay, and the age of certain objects. Other scientists said "hey lemme check this. hey he's right you know" and so off they went. That's the science thing: observe, postulate, theorise, predict. Refine, start again.

      Incidentally, none of this was to discredit religion. It just so happens that the more science became involved in explaining the natural universe, the less that a supernatural being was required.

    498. Re:In unrelated news... by DarkSarin · · Score: 1

      Part of the reason is that so many people who teach evolution insist on making the debate about evolution into one about the nature or existence of deity, or about the creation of the world or something like that. As long as that is the case, it will continue to push those that are highly religious away from the idea.

      I don't care if you disagree about deity. It is NOT the place of those working in a government school to attempt to change an adolescent's beliefs about religion. The idea that evolution is contrary to the scriptures, or that it somehow proves that there is no deity is sheer idiocy. The idea that you must accept both ideas simultaneously is exactly the reason so many people disbelieve.

      I am a reasonably religious person. I know of nothing in my religion that says that animals and plants and people cannot evolve. I, like many others, am not convinced that humans are related to other species, but neither do I think it ultimately matters. I believe God took a hand in the formation of this planet, and in the creation of life hereon. I don't know anything about how that would have happened, except that it is most decidedly not ex nihilo as some idiots believe. Other than that, it really doesn't matter if life evolved or was created. Evolution is only useful as a tool to either explain why certain species are the way they are, or to explain how things might change in the future. That is all

      --
      "We don't know what we are doing, but we are doing it very carefully,..." Wherry, R.J. Personnel Psychology (1995)
    499. Re:In unrelated news... by k8to · · Score: 1

      Well, it is a fact. The fact is that evolution is occurring. The term applies to the theory and the facts it surrounds, both. Language is a funny thing, with meanings oft contextualized. People understand this intuitively in usage, but if you pull it out and make it a point of discussion in isolation, they often get confused.

      Evolution haters will try to blur the facts together with the theory and suggest somehow all of it could be found wrong. Ignorant evolution boosters will try to blur the theory together with the facts and suggest somehow the entirety of the theory is factually incontrovertable.

      The thing is that the anti-evolutionists typically need the factual components to come into doubt, and so it is an effective and reasonable counterargument to identify the factual nature of evolution, although it is misleading to do so without clear distinction of what is meant by this.

      --
      -josh
    500. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Thankyou, DNA...

    501. Re:In unrelated news... by Kjella · · Score: 1



      The simplest current-day organism anyway. One thing is to remember is that the first organism has absolutely no natural enemies or even competition for resources. It doesn't matter if its reproduction is really crude and vastly inferior to advanced microbes as long as the reproduction ratio is anything over one. DNA is robust but quite complex, and probably not where we started. Not to mention that we all agree DNA is full of historical luggage - the first organism doesn't need that. It might be fairly simple, but if it has survived to present day it is most certainly very robust, for example defenses against all the other bacteria that have tried to wipe it out over billions of years. So i think we can quite safely say that this complexity is a gross overestimate on how complex it needs to be.

      --
      Live today, because you never know what tomorrow brings
    502. Re:In unrelated news... by idkk · · Score: 1
      Not, alas, an accurate translation.


      1) I do, as it happens, know a great deal about Bach (and much other music too), and I am a semi-professional musician. I also have thought deeply about cognition -and have published a book which (partly) touches upon that topic.

      2) & 3) I only believe these sciency things because I have looked at the logic and the mathematics (and. yes, I have a university degree in mathematics), and not just because it's the popular thing to believe. As a counter example, I have no idea whatsoever as to whether the graviton exists or not - I have no logical proof either way, therefore I must firmly hold to that piece of ignorance, and not pretend that I know.

      4) But my belief in God is different from - and does not affect - my scientific thought.


      These ideas get along well together because I recognize that they are from different universes.

      --
      Ian D. K. Kelly

      idkk Consultancy Ltd.

      "Quality through Thought"

    503. Re:In unrelated news... by miro+f · · Score: 2, Informative

      There is also the problem of the Second Law of Thermodynamics and as well the scientific principle that all things tend to degrade over time - completely opposite of the evolutionary logic. Funny though that the first two things mentioned are observable and reproducible, the latter is not.


      I really don't understand where this thinking comes from. The Second Law of Thermodynamics is one of the most accepted laws in science. If a theory contradicts the second law, then the theory is wrong. Nothing short of absolutely empirical proof that the laws of thermodynamics is wrong will make anyone even look twice at such a theory.

      The fact that Evolution is still a well accepted theory would then mean one of three things

      1) Scientists haven't noticed that it contradicts the second law of thermodynamics
      2) Scientists know that it does, but there's a huge conspiracy hiding the fact
      3) Evolution doesn't contradict the second law of thermodynamics.

      Given that 1 is plain ridiculous, and while many people believe 2, it would be difficult to shut every scientist who knows a little bit up, then the solution to this problem must be 3.

      People who bring up this argument instantly show they have no idea what they are talking about (luckily you did it right at the end, so a lazy reader might think you have a clue). Although the previous poster gave you a challenge, I would prefer bring some more education into the world so that people will stop trotting out this useless and wrong argument, and find a different wrong argument to bring up.

      The laws of thermodynamics are thus (simplified):

      0) two objects that are in contact will exchange thermal energy until they are in equilibrium
      1) energy can't be created or destroyed
      2) entropy (energy lost has heat) will always go up no matter what (amount of order will always decrease)
      3) as temperature approaches 0, entropy approaches a constant

      now looking at these four laws, I can find something that 'invalidates' them:

      0) a fridge. it's colder than outside and always remains so
      1) coal/oil. Energy is being created... Where does it come from?
      2) plant growing will be more ordered after as before
      3) (ok I have no idea here)

      well, those laws are looking pretty silly no? What people always fail to notice (or conveniently ignore) is that the laws of thermodynamics only apply to a closed system. That is, one with no outside influence. A fridge is allowed to hold back thermodynamics because we are pouring energy into it from our power plants. The oil/coal is allowed to be burned in those power plants because they came from the plants that have grown. And the plants can grow because there is an influx of energy that is (as we should all now know), the Sun.

      This same energy source is what allows for evolution. It is the energy from the Sun that allows simple things to become more complex things, thus not defying the second law of thermodynamics even though Intelligent Design pushers would love it to be true. So next time you're trying to discredit evolution, you might want to try a different argument
      --
      being vague is almost as cool as doing that other thing...
    504. Re:In unrelated news... by at_18 · · Score: 1

      Your counter-argument does not answer my question. Your counter-argument is simply flamebait and should be modded as such.

      It's not a counter-argument. It's your argument, slightly rephrased. If you don't like it there's nothing I can do.

    505. Re:In unrelated news... by miro+f · · Score: 1

      I never said that this wasn't true. All I stated was the creationist viewpoint on micro vs macro evolution.

      --
      being vague is almost as cool as doing that other thing...
    506. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Wow. That is an incredible post, Alsee. I don't give praise lightly, but that post had a more profound effect on me than anything else I've read on the subject.

      To be honest, it shook me up. I felt uncomfortable.

      Of course just because something is possible, doesn't make it likely. But that's kind of irrelevant, I suppose. We'll never know for sure either way.

      I would be interested to see a response to this from someone much more intelligent and articulate than myself.

      [thankyou Slashdot for allowing non-registered members to post. as a long-time lurker I had no idea this was even possible]

    507. Re:In unrelated news... by OriginalArlen · · Score: 1

      even though I wrote the code myself and know exactly what it's doing, I still want to anthropomorphize it and believe its doing it intelligently instead of just randomly selecting points and discarding those that don't give good results. That way, madness lies... or possibly genius. It's hard for me to tell...
      --

      Everything I needed to know about life, I learnt from Blake's Seven
    508. Re:In unrelated news... by Khomar · · Score: 1

      I just named several in that linked document. The whole development of the embryo continues to be mistaught in many schools today despite the fact that modern medicine has long since debunked these myths. There is also this interesting article which attempts to debunk most of the theories regarding human evolution by studying the DNA. While I am not in complete agreement with the conclusion, it is definite some food for thought. Make sure to check out the article's references.

      One of the big problems I see is that school textbooks are not updated with the current information. One textbook I saw being used in schools still referenced the Nebraska man!

      --

      I believe in de-evolution. God made the world perfect, man fell, and its been going downhill ever since!

    509. Re:In unrelated news... by HuguesT · · Score: 1

      In virtually every field, like you write, the USA is a minority leader. For instance, it has the largest single country economy in the world, however it's economy represents only about 30% of the entire world's, and is rougly the same as that of the European Union. In addition, this position is not guaranteed for ever. Again, for instance, the average world's economy grows faster (about 5%) than the US's (about 3%). The situation is comparable in the EU.

      In the next few decades we are likely to see the economic or otherwise importance of the West diminish, and in particular that of the US. The Economist foresees that China will be the dominant economy by 2050. Now western economies represent about 60% of the world's GDP, but by then it will be less than 30%.

      Just about the only area where the US is an undisputed leader is the military, but I'd argue that this is of limited value in a democracy.

    510. Re:In unrelated news... by rikkards · · Score: 1

      Especially when the bible says that for God a long period of time could seem like a second. Can't remember the exact quote. A good question is if you asked the same people that believe that God created the world in its present form as according to the bible, which way did he create it? There are contradictions in both Genesis 1 and 2 including the order in how things were created.

      For me: Evolution for the win

    511. Re:In unrelated news... by ultranova · · Score: 1

      You can prove Newton's laws of gravity. Take a hammer, drop it. It will fall directly towards the center of Earth's gravity.

      Except that this doesn't prove Newton's laws of gravity, it simply fits them. To demonstrate the difference, I'll make a theory that all objects have a tendency to move towards their natural position in space, which in the hammers case happens to be Earth's center; the hammer falling fits this theory, but does it prove it ?

      Obviously, if Newton's laws of gravity survive test after test, at some point you can assume them to be true for all practical purposes; but at no point in this process do they actually become proven, that is, known to be true beyond any shadow of doubt.

      Scientific facts can be tested and falsified.

      No, but hypotheses and theories can.

      --

      Forget magic. Any technology distinguishable from divine power is insufficiently advanced.

    512. Re:In unrelated news... by koreaman · · Score: 1

      The point isn't that understanding of evolution is a direct prerequisite for all scientific work.
      The point is that if one doesn't believe in evolution because "teh bibles say it arent true", this is a symptom of a lack of scientific thought processes and general level of education, which are in fact a direct prerequisite for all scientific or engineering work.

    513. Re:In unrelated news... by Anne+Thwacks · · Score: 1
      There are two places where truth and fact are mutually exclusive:

      a) Cloud-Cuckoo Land

      b) America

      --
      Sent from my ASR33 using ASCII
    514. Re:In unrelated news... by wasteur · · Score: 1

      Adaptability is an inherited property, so the original comment is not wrong in all contexts. The human brain gives us the ability to adapt: versatility is an asset.

    515. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Hahaha that was golden. I love it when elitism is trampled on the web.

    516. Re:In unrelated news... by Anonymous Coward · · Score: 0

      "DNA does not work like this AT ALL. There are huge, gigantic sections of DNA code that are never used. Then there are sections in certain places which are used for two TOTALLY UNRELATED purposes just because the particular sequence of base pairs happens to fit both purposes. It is the equivalent of compiling a header file full of constants (say, error codes or strings) and then after you're done compiling, going, "Oh hey, since we are using a Pentium processor, that sequence of bytes for the error codes happens to also be a valid sequence of opcodes. So now I don't need to bother writing the first half of memmove(), because it already exists right there! Whoopee!" Except that it's worse than that because the DNA will have 100 other copies of memmove() in other places, all different, all incompatible, and most with bugs. Except that you can't call them bugs, because there is no spec. You expect them to do "wrong" things every now and then, indeed often, and the only real crime is to do something so wrong that the organism doesn't survive. And the only reason it does survive is that the system is pretty redundant and tolerates chaos pretty well, except when someone gets heart disease, cancer, dementia, a sore lower back, etc."

      That sounds more like the concept of compression and code reuse, but on a scale that would be difficult to master as a coder. Instead of a higher level language, imagine the programming as Assembly. The individual lines of the assembly language perform unrelated specific operations such as loading values into memory, jumping to another line of code etc etc. Yet, when placed into the context of a linear run-time order the individual lines together form more complex operations.

      It would seem more likely that the design you perceive as sloppiness, is actually another level of complexity and the redundant code sections perform different tasks based on the context of their run-time order.

    517. Re:In unrelated news... by dbrutus · · Score: 1

      I'm one of those people who suspect that God used evolution as his tool in the process of creation so you can say that I believe in scientific evolution. It fits the best evidence we've got right now. So what I'm saying has nothing to do with the immediate question at hand, just the larger question of the reliability of scientific peer review.

      Unfortunately, the idea of scientific independence is something of a myth. Lysenkoism swept the Soviet academy, for instance, on the back of political patronage. That's a relatively uncontroversial example of modern scientific error spread widely. A growing number of people are saying that global warming is either that way now or headed that way. It's hazardous to your funding to say "I don't see anthropogenic global warming evidence in my specialty". It's very hazardous to say "I don't see global warming coming from humans at all".

    518. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Hitler said the "Big Lie Technique" was, of course, Jewish. He did not openly advocate its use - he condemned it. How he felt privately is anyone's guess.

    519. Re:In unrelated news... by dbrutus · · Score: 1

      Yes, yes, because every master chef imparts his recipes along with every meal. The Bible, for the vast majority of christians, is a guidebook to eternal salvation. It is not meant to be a scientific text and not vetted for that at the synods that established the canon of scripture.

      The revealed truth that we have from God through the prophets and Jesus is that God prefers that we have faith. If he were to put the secrets of the universe in front of us on a silver platter, that would destroy faith. This was established long before there was a scientific method. We're not talking about ex post facto argumentation.

    520. Re:In unrelated news... by linvir · · Score: 1

      i disagree with you, the idea that you cant be different from your parents its totally idiotic.
      Too easy.
    521. Re:In unrelated news... by darkwhite · · Score: 1

      But is it wrong?

      Yes. Chance did play a big role in it, and "supernatural forces" played none, but to trivialize the conditions that led to the formation of the universe, Earth-like planets and life as "it just happened by chance" is so simplistic as to be intellectually weak.

      The Linux kernel is about 2MB in size. To generate it randomly, you need on the order of 2^2M tries. The number of atoms in the universe is about 1e68, and its age is about 14 billion years, or about 4e26 nanoseconds. Let's overestimate and say that every nanosecond, for every atom, the probability of the Linux kernel being expressed completely randomly from the surrounding atoms is 1/2^2M. Then so far we've had about 4e94, or 2^314 tries. The probability of this having occurred over those tries is then 1/(2^(2000000-314)). These odds cannot be beat. You must appreciate that there must be conditions to facilitate this chance. That's my point. And explaining how these facilitating conditions arise is one of the most interesting things you can do.

      The fact that we sit here today though is that evolution is essentially exponential in its growth of complexity. Right?

      That statement makes very little sense, and on its face is false. I think you're trying to say that evolution iterates through exponential amounts of possible genetic makeups over time. That's not exactly true, either.

      Or is your real gripe that saying 'it just happened' undermines the human ego? Or wait, where you just chiming in to say, "I know more about it than you do"?

      Now you're just making yourself look dumb by going ad hominem.

      --

      [an error occurred while processing this directive]
    522. Re:In unrelated news... by hobo+sapiens · · Score: 1

      Thanks for the well thought out reply. I understand the points you are making, but one part in particular intrigued me, specifically about genetic algorithms. I might like to explore that a bit. Any idea where I could start? Know any good books, etc?

      --
      blah blah blah
    523. Re:In unrelated news... by hobo+sapiens · · Score: 1

      The Catholic church did not write the Bible, as another poster pointed out. The Catholic church got its start from a bastardized form of Christianity. Things like the trinity, the clergy/laity division, priestly celibacy, and political intermeddling aren't supported by the Bible. The Catholic church has introduced these things based on their own ideas. They have, to paraphrase 1 Cor 4:6, gone beyond the things written.

      Why? Because Christianity as taught in the Bible is a horrible money-making scheme, and it doesn't get you very far in the political-power-grubbing department either. The Catholic church therefore needed to resort to something else.

      --
      blah blah blah
    524. Re:In unrelated news... by Panzergheist · · Score: 1

      "And how, exactly, did you come to that conclusion?"

      By reading articles from scientific journals and using deductive reasoning to make connections between competing theories in evolutionary biology.

      Check the following articles that relate to what I've been writing about.

      http://www.blackwell-synergy.com/doi/abs/10.1111/j .1475-4983.2006.00603.x
      and
      http://www.blackwell-synergy.com/links/doi/10.1046 /j.1420-9101.2002.00437.x/abs/

    525. Re:In unrelated news... by gfreeman · · Score: 1

      It's also conceivable, though highly unlikely, that one day evolution will be disproven completely. If that happens, it will be entirely to God's credit.

      Disclaimer: Open minded borderline-atheist talking here ...

      --
      Ceci n'est pas un sig.
    526. Re:In unrelated news... by Scrameustache · · Score: 1

      Every time I read a discussion here on /. on the topic, I see about ten comments that say something to the effect of "Evolution is an unimpeachable fact". When I see statements like that I start to wonder if science is taking place anymore.
      I think the scientific method is one of the best detectors of rubbish-disguised-as-truth there is. All I am saying is that I hope it's being adhered to. I hope people don't blindly push evolution like some people blindly push religion. I'm one saying it's a fact. Here's why: The theory of evolution exist to EXPLAIN the observation that organism got more complex over time.

      Evolution is a fact, you look at life, the more complex forms have attributes found in less complex life, which have attributes found in less complex form, and so on until you get down to single cells. And if you look at the fossils, the less complex ones are found deeper in the deposits than the more evolved forms. Those facts are known collectively as "evolution".

      When Lamarck looked at those facts, he theorized that critters adapt to their environments, change their form, and pass those modifications on to their offsprings. That theory didn't pan out, but about 80 years later Darwin came to a better conclusion. Some people reject the entire thing, the theory explaining the observation, the observation themselves, and to give their denial more credibility, they say "it's JUST a theory". No, it isn't, evolution is a fact, the theory of evolution is how we understand it.
      --

      You can't take the sky from me...

    527. Re:In unrelated news... by gfreeman · · Score: 1

      Evolution is not intuitive.

      I must be odd because I found it entirely intuitive. Looking at how diverse humanity is, and how blurred are the lines between species, I had no trouble as a kid seeing how things fitted together without there being a "designer". I was always uneasy in church (when I was made to go) because nothing that was said there about the history of man seemed at all logical, and indeed counter-intuitive to me. I always saw religion as cover-up, right up until I discovered that I was not the only person who thought this - at which point I could start to talk about how I thought, rather than be a mouthy pre-teen who needed a bit more church time to set him straight.

      Anyway, back on point, I'm sceptical that everyone accepts a design-based universe by default. I know I didn't.

      --
      Ceci n'est pas un sig.
    528. Re:In unrelated news... by Anonymous Coward · · Score: 0

      How about Romania? Part of the backwards and ignorant European Union.

    529. Re:In unrelated news... by Opportunist · · Score: 1

      Well, ok, I should choose my terms more carefully.

      Any scientific "fact" is by its very nature in a permanent state of "not proven". It's just not been falsified yet. And many will never be, simply because they are actually "true".

      But maybe some day someone comes along and proves that antigravity exists and that Newton opened a can of bunk with his "laws", that we only saw them as true 'cause we didn't know any better and because we only observed a tiny segment and only the special cases in which the theory actually works.

      Who knows?

      The beauty of science is, and I hope we agree on this one, that it offers itself to tests. Whatever 'fact' we find can be tested and tested again, until we maybe find some special case in which the fact erodes into a fallacy, and then it's time to change it and retest it until we have a more stable theory.

      A religious fact just is. No test offered, often even testing it is explicitly forbidden by the very same book that describes it (for example, the Bible very explicitly tells you that it's sacrilege to test and try God). And, personally, that's not enough for me.

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    530. Re:In unrelated news... by Scrameustache · · Score: 1

      Newton's universal law of gravity still is a great description of how massive bodies respond to each other, but it doesn't say anything about how photons--massless particles--respond to massive bodies. Einstein gave us He gave us e=mc^2

      Remind me again what that "m" stands for?

      PS No "& sup2 ;" on /.? What gives?
      --

      You can't take the sky from me...

    531. Re:In unrelated news... by Fred_A · · Score: 1

      "The Teaching Authority of the Church does not forbid that, in conformity with the present state of human sciences and sacred theology, research and discussions, on the part of men experienced in both fields, take place with regard to the doctrine of evolution, insofar as it inquiries into the origin of the human body as coming from pre-existent and living matter."

      - Pope Pius XII
      So the church acknowledges that people come from sex ?
      --

      May contain traces of nut.
      Made from the freshest electrons.
    532. Re:In unrelated news... by bgman · · Score: 1

      When someone informed on the issue calls evolution a fact, they would be referring to the well documented evidence of descent with modification. There is no doubt that evolution has occurred. It's no longer open to question. We have the fossils. We win. What is a theory is how it happens. While the broad ideas of non-random survival of randomly varying replicators is broadly accepted, many of the details continue to be researched. Whether or not the process is gradual and relatively constant or occurs in fits and starts is an example. Has anyone made the point that the US now ranks with Turkey in the percentage of citizens who adhere to prescientific, mud hut religion and revelation rather than science as a source of information about, well virtually, everything? The US was once the center of scientific and technical progress in the world. Now - well I guess we are still the leader in production of quality entertainment like American Idol.

    533. Re:In unrelated news... by ZoOnI · · Score: 2, Interesting

      It's conceivable, though highly unlikely, that one day evolution will be disproven completely.

      Yes it will be the day when weak minded presidents and leaders have allowed religions to get a strangle hold on country politics and all the scientists are bought and paid for.

      The churches can go back and write version 295 of the existing religious texts, adding chapter 2 where Adam fights the dinosaurs with his apple tree club to bring back some raptor burgers for Eve.

      --
      "Never say Never."
    534. Re:In unrelated news... by cyber-vandal · · Score: 1

      When did Tony Blair become a Socialist? Must have been very recently.

    535. Re:In unrelated news... by SHP · · Score: 1

      Actually, since the question was stated as an AND, you'd have to believe BOTH in order to respond in the affirmative. So, even if you were aware that evolution is widely accepted, you'd have to answer no if you felt it wasn't well supported by the evidence.

      This poll doesn't mean that 52% believe both statements to be false, it merely means that 48% believe at least one of them to be false. Also, remember that most people interpret the term evolution expansively to cover the whole gamut of issues related to origins, as opposed to the narrow scientific definition of biological evolution. And, the phrase "well supported by the facts" is likely interpreted by many people to mean "true" or "proven", as opposed to merely "well supported".

      Don't read more into this than is justified.

    536. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Huh? Was that supposed to be profound? Was it even supposed to make sense?

    537. Re:In unrelated news... by Anonymous Coward · · Score: 0
    538. Re:In unrelated news... by debrain · · Score: 1

      An animal does not adapt. It is born with a certain set of DNA, which it cannot change or control, and it lives or dies as a result what DNA it has (along with other factors like chance).

      Interestingly, the theory of evolution popularized before natural selection had precisely this concept, known as Lamarckism. Thus, the theory of evolution has at some point encapsulated this idea, even though it is obviously not the predominant mechanism we recognize today. Further, it highlights the difference between the theory of evolution, and the theory that evolution is attributed to natural selection (and, in my humble view, from an open-minded scientific perspective this difference should not be forgotten).

      Food for thought. :)

    539. Re:In unrelated news... by cyber-vandal · · Score: 1

      Yes why wouldn't it?

    540. Re:In unrelated news... by BlueStraggler · · Score: 1

      It is becoming a pet peeve of mine that faith has taken the meaning of "unwavering belief in the face of evidence to the contrary". This is not faith, it is stupidity.

      Faith is loyalty, plain and simple. A dog is faithful to its master. A knight is faithful to his king. And the person is faithful to their god. This does not mean that the Bible is correct. It may very well mean the Bible is a load of bollocks. But just because it is a load of bollocks, and everyone who thinks they know what is in the heart of God is an arrogant fool, and science has shown that the ancient goat herders got pretty much everything wrong, and evil runs rampant in the world no matter what we do -- these are not reasons to forsake Jehovah and take up with some other god who might try and offer you a better deal. It's right there in the commandments - numbers 2, 3, and 4. Not to mention the whole freakin' Book of Job.

      So faith is not "unwavering belief in the face of evidence to the contrary". It is loyalty to God, even when you are forced to accept incontrovertible evidence that something previously understood to be a miracle, is in fact not.

    541. Re:In unrelated news... by Helios1182 · · Score: 1

      Actually, Wikipedia has a decent article with lots of good references. Also, check out the external links section and there are a number of good tutorials. http://en.wikipedia.org/wiki/Genetic_algorithm

    542. Re:In unrelated news... by Blakey+Rat · · Score: 1

      The only dark, depressing world is inside your head. I don't have to believe unconditionally in a higher power to see the beauty in the universe, or feel love, or be motivated to do good. People who seem to think they need a god to appreciate life puzzle me.

      I don't believe in a higher power, either, and I see beauty all around.

      That's not my point. Re-read the original post I'm replying to.

      He's saying that everybody believes what they believe *only* because that's what they were raised to believe. He's saying that it's basically impossible for somebody to change their life, beliefs, 'programming' they received as a child. That's the dark and depressing part. Thus, if you were raised to believe science is the only truth, then it's the only truth you'll ever experience.

    543. Re:In unrelated news... by AmberBlackCat · · Score: 2, Funny

      And if that is the case, that proof will be buried somewhere with a dinosaur fossil.

    544. Re:In unrelated news... by socerhed · · Score: 1

      The evidence for a world wide flood go together. Most people have heard of the idea that if you put a dam at the Grand Canyon that most of the Midwest would turn into a giant lake. There is even evidence that it could have once been a giant lake, fish bones and such in desert. Basically the idea is that if there has always been a river and then there was a flood, the river could have become blocked as the water left, evaporated, gone down into the Earth, and froze at the poles. Then when the dam broke water rushed out and carved the Grand Canyon. The idea is also supported from the fact that rushing water takes the path of least resistance and thus would explain the randomness of its path.

      The idea with lunar dust is that over time dust collects on the moon's surface. That is a fact and because of that when the lunar lander was created they gave it long legs. NASA expected there to be a couple of feet of dust since it would have been collecting for hundreds of millions of years. However once on the moon they found that their was only a couple of inches, only enough for a few thousand years.

      The Earth's rotation is slowing over time, by about 2 milliseconds a year. This means that billions of years ago when the Earth was so-called created the days were about 13.5 hours. The Earth's rotation would be so great that gravity would make it impossible to live and survive.

      --
      LostHobo.com
      Soup Kitchen of the Internet
    545. Re:In unrelated news... by geordieboy · · Score: 1

      No, Lamarckism is quite different to what he described, being the idea that characteristics acquired during the lifespan of an organism are passed onto its offspring. The usual example is the giraffe's neck elongating due to each generation stretching the neck muscles a little bit more. The Darwinian explanation is that each generation has a random sample of newborns, some with longer and some with shorter necks, and the ones with longer necks are more likely to survive, leading over time to a population with very long necks.

      --
      The world is everything that is the case
    546. Re:In unrelated news... by Crizp · · Score: 1

      Genesis could actually be a metaphorical description of the creation of the earth, and does not have to be at odds with the scientific evidence. It is all based on interpretation.

      That's why I enjoy stuff like these guys and the amusing-to-read ramblings of Blavatsky. At least these people did not outright disregard neither science nor myth and tried to link them somehow. Reading "The Secret Doctrine"s chapters on creation myths is especially fun. "Hey perhaps these few lines is just a metaphor for something that took really really long to do?"

      Their theories are of course not closer to what "really happened" than any other quasi-religious nutjobs. Everyone knows it's turtles all the way down.
    547. Re:In unrelated news... by Jimithing+DMB · · Score: 1

      Foundations of scientific thinking are not based on "God did it."

      For many scientists, the foundation is "How did God do it?" That of course is a theocratic remark but to suggest that it has no overlap with science is assinine. On the language side of things we see that the question has morphed from the active voice to the passive voice and has become "How was it done?"

      Nature is not neatly divided into math, science, language, and theocracy. There are no subjects in nature. Your proclamation that a Creator has no place in science is just as ludicrous as the proclamation that science has no place in theocracy.

      Wise up.

    548. Re:In unrelated news... by d_i_r_t_y · · Score: 2, Informative

      >>>
      Macro and micro evolution is very real. the differences are profound. so far to date, we have only found evidence of micro evolution and even though bacteria evolve at a much higher rate, they don't produce new species of bacteria.

      I have a PhD in Biochemistry/Molecular biology and you don't know what the hell you're talking about. New species of bacteria are created on a daily basis all around the world for research & industrial purposes; we just don't assign new species names to them, because 'species', to a scientist, implies it has arisen by natural evolution.

      Of all the things that man has discovered through the scientific method, none of them is more certain than Evolution - it is supported by so many different techniques and observations that on evidence, you'd be better off trying to discredit the existence of gravity than discredit evolution. That's why we teach it in schools; it's accepted fact.

    549. Re:In unrelated news... by @madeus · · Score: 1

      It's grossly ignorant to suggest it's not a series of chemical reactions, and that simply isn't a point worth debating any more than I'd get into a debate about the world not being flat, or the earth being more than 10,000 years old.

      'Love' is also an abstract concept, but it only exists as such because the concept dates back to a time before we were even able to imagine being able to understand or explain animal behavior (including our own) through the study of biochemistry or neurology.

      To quote Cole Porter, "Birds do, bees do it, even educated fleas do it" - the basic rules apply for humans, only have larger brains than most animals and so the whole affair is subsequently more complicated and less predictable in humans than it is in simpler life forms (not least because we are able to, and indeed make, a lot more value judgments).

      Your correlation is flawed because, unlike numeracy (which is human construct), what we know as love existed long before Homo Sapiens came along. I'm sure it existed even before mammals were dominant on Earth (and that dinosaurs where into doing the kind of crazy stuff birds do today to attract mates, for example).

    550. Re:In unrelated news... by Copid · · Score: 1
      [ on speculation ]

      1. The amount of carbon-14 (or whatever element used) in the atmosphere has always been the same
      That's just not true. The amount of C14 is not assumed to be constant. The values are calibrated using a variety of sources (trees, corals, ice cores, etc.). It should be noted that these generally agree with one another, which would definitely be a surprise if there was something deeply wrong with the system.

      2. The rate of decay has always been the same
      Ahh the special pleading and crackpot physics of creationists. We've seen evidence of the constancy of decay supernovae, and if decay rates were not constant, it would have very interesting (and completely unobserved) consequences for quantum mechanics. If something we observe (something that's consistent with all of physics and chemistry, not to mention historical observations) upsets creationists, they'll quickly whip out some new laws of physics and ignore the consequences.

      I don't see why young earth creationists have so much trouble with C14 dating given that it's not really used to support any of the evidence that devastates their positions. Far more interesting are things like isochron dating.
      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
    551. Re:In unrelated news... by MattHaffner · · Score: 1

      He gave us e=mc^2

      Among other things...

      Remind me again what that "m" stands for?

      Mass. What's your point? Photons don't have mass. That equation is for the rest mass energy equivalence of massive bodies. In general, it doesn't work the other way around.
    552. Re:In unrelated news... by Eli+Gottlieb · · Score: 1

      That might actually be true of some Slashbots, but when actual scientists get involved, it's not an issue of "faith in evolution" vs. "faith in the Bible." If anything, it's faith in the ability of critical thinking and the scientific method to sort through what evidence is found, come up with an explanation, and see if the explanation fits. Only if those scientists are biologists. A physicist, geologist, chemist, or climatologist hasn't studied evolution beyond a college- or high-school-level biology course.
    553. Re:In unrelated news... by Volante3192 · · Score: 1

      Well, for example...

      Truth is eyewitness testimony from the viewpoint of the witness. Eyewitness testimony is not always reliable because of memory and their own personal skew on events, yet for them, it's true.

      Fact is what really happened.

      Check out Rashomon some day.

      It's probably a personal definition of sorts, but I consider truths to be personal, and facts to be universal. Probably along definition eight in your list.

    554. Re:In unrelated news... by Garse+Janacek · · Score: 1

      I don't think anyone is questioning the basic tenets of macroevolution. ... Every time I read a discussion here on /. on the topic, I see about ten comments that say something to the effect of "Evolution is an unimpeachable fact". When I see statements like that I start to wonder if science is taking place anymore.

      Well, yes, people tend to generalize a lot. But the claim "Life on Earth today descended from a common ancestor" is almost universally accepted by scientists (in general, but especially in biology-related areas). This is the "fact" of evolution, and can be compared (albeit on a very different scale) to the orbit of the planets: it has been going on for as long as we've been watching, and there is a lot of pretty solid evidence (fossil record, DNA analysis, etc.) that it's been going on for very much longer. This is usually what people mean when they say evolution is an unimpeachable fact -- the details, such as the exact timeline, the details of the mechanism, and so on, have been the subject of much debate and revision, but "evolution," that is, that species have evolved into other species, is as close to being demonstrated as is possible without us having actually watched it (in some cases we have watched it, actually, but I don't want to get in that since you can always reject the observed examples on the basis that the distinct "species" can still interbreed with reasonable success -- this isn't really how we define distinct species, usually, but I prefer to avoid semantic arguments entirely).

      Similarly, astronomers argue a lot about the precise operation of gravity, but no one is questioning the observation that matter tends to be attracted to other matter, or the ubiquity of elliptic orbits. There's just such consistent evidence for these basic observations that there's not much more to say -- the interesting questions are about exactly how to characterize/quantify the details of the behavior. In evolution, there's such overwhelming evidence that speciation happens, and that life today shares a common ancestor, that there's not much more to say about it -- the real question is how, when, why, and so on.

      I hope people don't blindly push evolution like some people blindly push religion.

      Many, many people do, of course. Like most large categories of people, most of the individuals are far from experts, and have a lot of significant misunderstandings even about the meaning of their own beliefs. But what we should take away from this isn't that evolution is no better than any other alternatives (judging the view by the people who hold it is always dangerous) -- instead, we should reflect that we, too, are probably ignorant of many very simple concepts, and then try to educate people (including ourselves) as well as we can.

      --

      I am the man with no sig!

    555. Re:In unrelated news... by BlueStraggler · · Score: 1

      A single organism cannot ever adapt.

      Your understanding of adaptation is unnecessarily rigid. An organism can very well adapt to new environments. Our individual capacity for adaptation is, in fact, the primary evolutionary advantage of our own species.

      But even simple organisms can do it. You write as though an organism is genetically coded to work within a very precise set of environmental parameters, and is guaranteed to fail outside those parameters. In fact, organisms are coded to work in a range of environments, typically corresponding to the range they are naturally found in, and their performance varies depending on where in this range they fall. Moving such an organism into the edges of this range may very well stress the organism, and this stress may cause physiological effects as the organism struggles to cope with the hostile environment (think of sweating, shivering, exhaustion, etc., or even just the difficulty of finding a mate). Those physiological effects are the individual's adaptation to the environment. If the stresses of adapting are enough to bear, and if the if the organism is stressed less than its competitors, then if may very well be a profitable ecological niche to push into. Future generations will presumably adapt further (using evolutionary mechanisms as well as physiological ones) as they are selected for the environment, but it is that ancestral organism's struggle to survive in a hostile but liveable environmental niche that starts it all. Without that initial struggle to adapt, there is no evolutionary pressure to begin with, and the species would likely remain in evolutionary stasis in its comfortable niche.

    556. Re:In unrelated news... by shaitand · · Score: 1

      'Not really, assuming that the hypothetical creator have evolved from single celled life, it is easy to hypothesise that the creation was instansiated by a team of extra dimensional scientists and engineers. Having a multiple of beings working together thus makes the hypothesis more plausable.'

      If you were referring to the creation of life on Earth, sure. If you are referring to the creation of the Universe that doesn't seem as plausible. The same is true of aliens.

    557. Re:In unrelated news... by Copid · · Score: 1

      One textbook I saw being used in schools still referenced the Nebraska man!
      I'd be interested in knowing which one. Given the current state of public schools and textbooks, I suppose it wouldn't be completely impossible, but color me skeptical.
      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
    558. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Correct me if I'm wrong (I'm sure someone will...)

      I was under the impression that the miller experiment synthesized amino acids when a hydrogen/methane (and ammonia) atmosphere was assumed. All research I can find now indicates a hydrogen/helium atmosphere, not hydrogen/methane. Has anyone performed the experiment under these conditions? What were the results?

      Point is, a lot of the information currently in textbooks is outdated. Perhaps there are newer, more accurate experiments, but I certainly didn't learn about them in high school biology.

    559. Re:In unrelated news... by FroBugg · · Score: 1

      What do you mean by the basic tenets of macroevolution? If you're referring simply to the fact that it occurs or does not, then no, nobody is scientifically questioning this because it has been proven beyond any shadow of a doubt. Evolution happens. Nobody has produced a scrap of scientific evidence to even suggest that it might not happen.

      If you mean the rates, mechanisms, and other inner workings of evolution, then there are plenty of scientists questioning every single aspect of that every day. There's still great controversy over phyletic gradualism versus punctuated equilibrium. There's questions about the size of a population you need for speciation to occur, and how severe the barriers between populations need to be.

      Scientists are studying every aspect of evolution with the same criticism they bring to everything they study. But telling us that we're being dogmatic for not questioning whether it actually occurs or not is just a cheap tactic of the Creationists that perverts the scientific method.

    560. Re:In unrelated news... by Copid · · Score: 1

      The evidence for a world wide flood go together. Most people have heard of the idea that if you put a dam at the Grand Canyon that most of the Midwest would turn into a giant lake. There is even evidence that it could have once been a giant lake, fish bones and such in desert. Basically the idea is that if there has always been a river and then there was a flood, the river could have become blocked as the water left, evaporated, gone down into the Earth, and froze at the poles. Then when the dam broke water rushed out and carved the Grand Canyon. The idea is also supported from the fact that rushing water takes the path of least resistance and thus would explain the randomness of its path.
      That doesn't explain the layer upon layer of neatly deposited fossils in the resulting column. That's a big one. How were those layers created?

      The idea with lunar dust is that over time dust collects on the moon's surface. That is a fact and because of that when the lunar lander was created they gave it long legs. NASA expected there to be a couple of feet of dust since it would have been collecting for hundreds of millions of years. However once on the moon they found that their was only a couple of inches, only enough for a few thousand years.
      This is kind of like pointing out that somebody's fly is unzipped, but I have to tell you that this particular argument has been so well debunked that it's on the list of arguments that even Creation ministries international and Answers in Genesis say are bogus. I think that Kent Hovind and his traveling circus are the only people who really use it anymore. Summary: Dust doesn't accumulate nearly as quickly as once thought.

      The Earth's rotation is slowing over time, by about 2 milliseconds a year. This means that billions of years ago when the Earth was so-called created the days were about 13.5 hours. The Earth's rotation would be so great that gravity would make it impossible to live and survive.
      Please show your work. Actually, let me show mine:

      Earth's circumference: 24,900 miles
      Rotational period: 13.5 hours
      Tangential velocity: 24,900 / 13.5 = 1844 miles per hour = 824 meters per second
      Radius of the earth: 6,378,000 meters
      Acceleration due to rotation: 824*824 / 6,378,000 = 0.106455942 m/s^2

      So we're seeing a 0.1 m/s^2 reduction in the apparent force of gravity during the "old days". Re-running the numbers with a 24 hour period we get:

      Earth's circumference: 24,900 miles
      Rotational period: 24 hours
      Tangential velocity: 24,900 / 24 = 1037.5miles per hour = 464 meters per second
      Radius of the earth: 6,378,000 meters
      Acceleration due to rotation: 464 * 464 / 6,378,000 = 0.0337560364 m/s^2

      So the difference between now and then is 0.106455942 - 0.0337560364 = 0.0726999056 m/s^2. For the record, per this table, you'll get half that variation by traveling from Oslo to Mexico city. Where do you get your numbers?
      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
    561. Re:In unrelated news... by Mike1024 · · Score: 2, Insightful

      You don't need to understand quantum mechanics to be able to make a reasonable first pass at sorting out who does and does not have a PhD in quantum mechanics and is or is not professionally working in the field at prestigious international physics lab.

      I was once at a talk by a sociologist studying masculinity who said (and I'm paraphrasing here) "I got interested in this field because the ideas presented matched my experiences, and so 'resonated with me'". A student in the audience later cited the same motivation in entering the field.

      I, on the other hand, didn't think much of his ideas; they didn't match my personal experiences at all. However, I didn't enter the field, study for years getting a PhD and becoming a respected expert, in order to refute his ideas. In fact, I pretty much did nothing.

      The mapping from sociology to evolution is obviously a poor one, but it serves to illustrate a point: Academic study may self-select people who agree with ideas in that field, because people who do not agree with these ideas are unlikely to enter the field.

      Just my $0.02.

      --
      "Goodness me, how unlike the FBI to abuse the trust of the American public." -- The Onion
    562. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Your quote about one lone scientist back in the 19th century doesn't refute the fact that embryology offers substantial support to evolutionary biology in the 21st century. Have you read any modern papers or books on evolutionary development? If you had, you would've noticed that imaging technology has advanced quite a bit since 1874, and that modern papers and books do not cite 19th century drawings.

      What about textbooks, you ask? Perhaps even if modern scientists don't use 19th century drawings, high school textbooks might. The letter that you cite bases its claim on the Well's Icons of Evolution, where Wells even includes books with photographs of embryos in his class of Haekel's discredited drawings. He also apparently doesn't read the textbooks, as he cites some textbooks as bad for showing Haekel's drawings in a historical context and explaining why they're wrong, so it seems that this assertion is incorrect too.

    563. Re:In unrelated news... by sumdumass · · Score: 1

      Evolution is a collection of truths and half truths supporting fictional renditions of what might be next. This is the certain part of evolution.

      Now that you have a PHD in Biochemistry/Molecular biology and somehow have a slashdot moniker of "dirty" makes this sound a little hard to believe. But I'm willing to take your word for it. But if it was true, you would know that New species of bacteria, doesn't count as speciation in the way evolution considers it. Bacteria are asexual and produce changes by evolution forces but the DNA tell us that these are the same bacteria as before with different properties and capabilities. This is proof of evolving but not proof of evolution in that new species are created. The fact is that evolution in the essence of creating new and independent species from existing creatures have stopped.

      Another problem arises when it is common to use the term species outside the context it is intended. Recently, a new type of monkey was found and the habitat was being threatened. It was introduced as new species of monkey instead of the correct classification of sub species of monkey. This adds to the confusion that I'm sure your wallowing in. (PHD or not.)

    564. Re:In unrelated news... by hobo+sapiens · · Score: 1

      Heck yes! Back when I was just a road kid to a rum dum, I took on the moniker. Since then, after he caught a westbound, and many bone polishers later, I am still on the run. Were it not for wi-fi, why I'd never be able to talk to you.

      The 802.11j specification (designed for the unique geometry of the common boxcar) has been a real lifesaver to us enlightened hobos.

      That, or the name just sounded funny to me.

      --
      blah blah blah
    565. Re:In unrelated news... by fucksl4shd0t · · Score: 1

      Oh man, don't make it so easy. You don't think he's that smart because he's claiming he has a PhD in somethingorother but his slashdot moniker is 'dirty', meanwhile you're saying evolution is false under a slashdot moniker of "sumdumass".

      All I can say to that is Fuck Slashdot.

      --
      Like what I said? You might like my music
    566. Re:In unrelated news... by fucksl4shd0t · · Score: 1
      --
      Like what I said? You might like my music
    567. Re:In unrelated news... by sumdumass · · Score: 1

      It is nothing of the sort. You don't have to believe every thing Science says to participate in science. There are plenty of examples of this existing today in science itself.

      And someone not caring enough about a piece of science that doesn't pertain to anything they are working with or need in order to do whatever they choose has no bearing on anything they are doing. It says nothing about their education or anything about their grasp of the scientific process. It only says they don't care enough about what someone else says to believe over what their bible says. And that is all you do with evolution, believe what someone says it more true then what someone else says. No one in this debate has seen or experimented on evolution themselves.

      This is nonsense and systematic of the heresy charges in the biblical history. People are willing to condemn others because they don't step in line and tow the entire point of what is being said. Somehow this not believing the church in it's claim the the sun revolves around the earth means that he cannot have any association with the church at all. I don't think even the church has been this bad.

      There is nothing in modern science that a person would likely be working on that evolution verses creation makes one bit of difference in the outcome. There are a few specialized fields but these people wouldn't be applying them. It makes no difference at all. It is a non issue to anyone but those wanting it to be an issue. And I'm starting to believe they are the religious fanatics like the bible thumper's are when they insist everyo9ne should believe their version of the bible.

    568. Re:In unrelated news... by StanSitwell · · Score: 1

      The things you have faith in are things you THINK are true. The things that science has shown are things everyone KNOWS to be true. You can have faith all day long but refusing to accept the findings of science is not ignorance, it is utter stupidity.

      Hmmm... This is news to me. I'm pretty sure that the things you have faith in are things you BELIEVE are true. The things that science has shown are things that everyone THINKS to be true. If you KNOW something in science is true, then you're not talking about science any more. You're following a religion. People like you, who discourage free thinking, are the people who are destroying science. To say that it is "utter stupidity" to not accept the findings of science goes against the very essence of science itself! What if Newton followed your principles? "Oh, I'm pretty sure Galileo had it down," he would have said.

      When did it become OK to blindly follow in science? When did skepticism become so taboo? It was when "scientists" became priests, and Darwin the pope.

      I am extremely skeptical of evolution, because I am not convinced that science has given it a fair trial. Too many "scientists" cling to evolution as their religion (a very desirable one at that, with no commandments or rules). Too many "scientists" are too invested in it to be objective.
    569. Re:In unrelated news... by ozmanjusri · · Score: 1
      What you just described is highly illegal in the US.

      You didn't answer the first question;

      Which would be the greater risk to the project?
      --
      "I've got more toys than Teruhisa Kitahara."
    570. Re:In unrelated news... by sumdumass · · Score: 1
      Now i am convinced that at least you are a moron. read the post, look at what it says, then come back when you understand it,

      I doubt you will get the grasp of it though, so I guess i will point it out for you.

      You don't think he's that smart because he's claiming he has a PhD in somethingorother but his slashdot moniker is 'dirty',
      I said I was doubting his claim to being a PHD on the subject with that moniker. Now, I haven't claimed to be one have I? It had nothing to with him being stupid.

      But the rest of his comments did. And claiming something to be true based on a fictional authority smells of wikki legend here. Never the less, he cited something completely out of context as proof when even the pro-evolution sites claim it as the opposite. This would make him stupid or lacking. If i was 6 years old or something, I might have put more weight into it. But I'm not and I have the power of everyone else who isn't at my fingers and keyboard. His claim wasn't true and the usage was out of context. Does this make him stupid? I don't know, it could have made him a liar because he knew it wasn't true or it could have made him part of some scheme that didn't care about the usage and he was dupted into thinking it was something it wasn't. But the later would suggest he didn't pay attention when getting his PHD.
    571. Re:In unrelated news... by Anthony · · Score: 2, Insightful

      Lysenkoism spread widely under one regime where oppression and political patronage could trump scientific thought.

      Evolution is accepted as fact by scientists and in countries where scientific fact is publically acknowledged across the social strata. Where else in the world can public figures like Ann Coulter get an opportunity to not only display their ignorance but a large percentage of the population endorses that ignorance? It seems this false war is being waged against science as it threatens the power base of Christian sect leaders who's basic means of power is strident, willful ignorance.

      My feeling is those threatened by the fact that global temperatures are rising and global CO2 levels are rising with a distinct anomaly since the Industrial Revolution, have everything to gain by opposing the dissemination of facts and reasoned inference.

      My hypothesis is that science thrives in liberal (not the US definition) societies with clear controls that minimise concentration of power and provides fundamental services to its populace such as health education etc. To do otherwise gives too many opportunities to would-be despots to control others.

      --
      Slashdot: Where nerds gather to pool their ignorance
    572. Re:In unrelated news... by ozmanjusri · · Score: 1
      With a sig like yours, I don't know why I bother arguing with you

      If you're worried about my capacity for discussion, you're better off looking at my posting history than my sig. Still, in it's defence;

      Nihilism is a philosophical position which denies human existence has any higher meaning, and claims that our belief in higher meaning is a cultural artifact
      Deconstruction is examining philosophical positions in a way which strips them of their cultural artifacts.

      At the very least, my sig is an invitation to rethink nihilism and reconsider the role of a creator. It contains self-mockery, irony and recursion. In two words, it encapsulates a centuries-old argument spanning Nietzsche, Baudrillard, Heidegger and Derrida.

      It is a perpetual literary collision machine. And you consider it a reason NOT to argue?

      Get thee to thy god. You belong together.

      --
      "I've got more toys than Teruhisa Kitahara."
    573. Re:In unrelated news... by cyphercell · · Score: 1

      Yes, but literate wetbacks are literate. The numbers between Wikipedia and the CIA factbook are completely at odds, according to the CIA fact book we have 99% literacy when you include languages other than english. Well above the global average, of course that's including many of our territories too.

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    574. Re:In unrelated news... by sumdumass · · Score: 1

      Neither would be the greater risk. If the candidates understood everything else and were qualified to do the job, this one thing wouldn't have any influence on it at all besides being illegal.

      The issue revolves around why they dismissed this. A higher calling would be the answer and nothing else associated with this higher calling lends to anything else in the project. Unless of course that project is finding examples of evolution. But even in a biblical sense, the sheeple are instructed to obey their masters and give unto Cesar what is Cesar's. So I doubt is would even cause an issue there if they were working in that field.

    575. Re:In unrelated news... by fucksl4shd0t · · Score: 1

      Or, the simplest explanation, he wasn't lying and you're not anywhere near qualified to debate the matter with him (something that happens a lot more than the "wiki legend" you were referring to)? Nah, couldn't be.

      --
      Like what I said? You might like my music
    576. Re:In unrelated news... by ozmanjusri · · Score: 2, Interesting
      But even in a biblical sense, the sheeple are instructed to obey their masters and give unto Cesar what is Cesar's.

      So you're suggesting Christians should believe in god and the teachings of Jesus, but not let their belief change their behaviour in the real world.

      That explains a lot.

      --
      "I've got more toys than Teruhisa Kitahara."
    577. Re:In unrelated news... by eyendall · · Score: 1

      You have to hand it to the USA---even a moron can get to be President. No one ever went broke under-estimating the intelligence of the American public. (P. T. Barnum-a patriotic American).

    578. Re:In unrelated news... by alphamugwump · · Score: 1

      "Deconstruction is examining philosophical positions in a way which strips them of their cultural artifacts."

      Deconstructionism is all about finding some self-referential "contradiction", thumping one's chest, and then feeling clever. Which possibly makes it the most useless, arrogant, and shallow form of thought ever conceived. Seriously, shut the fuck up already. Deconstructionism is like the feedback you hear when you turn up the gain too much on a microphone. It's shrill, meaningless self-reference, and just plain irritating.

      See, I LIKE nihilism. I like Nietzsche. I like Zen. I believe a meaningless world is reason for hope, because it leaves a blank slate that is open to interpretation. But it still bugs me when people dance around in the trappings of logic. Either embrace self-contradiction, or don't. Don't claim to accept it, and then whine about how it's so depressing. Or meta-analyse it.

      Self-analysis is impossible. It's meaningless, but more importantly, it's utterly useless. It's like trying to do eye surgery on yourself. Or trying to stick your head up your ass. Seriously, I have no clue why academics still believe in the self. Because if there is no self, there is no self-analysis, and no contradiction. Fuck Descartes and his cogito. Fuck that bastard up the ass. He's responsible for all the wankery in western philosophy that wasn't caused by Plato.

      Why do postmodern literary dipshits bother to /analyse/ everything if they think it's futile anyway? Oh well, I guess it makes for interesting movies.

    579. Re:In unrelated news... by jeff4747 · · Score: 1

      Bacteria are asexual

      Wrong. Some bacteria are "sexual", in that they exchange genetic material. One example is the F plasmid (http://en.wikipedia.org/wiki/F_plasmid)


      produce changes by evolution forces but the DNA tell us that these are the same bacteria as before with different properties and capabilities

      Just how do bacteria get different properties and capabilities without changing it's DNA? Any changes to 'properties and capabilities' are caused by changes in DNA.


      The fact is that evolution in the essence of creating new and independent species from existing creatures have stopped.

      Actual microbiologists differentiate between macroevolution and microevolution. Macroevolution is speciation and large-scale changes. Microevolution is the tiny changes that eventually lead to macroevolution. Every time a human baby is born, a little bit of microevolution has happened. Add all those microevolution events together over the millenia, and you get the macroevolution that separated our species from apes.

      Anyway, the usual definition of speciation is that the two creatures are so different that they can no longer mate and produce fertile offspring. That doesn't so much apply to asexual bacteria species. So there is no hard-and-fast rule for speciation in bacteria. Any genetically engineered microbe could be considered a new species, or not, and neither is incorrect.

    580. Re:In unrelated news... by conman90 · · Score: 1
      1. The amount of carbon-14 (or whatever element used) in the atmosphere has always been the same

      That's just not true. The amount of C14 is not assumed to be constant. The values are calibrated using a variety of sources (trees, corals, ice cores, etc.). It should be noted that these generally agree with one another, which would definitely be a surprise if there was something deeply wrong with the system.

      Key term here "calibrate," in other words, we can make a guesstimate at the amount of C-14 there was. If you remember, C-14 is often inhaled by organisms and there would be drastically different figures for each specimen depending upon a myriad of environmental factors. Simply put, they are all just guesses.

      2. The rate of decay has always been the same

      Ahh the special pleading and crackpot physics of creationists. We've seen evidence of the constancy of decay supernovae, and if decay rates were not constant, it would have very interesting (and completely unobserved) consequences for quantum mechanics. If something we observe (something that's consistent with all of physics and chemistry, not to mention historical observations) upsets creationists, they'll quickly whip out some new laws of physics and ignore the consequences.

      Well, let's use some pretty common knowledge here... Global Warming is occuring. Everyone can agree to that. So, what are the changes we are seeeing in our environment? As we increase the levels of CO2 in the atmosphere and thereby increase the heat, guess what? The rates of decay increase dramatically! We can valid this through observations.

      BTW, I'm having fun debating with you on this subject, so if we could please refrain from Ad Hominem attacks, I think we could both have a more enjoyable time. :)

      I don't see why young earth creationists have so much trouble with C14 dating given that it's not really used to support any of the evidence that devastates their positions. Far more interesting are things like isochron dating.

      It's funny you mention isochron dating, becuase isochron dating and radiometric carbon dating rely on the exact same assumptions. Just look at my arguments above and you can apply them perfectly to ischronic dating as well.

    581. Re:In unrelated news... by Dadoo · · Score: 1

      41 percent of Catholics agree with that view.

      Odd, given that the official position of the Catholic Church contradicts that view?

      That is odd, given my experience. I lived in Pittsburgh - a city that's roughly 80% Catholic - for most of my life, so I've met a lot of Catholics. In my entire life, I've met exactly two who don't believe humans evolved from earlier species. One of those completely accepts evolution and believes science is mostly correct about the age of the Universe, except he believes that God created humans, specially. He's also a special case: he converted to Catholicism.

      --
      Sit, Ubuntu, sit. Good dog.
    582. Re:In unrelated news... by Mkoms · · Score: 0

      I'd recommend Melanie Mitchell's "An Introduction to Genetic Algorithms".

    583. Re:In unrelated news... by Dadoo · · Score: 1

      Evelution and a litteral interpretation of Creation ARE mutually excslusive.

      I see what you did there. You tried to equate people who insist on "a litteral interpretation of Creation" to "Christians". Nice try.

      --
      Sit, Ubuntu, sit. Good dog.
    584. Re:In unrelated news... by sumdumass · · Score: 1

      Wrong. Some bacteria are "sexual", in that they exchange genetic material. One example is the F plasmid (http://en.wikipedia.org/wiki/F_plasmid)
      Sure they are. But these aren't the ones this PHD was talking about. Lets keep this into perspective.

      Just how do bacteria get different properties and capabilities without changing it's DNA? Any changes to 'properties and capabilities' are caused by changes in DNA.
      I don't think you read the post or understood it. Either could be true but the later is more probable form your reply. Humans have different DNA and are still humans. Likewise, other animals and yes, even bacteria. So changes in their DNA that allow different characteristics do not change the genetic markers that describe who it is. In other words, if you changes the DNA in a person and give them a third EYE, they are still a human but they have a third eye. Do you get it now? or it is still too complicated?

      Actual microbiologists differentiate between macroevolution and microevolution. Macroevolution is speciation and large-scale changes. Microevolution is the tiny changes that eventually lead to macroevolution. Every time a human baby is born, a little bit of microevolution has happened. Add all those microevolution events together over the millenia, and you get the macroevolution that separated our species from apes.
      Nope, You cannot prove that to any extent. That is why we are still on the hunt ofr the missing link. The fact is that other theories of evolution like the buble theory of evolution account for the missing link and doesn't consider speciation possible. To date, even with the microbes, we havn't seen speciation. We seen all but that and I will tell you i was almost convinced at one point. What ends up happening is more or less hte difference in breeds of dogs were you can have the differences vary so greatly, you think it is a new animal but it is in fact still a dog and still very much the same species.

      Anyway, the usual definition of speciation is that the two creatures are so different that they can no longer mate and produce fertile offspring. That doesn't so much apply to asexual bacteria species. So there is no hard-and-fast rule for speciation in bacteria. Any genetically engineered microbe could be considered a new species, or not, and neither is incorrect.
      Yes, This is why I brought up the DNA identification. It is important because we have seen what is so close but there are no confirmed switched in this marker. We have strains and mutation but no natural occurrences which is what we are talking about. I personally believe the bubble theory of evolution is more likley to have happened and this is a reason why we discover new breeds of animals that we call species incorrectly. Notice how when a new Species is found, it is actually a new breed and it is an undiscovered species and not an evolved species? there is an underlying reason for this and GOD isn't one of them.
    585. Re:In unrelated news... by rainman_bc · · Score: 1, Insightful

      What if evolution were the big lie? Thing is, if science came out with evidence refuting evolution, people in the scientific community were to welcome it and move on. They wouldn't cling to it like religious people do.

      That's the beauty of the scientific method. It thinks with an open mind and openly debates topics. It doens't talk about ignoreance of facts, in fact you need to use fact to support your thesis otherwise no one will listen.

      As opposed to anyone who believes solely in the bible who dismisses any empirical reasoning in favour of faith. It defies logic and reason and comes only out of ignorance of fact.
      --
      09 F9 11 02 9D 74 E3 5B D8 41 56 C5 63 56 88 C0
    586. Re:In unrelated news... by Anonymous Coward · · Score: 0

      No. He clearly isn't smart.

    587. Re:In unrelated news... by Dadoo · · Score: 1

      The Catholic church therefore needed to resort to something else.

      I won't argue this with you, and I can't speak for the Catholic church in other countries, but here in the US (assuming that's where you live) you can't tell me the Catholic Church is worse than any others, as far as making money is concerned. If anything, they demand less from their members than most of their Protestant counterparts.

      --
      Sit, Ubuntu, sit. Good dog.
    588. Re:In unrelated news... by sumdumass · · Score: 1

      It is interesting that you claim I ain't qualified to talk about it without any representation to anything i got wrong. Does that mean you ain't qualified either?

      Of course i could back up my statements but I find it better that you do some googling yourself. Something that doesn't happen with the wikki legend.

      BTW, Are you six? Or did i underestimate the credit someone claiming to be a PDH is some related field gets by age group? It seems that you might be 10 or 11 or so. Do me a favior, let me know when you get old enough not to believe someone who just spouts stuff by claiming they are a PHD in the area. It will let me update my books on who we can fool.

    589. Re:In unrelated news... by sumdumass · · Score: 1

      I didn't say that. What the fuck are you reading? I said that the believe or disbelief in this means nothing to a person who is otherwise qualified then presented were the bible has several verses relating to doing things outside the church because you have to to make a living.

      I think the problem with you anti Christian is that you take one thing to mean another and then attempt to generically imply everyone in the religion is of that opinion. This couldn't be further from then truth in real life. Maybe you should get out more and take a real look at life. Also it would help if you read something about the religion you attempt to damn beside you buddy's rendition on why it sucks. Never have I been in a conversation with someone seemingly so ignorant about what you attempt to protest.

    590. Re:In unrelated news... by fucksl4shd0t · · Score: 1

      Let's see if I get this straight. You're having an idiotic argument with someone on a subject of which I have said *nothing*, when that someone says he's got a PhD. So you say that because of his username, you question his credentials (book judged by the cover). So I point out to you that *your* username is "sumdumass". And you take this personally.

      The irony is very entertaining, believe me. You've been trolled good, asshat.

      (No, I'm not qualified to debate with an idiot about evolution, because I'm not an idiot, and I'm well aware what my slashdot username is)

      --
      Like what I said? You might like my music
    591. Re:In unrelated news... by Alsee · · Score: 2, Informative

      genetic algorithms. I might like to explore that a bit. Any idea where I could start?

      Excellent.
      And actually I really should have thought to answer that question in my post. If I'm gonna suggest people go look at something, I should point where :)

      Wikipedia has a very good article on Genetic algorithms. Aside from an overview of the subject, it lists 24 reference books plus links to 21 websites on it.

      A Google search on the exact phrase "introduction to genetic algorithms". Over a hundred thousand hits.... and that's just pages specifically on introduction to genetic algorithms.

      I'd like to add in another particularly interesting link here - the Talk Origins FAQ on Genetic algorithms. It doesn't teach how to program them, but it does give an overview and has extensive discussion on them in relation to biological evolution, it raises and addresses the various arguments anti-evolutionists attempt to use to claim that digital genetic algorithms don't really work or that they some how "cheat" or that the huge success and amazing creative power of digital genetic algorithms for some reason or another do not reflect and support evolution in biology. However I think one of the best parts there is a great list of incredibly impressive examples of real world application and success of genetic algorithms, such as a checkers playing genetic algorithm that achieved expert play level. There was another example that even blew me away... a genetic algorithm where the individuals only has 250 bits of DNA, and which proceeded to create and encode 625 bits worth of genes to simultaneously solve multiple problems. Yes - 625 bits worth of valuable useful new information encoded in 250 bits. It sounds impossible, but actually humans and other species often do the same trick. You do it by overlapping the genes in the DNA, sometimes even encoding one gene forwards in the DNA and another gene reading in the backwards direction across the exact same DNA. That is exactly the sort of insanely impossible problem that evolution excels at. For all of the programmers reading this, imagine trying to write software that did one thing when you executed the code forwards, but which ran a completely different program and solved a completely different problem when you reversed the bytes ran the code in the opposite direction. It's an insanely complex problem that you just cannot intelligently design it... but evolutionary algorithms don't worry about designing things. They do a random search for pieces that just happen to be better (or less worse) than the other random crap, and then stepwise stitching together pieces that get you closer to a solution and random tweaks that just happen to get you closer to a solution. You get can crazy complex solutions that don't follow any logic or reason, they just simply happen to work. Each generation you get crazy random garbage that just happens to work better than the last generation's crazy random garbage. For some problems you can analyze the evolved solution and see clearly how it works and be amazed at the genius simplicity, and for other problems you may evolve an absolutely incomprehensible scramble of disconnected illogical gobbly-gook with the inexplicable property that it simply happens to work. It can come up with an antenna with kinks and angels pointing in all sorts or chaotic random directions with absolutely no reason or logic to the random tangle of twisted metal pointing all over the place... and that evolved antenna will simply have the inexplicable property that it "just happens to work" incredibly efficiently at sending and receiving certain frequencies and certain polarizations of radio in specific directions or in specific ranges of directions or in all directions - whatever the natural selection rule was that's what

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    592. Re:In unrelated news... by ozmanjusri · · Score: 1
      Seriously, shut the fuck up already.

      The end point of deconstruction is nihilism, however the STFU meme you're referencing there has more to do with emo, angst and a schadenfreude-like malaise ovetaking western youth. There also some reference to the iconoclastic irreverence in Australian larrikin tradition in my previous posts.

      --
      "I've got more toys than Teruhisa Kitahara."
    593. Re:In unrelated news... by hobo+sapiens · · Score: 1

      No, I can't argue with you on that. You are right. It's all a question of how you want to get ripped off. Want to go to Catholic church? Well, be prepared to pay up if you want your dead family members prayed out of purgatory. Rather go be a Baptist or Pentecostal? Well, that's ok too. There you will be have all kinds of scare tactics used on you about an evil god who burns people in hell. Become a protestant of another stripe and instead of receiving bible teachings, you get pseudo-theology which is really just feel-good psychology. And so on.

      Not that they don't do some good. But the damage the churches cause outweighs the good they do. I mean no offense to anyone, but the churches have totally deviated from what they purport to teach. If you want to teach people social gospel or use scare tactics on people, then fine, but don't claim that the bible supports that stuff.

      Like I said, I don't mean to offend anyone. Just speaking my mind.

      --
      blah blah blah
    594. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Yeah, he beat the crap out of that strawman, didn't he?

    595. Re:In unrelated news... by Anonymous Coward · · Score: 0

      "Thing is, if science came out with evidence refuting evolution, people in the scientific community were to welcome it and move on. They wouldn't cling to it like religious people do."

      no they would not, and you know it. evolution IS your religion, you hypocrite! you say there is no god, yet you make a god out of yourself. people like you are so full of yourself and your own ideas it makes me sick.

    596. Re:In unrelated news... by ozmanjusri · · Score: 1
      Also it would help if you read something about the religion you attempt to damn beside you buddy's rendition on why it sucks. Never have I been in a conversation with someone seemingly so ignorant about what you attempt to protest.

      I was involved with a Jesuit seminary for more than six years, and we were able to discuss this and similar philosphical issues without recrimination. It's a shame more Christians can't practice similar tolerance.

      --
      "I've got more toys than Teruhisa Kitahara."
    597. Re:In unrelated news... by alphamugwump · · Score: 1

      "There also some reference to the iconoclastic irreverence in Australian larrikin tradition in my previous posts."

      Where I'm from, we call that trolling. Yeah, I know, it took me a while to catch on. You win.

    598. Re:In unrelated news... by N3wsByt3 · · Score: 1

      "If he were to put the secrets of the universe in front of us on a silver platter, that would destroy faith."

      Not at all, unless you mean *blind* faith.

      If I were to suddenly see all the secrets of the universe on a silver platter, my faith would certainly augment that there is a being powerful and all-knowing enough to be called god.

      In fact, if such a thing would happen, I suspect milions would have more faith in such a being than that which they have now.

      A master chef doesn't want to impart his recipes, because he's petty enough to consider those his own property, which only he has the right to it. Basically, he wants to 'guard' his recipes from being used by others. Are you claiming God has the same tendencies?

      --
      --- "To pee or not to pee, that is the question." ---
    599. Re:In unrelated news... by mobydobius · · Score: 2, Informative

      Einstein gave us a deeper understanding of gravity that applied even more universally than Newton's law, but it didn't invalidate Newton's law. It's still the best formulation to use for non-relatavistic, massive bodies.

      Yes it did invalidate Newton's laws. Einstein's relativity completely invalidated the newtonian view of gravity. Sure, its used still, but in every case, Einstein's predictions about what a couple of bodies will do, no matter how massive, is more accurate than Newton's.

      Kudos to Newton for having the best description for so long, but it turns out he was completely wrong. And when someone comes up with a unified theory that predicts things better than Einstein's relativity and whatever is current in the quantum world, at the same time, then those will be completely wrong.

      And that is how science works.

      --

      "I like to wear big boy pants."
    600. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Do you need evidence for evolution? Have you seen dogs? I admit that the different races of dogs are not exactly an evidence, as they where not produced using natural selection, yet would you claim other that that the fittest survive (and reproduce)? Let us talk about antibiotics. Do you know why you should not over-use antibiotics? The reason is evolution. Evolution of the bacteria, in the new enviornment, containing antibiotics. If some of the bacteria survives, they will ususally be adjusted to this enviornment, and so this antibiotic will be useless against them.

      The problem here is not the lack of evidence, there are many evidences supporting evolution, and there is none opposing it. I promise to abandon evolution once someone will find rabbit fossils in a juratic rock.

      By the way, please give a little thought to your invented statistics, so they won't be so ridiculous. And also, it seems as if you have learned about evolution in an american public school, it has nothing to do with the beginning of life, only in its evolution.

    601. Re:In unrelated news... by ozmanjusri · · Score: 1
      Where I'm from, we call that trolling. Yeah, I know, it took me a while to catch on. You win.

      Well, it was April 1...

      Actually, the sig isn't meant to be a troll, I was hoping it'd be a little thought-provoking. At least it has generated an interesting discussion...

      And I wasn't chasing a win, I thought we were both enjoying the talk. If that's not the case, I apologise.

      --
      "I've got more toys than Teruhisa Kitahara."
    602. Re:In unrelated news... by Profound · · Score: 1

      >> is even evidence that it could have once been a giant lake, fish bones and such in desert.

      Or, it was underwater millions of years ago...

      >> Then when the dam broke water rushed out and carved the Grand Canyon. The idea is also supported from the fact that rushing water takes the path of least resistance and thus would explain the randomness of its path.

      Actually, if that amount of water broke all at once it would likely cause an explosive exit, not a meandering path like the Grand Canyon. That seems better explained by a slow meandering river taking millions of years.

      >> The Earth's rotation is slowing over time, by about 2 milliseconds a year. This means that billions of years ago when the Earth was so-called created the days were about 13.5 hours. The Earth's rotation would be so great that gravity would make it impossible to live and survive.

      I think you are confused about centrifugal force and gravity (though that's the least of your problems)

    603. Re:In unrelated news... by N3wsByt3 · · Score: 1

      "[]you take one thing to mean another and then attempt to generically imply everyone in the religion is of that opinion."

      Let's say, for arguments' sake, this is true. What about a refined (similar) question, then? Who would be most suited for the project, if the project was directly related to evolutionism, and one of the candidates was a christian with a strict interpretation of the Bible (including the creation-tale), and the other, say, an atheist who uses only logic and observational evidence as a basis of his believes?

      If you still argue that both are equal because both are qualified and belief is of no influence on it, then the premise is, that it DOES NOT have influence on his work. It therefor follows, that he has to act on the observational evidence he finds, not on his beliefs. In that sense, the parent poster was right to claim they can't let their belief change their behaviour in the real world (at least, as far as the project is involved).

      --
      --- "To pee or not to pee, that is the question." ---
    604. Re:In unrelated news... by David+Rolfe · · Score: 1

      But is it wrong?

      Yes. Chance did play a big role in it, and "supernatural forces" played none, but to trivialize the conditions that led to the formation of the universe, Earth-like planets and life as "it just happened by chance" is so simplistic as to be intellectually weak. I guess this is what I'm having trouble with: If, as you concede, chance did play a big role in it, what played the other roles?

      Now, back off-topic: regarding the fantastic exercise in probability, 2^-2M still is not zero. Arguing whether or not a number will be expressed seems rather pointless though. Will the universe exist for 2^2M nanoseconds? I could be looking dumb as you put it, but I accept it will. (The big crunch is off the table at this point, isn't it?) What it looks like to me though is that it's quite a bit more likely than "a million monkeys writing the complete works of Shakespeare". :-D (a string of 4 million or so letters and punctuation, etc.)

      Anyhow, I obviously don't know as much as you do about biology, so I look forward to your answer to my first question.

      Oh, I also wanted to mention the rhetorical about ego wasn't a stab at you in particular. Generally, man has often been resistant to ideas that diminish his central importance to life, the universe, and everything. Hence, there has been great strife and controversy at the introduction of such ideas, e.g. heliocentrism, naturalism, cosmology, evolution, atheism, etc. I had just assumed that you took issue to the dumb luck of "the absurd universe" (as Paul Davies' put it), that will be moot in a moment though when you mention/explain the other roles responsible for life. I know, I'm an ass for assuming.
      --
      Read Heinlein's 1953 Revolt in 2100, now more than ever.
    605. Re:In unrelated news... by Phil+Karn · · Score: 2, Informative
      Not only is the distinction between "microevolution" and "macroevolution" entirely artificial, but those terms are entirely creationist in origin. They have no scientific meaning.

      In mainstream biology there is only one form of evolution. Mainstream biologists never the terms "microevolution" and "macroevolution" except to refute the creationists in their own language.

      Creationists devised those terms in a desperate attempt to reconcile the overwhelming empirical evidence for evolution with religious dogma claiming that God created all the various "kinds" of plants and animals in their present forms. ("Kinds" is another purely biblical term that has no use in mainstream biology.) Creationists could no longer deny clear examples of evolution such as the development of bacterial antibiotic resistance or human sickle-cell trait (an evolutionary adaptation to malaria), so they try to pretend that these constitute a "micro" form of evolution that is somehow fundamentally different from the way that evolution produces new species ("macroevolution").

      Evolution is a slow process that has acted on earth for billions of years. The evolutionary changes one can see during the span of a single human lifetime are necessarily small, but they are no different in principle from the much larger changes that occur over much longer periods of time. In other words, "macroevolution" is nothing more than "microevolution" plus long periods of time, and the creationists cannot plausibly argue otherwise.

    606. Re:In unrelated news... by sumdumass · · Score: 1

      Tolerance of what? To having the entire statement being misrepresented in the name of furthering something the exact opposite of the point you were making?

      And maybe the Jesuit seminary clouded something for ya. But not all Christians are that way. I would say the majority of people claiming to be Christians are this way because they believe in a god and jesus but don't goto any church and aren't any denomination outside what their parents were when they forced them to go.

      And yes, A Christian can be a Christian without pushing it on everyone and everything. Making exceptions to one incident or one facet of an incident doesn't represent their entire life. In case your wondering, It was the absoluteness of your statement that sent me off. It is a typical ploy of the anti religious crowd. If you want to debate this more, we can do so. But if i say something, that is exactly what i said, not some misrepresentation of it. Personally, I'm not real religious. I am in the crowd I just described above who associate themselves because that how they were taught. But that doesn't mean I haven't looked into what the bible or other religions have to say either.

      I take great offense at someone attempting to deny someone's personal religion when the scope doesn't come close to making one bit of difference to their objective. This is how i took the original question implying something shouldn't be eligible because of a personal belief.

      And implying that I would be able to reject empiricism and make a leap of faith is somewhat slanted. There is evidence of evolution in the way things evolve to suit their habitat but not any direct evidence of common linkage between different species. In other words, You would have to do the same to believe in evolution and common ancestry thories developed form within it. This is a big stickler because the justification for the belief revolves around other believing it too. How is that different? They call it something different from faith but it carries the same concept.

    607. Re:In unrelated news... by JustinY2K · · Score: 2, Informative

      Your statement on when the Bible was formed is erroneous. Christ died in about 30 AD, and the first books appeared some ten years later. The last book was written probably around 80-90 AD. By the early 100's, the early Christians were circulating two books that they called "The Gospel," which included the four gospels, and "The Apostle," which had the writings of Paul plus the letters of Peter, Jude, etc. The point is that the Bible as we have it today was complete in its entirety before 120 AD. The Roman councils on the subject just left everything as it had already been for some time. The manuscripts that we have from the time match those that we have today, with minor variations for different spellings of the same name, that kind of thing.

      If you want to insult a great number of people, which you apparently do, go ahead and call Jesus a Muslim prophet. However, if you want to enjoy an actual discussion on the subject like a mature adult, you might want to refrain from such bigoted comments.

    608. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Here's the flaw in evolution - the whole concept of *usefulness*. Tell me, how does dirt make a decision? Here's the flaw in gravity - the whole concept of *force*. Tell me, how does dirt make a decision?

      Those statements are suffering the same logical problem, antropomorphic personification of dirt. Dirt does not make decisions. Of course, as baceria is organized dirt, it does not make any decisions as well (and stars, winds, dogs and humans are also deterministic). Evolution does not describe the decisions organsims make or those or the species, it describe the behaviour of those species. Would you disapprove any theory that describe the behaviour of matter?

      Of course we can stray into irreducible complexity Oh, great, let us stray there. There are two problems with irreducible complexity:

      a) No mechanism was ever shown to be irreducibly complex, as one must prove that with out any of its "components" it is useless. Not just not working in the same way, or for the same purpose, but useless in any context. Organs may change purposes over time, this was shown fantasticly with the bacterial flagella (the original example of irreducible complexity) that is very similar to "type III secretory system", some anti-bacteria mechanism.

      b) Even if a mechanism is irreducibly complex, it still doesn't mean that it couldn't evolve by removing parts of a more complex mechanism, or by changing many parts at the same time (which is expected even when you change only one gene in the genome).

      So there are no irreducibly complex mechanisms that we know of, and even if there where they could be created by evolution.

      There is also the problem of the Second Law of Thermodynamics Yes, this law is a problem. It will stop us from building a perpetual motion machine. But as the ecology, let alone organisms and species are not close systems, so the laws of thermodynamics can't be applied to them. Isolate some life (without incoming energy as well, of course) and evolution will soon stop (and the life as well).
      By the way, do you know what exactly is the second law, or is it just something you use against complexity? The universe has managed to create galaxies and stars altough the second law can be applied to it, you know.
    609. Re:In unrelated news... by ozmanjusri · · Score: 1
      I take great offense at someone attempting to deny someone's personal religion when the scope doesn't come close to making one bit of difference to their objective. This is how i took the original question implying something shouldn't be eligible because of a personal belief.

      Ok, I'll rephrase the question;

      If a goal of my project conflicts with the employee's belief, which should they choose?

      --
      "I've got more toys than Teruhisa Kitahara."
    610. Re:In unrelated news... by sumdumass · · Score: 1

      We are getting into a lot of hypothetical situations here. But if a person was able to go into a field were they would be positioned to act on research outside their faith that directly contradicts their faith, then OF course they are in a position to follow a script outside their belief system in order to achieve a certain goal. But it really no different then acting in a movie of a play. It is a means to an end that puts food on the table and cloths on the back.

      And the end to the means of what you stated. However the GP wasn't correct because he used it in a general sweep of Christians. This decision is one made by the individual who decided to go into this field. It in now way reflects the convictions or beliefs of others claiming to be Christians or their determination to remain inside their faith. Do you see a difference here? The actions of one person doesn't dictate the entirety of them because of some association. People claiming to be Christian turn out to be criminals too, that doesn't make every Christian a crook just like a black kid robbs the corner store doesn't make every black kid prone to robbing a store.

      People do things for their own reasons. The bible has scenarios setup that allow this to happen. There are few things you can do that you are bound to the religion as spoken to a tee. Some versions of Christianity allow you to commit adultery, drink alcohol, and absolve anything considered a sin by repentance. I always say the best religion would be a cross between Mormon and Irish Catholic with a little protestant mixed in. But then I have a thing for redheads.

    611. Re:In unrelated news... by sumdumass · · Score: 1

      Yea, I know I have been trolled. Buy who cares? You are making references that any idiot other then you could see isn't what was said. I pointed it out to you and you then claim to not be involves.

      I would say your an idiot in the classical example of one. I'm reminded of dumb and dumber were they don't the stupidest thing to make everyone laugh and then attempted to pass it off as normal. I cannot get that scene out of my mind when I think of you. But I know, You are one of the smartest people in your little world. Don't get offended when you come to the real world and sumdumass is smarter then you. It is just the way life works.

    612. Re:In unrelated news... by mapkinase · · Score: 1

      Yeah, right. How on Earth a historical "science" is bloody falsifiable???

      --
      I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
    613. Re:In unrelated news... by fucksl4shd0t · · Score: 1

      Two words: Reading comprehension. (I didn't say anything about evolution, because arguing over the internet is just like running in the special olympics...)

      --
      Like what I said? You might like my music
    614. Re:In unrelated news... by MattHaffner · · Score: 1

      Yes it did invalidate Newton's laws. Einstein's relativity completely invalidated the newtonian view of gravity. Sure, its used still, but in every case, Einstein's predictions about what a couple of bodies will do, no matter how massive, is more accurate than Newton's.

      I was talking specifically about the universal law of gravity, and no, Einstein's GR does not invalidate Newton's equation. In the limit of weak gravitational fields and non-relatavistic speeds, the GR equations are required to converge to exactly Newton's equation. It's a special case of the more general theory. And it is right (or, I would say valid) for those conditions.

      Yes, Newton's (and the others' that helped lead to it's formulation) idea behind a gravitational force is tremendously less complete than Einstein's GR, a more complete description of space-time. If something comes along that describes these effects even better than GR, we will have a new theory, but the formulation of GR will still be valid when the conditions hold for which it was designed and rigorously, experimentally tested.

      Maybe it's semantics, but in my mind using right and wrong for scientific theories just promotes the idea that nothing we're claiming as a theory at the moment is right and opens the door to someone then inferring that they aren't valid and that their preferred alternative is just as good.
    615. Re:In unrelated news... by Mr.+Slippery · · Score: 1

      It's grossly ignorant to suggest it's not a series of chemical reactions

      It's grossly ignorant to confuse experiences of subjective personal realities, with observations of objective consensus reality. (Also beware of confusing maps with territories, menus and meals, equations with things, and summer days with pretty girls.)

      unlike numeracy (which is human construct), what we know as love existed long before Homo Sapiens came along.

      You're suggesting that numbers did not exist until humans came along?

      Not only does that make figuring out the physics of the early universe interesting, trying to write equations without numbers and all; but it is known that non-human animals have some basic concepts of numbers.

      --
      Tom Swiss | the infamous tms | my blog
      You cannot wash away blood with blood
    616. Re:In unrelated news... by sumdumass · · Score: 1

      Yep. Reading comprehension. Were did I discus this with you or attempt to disprove anything you didn't say about evolution. All my statements were in the context of the PHD poster.

      I'm starting to see how you would know what running in the Special Olympics is like.

      Good day and god bless you.

    617. Re:In unrelated news... by jeff4747 · · Score: 1

      Wrong. Some bacteria are "sexual", in that they exchange genetic material. One example is the F plasmid (http://en.wikipedia.org/wiki/F_plasmid)

      Sure they are. But these aren't the ones this PHD was talking about. Lets keep this into perspective.

      The F plasmid is just the most famous example of "sexual" activity in microbes. There's lots of others. You also have no idea what bacteria "this PHD" was talking about.

      So changes in their DNA that allow different characteristics do not change the genetic markers that describe who it is

      That depends entirely on your threshold for speciation. In an asexual species, you could consider every change in DNA to be speciation. Or you could require massive physiological changes. Neither is incorrect due to their reproductive strategy.

      An example: You could consider the 'flesh eating' aspects of the 'flesh eating' strand of E. coli to indicate it's a different species. However, it's DNA is fairly close to other strands of E. coli that are harmless. IIRC, the flesh-eating variety produces one additional protein, an exotoxin that does the actual 'flesh eating'. Just one protein, but massively different behavior.

      if you changes the DNA in a person and give them a third EYE, they are still a human but they have a third eye. Do you get it now? or it is still too complicated?

      Two points:

      1. The number of eyes is irrelevant for speciation in humans, because we reproduce sexually. If your tri-clops can mate with a 'normal' human and produce fertile offspring, then it's still human. If the children are infertile (or there are no children), then it's a new species.

      2. Never assume that the person you are talking to is an idiot. As a real-life microbiologist, I assure you I know more about bacteria, mutation, and speciation than you do. One piece of evidence: your irrelevant 3rd eye question.

      Add all those microevolution events together over the millenia, and you get the macroevolution that separated our species from apes.

      Nope, You cannot prove that to any extent.

      What, exactly, happens when individuals collect a small series of mutations over millenia? Please be specific, since you're claiming it's not macroevolution. My position is that lots and lots of little changes add up to big changes. Your position is....?

      That is why we are still on the hunt ofr the missing link

      There is no such hunt. Human evolution is now quite well documented from Austrailopithicus to modern humans. At one time there were a few significant leaps in physiology, but discoveries in the last 20 years have filled in those leaps with examples of intermediate species.

      To date, even with the microbes, we havn't seen speciation.

      False. Or maybe not. You have to define speciation in asexual bacteria. I personally have done a lot of gene splicing that lead to what I'd consider new species. For example, I've made bacteria that produce several human proteins. They have 30% more DNA than their originating species, so I'm pretty confident at calling it a new species under any sane measurement.

      Until you provide some specific empirical measure of speciation in asexual bacteria, you have no way of saying speciation has happened or has not.

      What ends up happening is more or less hte difference in breeds of dogs were you can have the differences vary so greatly, you think it is a new animal but it is in fact still a dog and still very much the same species.

      Once again, irrelevant to bacteria. Dogs reproduce sexually, so they are not an anti-speciation example in asexual bacteria. In addition, there are several 'dog-like' creatures in the fossil rec

    618. Re:In unrelated news... by xerxesVII · · Score: 1

      My "proclamation" as such is to prevent "God did it" out of the line of answering. "How did God do it?" if you must, but there are those who consider it heresy to attempt to crack such mysteries. The idea that mere man could possibly unravel how God did anything can be very upsetting to these people and as long as you are entertaining them by allowing God into the conversation you've opened the door to their further interference.

      And that's why I say leave the theology out of the science classroom. Nature may have no subjects, but schools most certainly do.

      --
      "We shall grapple with the ineffable, and see if we may not eff it after all." - Douglas Adams
    619. Re:In unrelated news... by sumdumass · · Score: 1

      Now directly to you question, They should choose whatever their greatest need is at the time. If their need is to have a job and place food on the table and this was the only way of most likely way this could be done then they should choose forgoing their faith and doing what is necessary. But they have to reconcile this with themselves and their god. There are passages in the bible to support a move in either direction.

      This is a question that is asked and answered everyday. It even involves the ten commandments, the one part of the bible that is supposed to be taken verbatim. Cops can be devout Christians and find the necessity to kill someone in order to save someone else from harm or loss of life. So while some churches count the shall not kill as killing under any circumstance, others read it as murder and the tiny justification is that one is unwarranted while the other is warranted.

      Either way, They have chosen a job that might require them to break a commandment in order to save an innocent life. This makes the person no less of a Christian and doesn't proclaim that every Christian should do the same. We are coming on easter and to stop short of giving a sermon, Jesus asked god to forgive his executioners while dying at their hands.

      In other places it says he directed people to obey the laws of the land even when they weren't God's laws. He said to give unto Cesar what is Cesar's. And that is enough preaching by me. The point is that we are often confronted with tasks that directly conflict with our convictions. The necessity of performing those tasks can be justified by the convictions even though they contradict them. But it is upto the individual to take the circumstance into perspective with their conviction and faith.

    620. Re:In unrelated news... by ahodgson · · Score: 1

      I'm not a scientist or high level scholor, but there are some holes in evolution just like there are some holes in creationism, but saying that just because there is some evidence to support evolution doesn't mean that creationism is bunk either.

      There are no holes in the basic theories that comprise evolution. Natural selection is the only scientific theory available that explains the complexity of life.

      Comparing it to creationism is completely invalid; creationism is not a scientific theory. There is no evidence for it. It is purely wishful thinking. It doesn't even explain anything, because in order to be true it has to have a creator, whose existence in turn would seem to require an explanation.

    621. Re:In unrelated news... by ahodgson · · Score: 1

      Surely the spontaneous origin of very simple life is more likely than the spontaneous creation of an all-powerful, all-knowing being who then created life, though.

    622. Re:In unrelated news... by Anonymous Coward · · Score: 0

      There is no such thing as micro or macro evolution. Those terms belong to creationists trying to shed misinformation. New species do not appear out of the ether. They are the product of many small steps accomplished via natural selection, most usually in populations that are separated from the majority of their original species.

    623. Re:In unrelated news... by amRadioHed · · Score: 1

      A master chef doesn't want to impart his recipes, because he's petty enough to consider those his own property, which only he has the right to it. Basically, he wants to 'guard' his recipes from being used by others. Are you claiming God has the same tendencies? Have you read the Old Testament? Yeah, he is quite petty and jealous actually.
      --
      We hope your rules and wisdom choke you / Now we are one in everlasting peace
    624. Re:In unrelated news... by amRadioHed · · Score: 1

      The first few popes were also the roman emperor by some coincidence. Where you getting your facts from dude? The first Pope was Peter. According to legend Peter was crucified by the Roman government. Are you claiming that his crucification was a suicide?
      --
      We hope your rules and wisdom choke you / Now we are one in everlasting peace
    625. Re:In unrelated news... by amRadioHed · · Score: 1

      Well his party, The Labour Party, used to be a Socialist party. It's understandable that someone could assume Blair was also a socialist even though he is quite a bit less socialistic than many others in his party.

      Still, by US standards just about every government in Europe is probably Socialist so I guess it's a relative term.

      --
      We hope your rules and wisdom choke you / Now we are one in everlasting peace
    626. Re:In unrelated news... by amRadioHed · · Score: 1

      History is not science. All that people can know about history is from second or third hand accounts at best, science can be observed first hand by anyone inclined to do the experiments and observations. That is why your comparison of the two is rubbish.

      --
      We hope your rules and wisdom choke you / Now we are one in everlasting peace
    627. Re:In unrelated news... by ozmanjusri · · Score: 1
      They should choose whatever their greatest need is at the time.

      If their greatest need is to support their religion, and not my project's goal, what will happen to my project?

      --
      "I've got more toys than Teruhisa Kitahara."
    628. Re:In unrelated news... by amRadioHed · · Score: 1

      Why is people believing in god such a big problem for some? Would you feel comfortable knowing that your government is run predominantly by people who believe that Santa Clause is real?

      If not, please explain how that is different from faith in God.
      --
      We hope your rules and wisdom choke you / Now we are one in everlasting peace
    629. Re:In unrelated news... by amRadioHed · · Score: 1

      What is the difference between microevolution and macroevolution other than scale? It seems pretty obvious we haven't directly witnessed speciation yet just because we haven't been making observations for long enough.

      Or maybe we have witnessed it. The classification of creatures that reproduce asexually into species is fairly arbitrary, is it not?

      --
      We hope your rules and wisdom choke you / Now we are one in everlasting peace
    630. Re:In unrelated news... by Anonymous Coward · · Score: 0

      God would have to be pretty petty to create this vast universe just to test these hairless apes on an insignificant speck of nothingness.

    631. Re:In unrelated news... by amRadioHed · · Score: 1

      Nope, You cannot prove that to any extent. That is why we are still on the hunt ofr the missing link Nope. The only people who "claim" to be looking for the mytological "missing link" are creationists. Anyone with any education knows that evolution is a gradual and continuous process. You can't discover every transitional form in a species evolution any more than you can list all the real numbers between 0 and 1.

      It's just another bogus form of the old creationist "God of the gaps" argument.
      --
      We hope your rules and wisdom choke you / Now we are one in everlasting peace
    632. Re:In unrelated news... by alshithead · · Score: 1

      "But thinking that evolution isn't supported by evidence, or isn't widely accepted by scientists, is just plain ignorance."

      Not just ignorance but WILLFUL ignorance. I just don't get how believing in God and Jesus equates with ignoring the tremendous scientific evidence of evolution. How does faith trump logic? The news is full of newly discovered fossils and the evolutionary record grows daily. I just attended a seminar on avian anatomy and there is no doubt in my mind that birds evolved from a branch of dinosaurs/reptiles way back when. Evolution is fact no matter what religious folks say. Any serious study of biology can't help but provide tons of evidence in favor of evolution. The "devil" is in the details...and he didn't salt the earth with fossils in order to gain more souls.

      --
      I reserve the right to think for myself. Others' opinions are optional. Puppy on lap = typos...not illiteracy.
    633. Re:In unrelated news... by Fordiman · · Score: 1

      "By the way, I'm also not convinced that these processes are "known to happen on Earth prior to life". I suspect that what you "know" about conditions on Earth before life are based on what you've concluded "must have been" in order for life to have formed the way you believe it did, rather than on any evidence of what the conditions really were. But who knows?"

      No, by "known to happen on Earth prior to life", he means "what science has concluded the earth was probably like, given geological and glacial evidence", not "What we want it to be".

      Seriously, that's creationist talk; scientists don't work that way.

      --
      110100 1101000 1101000 1100110 0 1101111 1101000 1100011 1
    634. Re:In unrelated news... by Fordiman · · Score: 1

      Funny. The appendix isn't mentioned anywhere in that article. O learned one, what is the purpose of the appendix?

      As I understood it, it's a leftover from when we ate raw meat.

      --
      110100 1101000 1101000 1100110 0 1101111 1101000 1100011 1
    635. Re:In unrelated news... by Copid · · Score: 1

      Key term here "calibrate," in other words, we can make a guesstimate at the amount of C-14 there was. If you remember, C-14 is often inhaled by organisms and there would be drastically different figures for each specimen depending upon a myriad of environmental factors. Simply put, they are all just guesses.

      No, they're not just guesses. If they were, you'd have a point, but the amount of C14 is measured from samples of known age. Counting down ice cores and tree rings allows scientists to create a catalog of what the atmosphere's C14 levels looked like over the years. You say they're just guesses, but in reality, quite a lot of work goes into standardizing the data. As I said before, though, there are other methods that are even better because they are able to self-check for problems like the ones you describe.

      Well, let's use some pretty common knowledge here... Global Warming is occuring. Everyone can agree to that. So, what are the changes we are seeeing in our environment? As we increase the levels of CO2 in the atmosphere and thereby increase the heat, guess what? The rates of decay increase dramatically! We can valid this through observations.

      I've said this before in these discussions and I'll probably say it again but, please show your work. Don't take it personally, but the assertion you just made is far too handwavy to be taken at face value, and as far as I know, quantum mechanics gives us no theoretical reason for this to be true in the temperature regimes you're talking about. As far as I can recall (and I don't have copy of Dalrymple with me, so please forgive me from working from memory), changes of over 1000 degrees C don't seem to alter C14's decay constant. I seriously doubt that a few degrees C are going to do it under normal Earth conditions. If you have some numbers to show, I'd be interested.

      BTW, I'm having fun debating with you on this subject, so if we could please refrain from Ad Hominem attacks, I think we could both have a more enjoyable time. :)

      It should be noted that ad hominem isn't Latin for, "That was a mean thing to say!" I suggest that if you'd prefer that your physics be taken seriously, start doing some calculations and stop inventing physical laws that don't exist. I was already a bit grouchy when you responded to me, and you did so by essentially calling thousands of scientists incompetent, stupid, or frauds. You can't seriously think that the objections that you're bringing up have gone unnoticed by the scientific community until now, can you? Obviously not, so they must either be too thick headed or incompetent to understand them, or the entire community of atomic physicists is involved in a conspiracy to defraud us. I'll leave it to you to decide which one you were suggesting.

      It's funny you mention isochron dating, becuase isochron dating and radiometric carbon dating rely on the exact same assumptions. Just look at my arguments above and you can apply them perfectly to ischronic dating as well.

      If you honestly believe that, whoever taught you about isochron has sold you a bill of goods. You might seriously consider rethinking whatever other material they sold you while you're at it. What, specifically, are you wrong about? Well:

      * Isochron dating does not require that the initial amount of the daughter isotope be known.
      * Contamination of either the parent or daughter isotope can generally be detected because the data will no longer be collinear.

      To some extent, isochron dating is "self calibrating" in that finding data that are not collinear immediately means that something is wrong, and that finding collinear data is a strong indication that the system is working. Is it foolproof? Certainly not. The ICR's grand canyon dating project shows that sufficiently careful selection of data can break nearly every dating tool. Does it s

      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
    636. Re: In unrelated news... by Fordiman · · Score: 1

      Oh, 98% of the virtual scientists (scientists that only exist on paper as absentee votes, post mortem) support creationism, but that's nothing compared to the imaginary and irrational ones. They ALL believe in creationism. Look, I'll ask one. ...

      Yup, this one believes that god made the earth in six days, about 6k years ago, on a flat earth with a sun revolving around it, and knows this, of course, 'cos they chat all the time.

      --
      110100 1101000 1101000 1100110 0 1101111 1101000 1100011 1
    637. Re:In unrelated news... by sumdumass · · Score: 1

      Nothing will happen to your project because they wouldn't take the position. If they did, then they have made the other choice.

    638. Re:In unrelated news... by Casshan-Robot+Hunter · · Score: 1

      Umm, you're a moron. Welcome it and move on? You need to get in touch with the real world.

      --
      Why oh why didn't I take the purple pill?
    639. Re:In unrelated news... by mpe · · Score: 1

      Most of them just use the tactic of saying things longer and louder than everyone else in the room and eventually people will believe you.

      At least those still in the room might do, assuming they havn't fallen asleep... Anyone who dosn't believe you having probably left at that point.

    640. Re:In unrelated news... by geminidomino · · Score: 1

      Check out the Old Testament. He's pettier than my girlfriend during her "lady time" (also known as 'stay in my room and stay quiet' week).

    641. Re:In unrelated news... by ealar+dlanvuli · · Score: 1

      Or, more fundamentally, Godel put a crimp on this whole discussion about proving and disproving things in the 1930's.

      Just thought I'd troll to see if any actual CS majors still read this site (I doubt it).

      Ealar

      --
      I live in a giant bucket.
    642. Re:In unrelated news... by N3wsByt3 · · Score: 1

      Exactly, and why would anyone want to follow a petty god anyway? ;-)

      Xian belief (as described in the bible) is so piled up with contradictions, that it is mindboggling some people just keep using it as anything more then a fairy-tale composed by a group of superstitious nomads.

      The discrepancies between the god described in the old testament and the new one, alone, would already indicate a shizofrenic God.

      In a certain sense, however, many things would make more sense if, indeed, God was a petty and jealous being, who didn't mind ordering His people to destroy a city and kill everyone in it, including women and children. However, this is something most xians vehemently deny.

      --
      --- "To pee or not to pee, that is the question." ---
    643. Re:In unrelated news... by ozmanjusri · · Score: 1
      Nothing will happen to your project because they wouldn't take the position. If they did, then they have made the other choice.

      That's a copout.

      --
      "I've got more toys than Teruhisa Kitahara."
    644. Re:In unrelated news... by Khomar · · Score: 1

      The appendix, like the tonsils, are part of the immune system. From the linked article:

      There are two main theories about the function of the appendix. Some experts think it serves as a "factory" for bacteria that help us digest the cellulose in some plants we eat. But most scientists believe that both the appendix and the tonsils are part of our immune system, manufacturing B-Lymphocytes, which are white blood cells that produce antibodies to fight infections in the body.

      We can live without it, but that doesn't mean that it doesn't serve a purpose while we have it.

      --

      I believe in de-evolution. God made the world perfect, man fell, and its been going downhill ever since!

    645. Re:In unrelated news... by Fordiman · · Score: 1

      "There are two main theories about the function of the appendix. Some experts think it serves as a "factory" for bacteria that help us digest the cellulose in some plants we eat."

      Which, if I remember correctly, is the prevailing theory.

      "But most scientists believe that both the appendix and the tonsils are part of our immune system, manufacturing B-Lymphocytes, which are white blood cells that produce antibodies to fight infections in the body."

      The appendix had been found to contain these cells, not to produce them.

      "We can live without it, but that doesn't mean that it doesn't serve a purpose while we have it."

      There's no evidence that being born without, or having it removed very early in life leads to even a compromised immune system.

      Knowing that - even if it did produce B-Lymphocytes - it's a vestigial organ, pressed into some other function. It's even possible that an appendix that produces B-Lymphocytes enables its host to survive more statistically frequently, leading to a stronger expression of it in future generations. That doesn't make it any less vestigial, just repurposed.

      --
      110100 1101000 1101000 1100110 0 1101111 1101000 1100011 1
    646. Re:In unrelated news... by N3wsByt3 · · Score: 1

      "Animals don't adapt to their environment."

      Well, actually, many animals do adapt to their environment (to varying degrees), but that change in behaviour isn't hereditary (which otherwise would constitute the obsolete Lamarckism, as you correctly point out).

      You know, pondering about it, there is only one thing I have difficulty understanding with evolutionism (which I am a strong proponent of). I don't know if you're a biologist or not, but if someone could give me a good explanation I would be glad.

      In the case of social groups of insects, like bees and ants, you have different classes/groups of individual insects within one hive, some of which are highly specialised. I can't quite understand how that works, using darwinistic evolution. When one follows the theory of evolutionism with, say, mammals, it makes sense: a genetic change in sperm or egg can lead to an indivdual who is less or more adapted to their environment, and this indivdual passes those traits to his/her offspring.

      But, in the case of social insects like ants, you have one queen (and usually one dar) who supplies all the sperm and eggs that the queen uses to create her offspring, resulting in sometimes very specialised ants/bees. But how did that specialisation come about in a heritary sense, when those specialised ants are unfertile, and can't reproduce themselves?

      So, how does it work? Say, the queen lays an egg, which has a mutation in it, which evolves into a more specialised ant which is beneficial for the whole hive. Very well. The hive survives better through it. But HOW does that ant give its benefical adaptation/specialisation to any offspring, when it can't reproduce?

      --
      --- "To pee or not to pee, that is the question." ---
    647. Re:In unrelated news... by OwnedByTwoCats · · Score: 1

      It's conceivable, though highly unlikely, that one day evolution will be disproven completely
      When Einstein's General Relativity 'overthrew' Newtonian mechanics, it had to do two thing: explain all the things that Newtonian mechanics got right, and also give a different answer to some question that could be answered with observables of the day. It did that in explaining the precession of Mercury and showing that gravity bent starlight.


      Was Newtonian mechanics 'disproved completely'? It works well enough to get the Cassini-Huygens space probe to fly by Venus, Earth, Earth and Jupiter, picking up enough momentum with each flyby to actually make it into orbit around Saturn.


      I have trouble conceiving of an observation, or a discrepency, that would "disprove completely" the fundamental pillars of evolution: descent with modification, and differential reproductive success. Sure, there will be i's dotted and t's crossed with details like the relative power of sexual and kin selection. Understanding the precise conditions that lead to mutations. but the basics are so blindingly obvious and unimpeachable that I can't honestly say there's a chance that they're all wrong.

    648. Re:In unrelated news... by sumdumass · · Score: 1

      Seeing how the story behind santa clause is joyous and humorous, what difference would it make?

      And yes, Certain element of the government already think Santa is real while some of the same elements try to become him.

    649. Re:In unrelated news... by sumdumass · · Score: 1

      Lol. No it is reason. Just because it doesn't go along with your experiment doesn't mean it is any less legit.

      The fact is that if a someone was looking at a job and this was a question, they would have made the decision before taking the job. That is unless they somehow get SAVED after they are hired but then that doesn't play into this thought experiment.

    650. Re:In unrelated news... by Anonymous Coward · · Score: 0

      I'd settle for an acceptance of science and a proper understanding of what the Bible really says, myself. Most people really think that the Bible says the Earth is only 10k years old? Yikes. It makes no such statement. What it says is:

      1) God created heaven and earth (Earth and the universe around it)
      2) The earth was devoid of life or even land mass. It was covered in water, and had a thick cloud layer keeping it in darkness despite its proximity to the sun. God says "Let light come to be" and fixed the heavy cloud layer issue. This also caused the first "day" and "night" periods upon the earth.
      3) "Let an expanse come to be between the waters", or in scientific terms, "yay, atmosphere!" Waters "beneath" and waters "above" are sea and clouds, respectively.
      4) Land mass created. Probably by tectonic upheaval, as it notes that the waters were "brought together into one place". Likely by land displacing it.
      5) Vegetation created.
      6) Clear away more clouds to make stars visible. Also, the moon and sun become distinctly visible.
      7) Aquatic life created.
      8) Avian life created.
      9) Land animals created.
      10) Humans created.

      Of these, the Bible specifies only the time period of the last one. There are about 4200 years of recorded history in the Bible, and it goes all the way back to the ones created, and ends about 1870 years ago. Thus the Bible only states that humans are 6000 years old. The earth and the rest of creation are of unspecified age.

      These bible-thumping twits need to get their facts straight before they start spouting off.

    651. Re:In unrelated news... by Ihlosi · · Score: 1
      These bible-thumping twits need to get their facts straight before they start spouting off.



      Well, for them, God's workday has exactly 24 hours, and the time reference frame is, of course, Earth time.



      Just as if God wouldn't have to zip around at 0.9999999c to check up on every corner of creation.



      Why haven't they started bashing the theory of relativity yet ? It would make it perfectly possible that, for God, only 6000-something years have passed since the beginning of everything. He'd just have to move really fast. But that should be a rather trivial feat, given the claims of friggin omnipotence. :P

    652. Re:In unrelated news... by rayk_sland · · Score: 1

      Ridiculous. This is a religious debate. To say that it's education is on one side or another is a mere ad hominem against the other side. Beliefs about the past are by nature religious beliefs. Interpretation of facts comes from worldview. you can't get away from that. If my worldview includes a Deity and yours doesn't can't we get along without you calling me stupid (uneducated)? Have you ever seriously tried to contact this Deity, No? well then you have nothing to say to those who have tried and believe they've succeeded. What you seem to want is that a single interpretation of the facts be shoved down everyone's throat.

      --
      Jedis are stupid. If they were so powerful, why couldn't they handle counseling for a kid who missed his mom?
    653. Re:In unrelated news... by Scrameustache · · Score: 1

      Frankly, even the rabidly fundamentalist anti-evolution junkies are aware that evolution is widely accepted in the scientific community. [...]
      I agree; this has to be ignorance, not religious zealotry. 'Is evolution well-supported by evidence and widely accepted within the scientific community?'

      They answer "NO!" at the first half of the question and never take the rest into account. "Flamebait refers to comments whose sole purpose is to insult and enrage. "
      Someone point out the bit that was baiting ? I can't see it...
      --

      You can't take the sky from me...

    654. Re:In unrelated news... by init100 · · Score: 1

      The bubble theory of evolution says that once a species was a species it alway is that species but it had developed over the years from the primordial soup that life started in. In this case, we would only be related to the monkey in that we shared the same pool of resources were life began.

      So what you are actually saying is that all species developed completely into their current form in that primordial soup?

    655. Re:In unrelated news... by init100 · · Score: 1

      Haha. I find it so funny when something is marked as a troll and it is nothing but the truth.

      And I find it so funny that almost all trolls post as anonymous cowards.

    656. Re:In unrelated news... by Chmcginn · · Score: 1

      So the church acknowledges that people come from sex ?

      The Church acknowledges the human body comes from sex, evolution, monkeys, tiny shrew-like things, some ugly lizards, frogs, fish, and eventually bacteria. The physical sciences are generally quite well accepted amongst the hierarchy of the Catholic Church.

      --
      Have you been touched by his noodly appendage?
    657. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Your constant use of the word theocracy when you should be using theology is rather telling.

    658. Re:In unrelated news... by @madeus · · Score: 1

      Nonsensical, pretentious, contradictory cods-wallop.

    659. Re:In unrelated news... by init100 · · Score: 1

      I don't think even the church has been this bad.

      I don't know any details of the church's real stance on heliocentrism vs geocentrism, but the church has been very bad indeed in other cases. Have you ever heard about the inquisition? This was a branch of the Roman Catholic Church that prosecuted and executed "heretics", just for speaking up against the church. One of their common methods of execution was burning the heretic live at the stake. This is not bad?

    660. Re:In unrelated news... by rainman_bc · · Score: 1

      Umm, you're a moron. Welcome it and move on?

      Normally I don't bite on flamebait, but am I a moron because my views differ from yours?

      Hello Pot, your black too.

      --
      09 F9 11 02 9D 74 E3 5B D8 41 56 C5 63 56 88 C0
    661. Re:In unrelated news... by pixelpusher220 · · Score: 1

      By your definition, all of Galileo's observations were proven *wrong* by the Hubble telescope?

      Producing more accurate results is not disproving, it's refining the initial theory. Newton's laws do still work.

      Let go of a bowling ball over your foot and let us know how *wrong* Newton was, k?


      --
      People in cars cause accidents....accidents in cars cause people :-D
    662. Re:In unrelated news... by Anonymous Coward · · Score: 0

      If I wanted to refute your claim or at least put a wedge in it that the creation-science scientists are crackpots I would say this: Science is not a democracy. Just because most scientists don't subscribe to creation science doesn't mean its true. Time will tell if they can convince other scientists that they are correct but you have to be careful when playing the numbers game. I don't disagree with you on any point, its just something that requires attention. We can't dismiss them as crackpots just because there aren't many of them. I wouldn't even say you are arguing that, but there is room for the creationists to put a wedge in there.

    663. Re:In unrelated news... by Ash+Vince · · Score: 1

      If you want to insult a great number of people, which you apparently do, go ahead and call Jesus a Muslim prophet.

      Its not a bigoted comment. I was pointing out that the muslim faith also recognise Jesus as a prophet. I have been involved in a great many discussions with muslims on this subject. Here is a quick link I found regarding the subject by a christian though so you may actually read it:

      http://debate.org.uk/topics/theo/jes-musl.htm

      I believe from memory that in Islam his name is pronounced slightly differently but there are enough similarities that it is undoubtably the same person.

      --
      I dont read /. to RTFA, I read /. to offend people in ignorance.
    664. Re:In unrelated news... by DavidApi · · Score: 1

      I'm no biologist but... doesn't stop us thinking...

      After some thought, I can only put hive-like devlopments down to something similar to the way multicellular bodies evolve. A mutation for an improved organ is also present in cells for other organs. This mutation must take care not to disrupt or lower the overall improvement to the individual's fitness to survive and breed. i.e. It almost kind of needs to have no detrimental affect on the other organs (or any other part of the whole).

      Of course, it's possible I guess, that it could have a detrimental affect on another part of the whole, as long as the overall affect of the mutation is beneficial to the individual. The case of malaria and sicklecell anaemia comes to mind there.

      Similarly, I also wonder (like you) about how evolution can explain the marvelous development of individuals from the initial conception through to adult form. And also those species that undergo metamorphosis. These are like your hive member variations, but spread over time. What combination of genes makes it good to be a screaming baby (and so getting attention for food etc), and then a demure, considerate and well liked adult (likely to get a mate and have kiddies)?

      I guess the answer will have to come down to the idea of genes surviving in a pool of other genes. And the separation of genotype vs phenotype. A set of genes that just happens to express themselves into a number of individual types (workers, soldiers, queen etc), and that creates a species well suited to surviving in their environment.

      There are probably very few genetic 'switches' that need to be pulled in order to flip a worker into a soldier. It's even possible these switches are by-products, mistakes, that just happen to make the species better at surviving (i.e. soldiers to defend the hive). Nature takes such mistakes in stride, as long as they conver benefit - and can be reached through, gradual, incremental steps (ref Climbing Mount Improbable - Richard Dawkins).

      I haven't read anything on this. Surely there's something out there already written. I'll have to search now (reaches for the Google-bottle). Thanks, you've given me a new book to look for.

    665. Re:In unrelated news... by Ash+Vince · · Score: 1

      But was Peter an Aramaic name? It sounds a little to english and modern to have been someones name 2000 years ago?

      And which legend are you referring to? If you mean that which is written in the bible it is hardly legend. It is a book that has been rewritten and translated from Latin at the very least, but probably Ancient Greek and something else as less people could actually write anything 200 years ago, let alone 2000.

      Can you read Latin? Can you read Aramaic? Does anyone have a copy of the Bible in any langauge other than the Latin translation or they even later English one?

      I did find this link regarding the language Jesus spoke if anyone is interested:

      http://www.markdroberts.com/htmfiles/resources/jes uslanguage.htm

      I am not opposed to Christ's message, I think he spoke a lot of sense which we would all do well to follow. I am opposed to the distortion of his message by organised religion in order to get people to obey. Something the Catholic church excelled at for over a thousand years.

      I think one of Christ's key messages was to question authority, this is why the authority of the time killed him via a particularly nasty means.

      --
      I dont read /. to RTFA, I read /. to offend people in ignorance.
    666. Re:In unrelated news... by JustinY2K · · Score: 1

      You are correct in saying that Muslims call him a prophet. I didn't say that they didn't. What I am saying is that for Christians, such assertions are inherently insulting. Christians see Jesus as a lot more than a prophet, whereas Muslims see Him as little more than a good man and prophet. Now, had you had merely pointed out that Muslims see Jesus as a prophet, and not referred to Him as merely a Muslim prophet, I don't think that I or anyone else would have had a problem. The difference: The Muslim prophet Jesus lived in the first century. Jesus, whom both Muslims and Christians regard as a prominent figure in their respective religions, lived in the first century. One is potentially insulting, whereas the other is informative. That was what I was getting at.

    667. Re:In unrelated news... by Jimithing+DMB · · Score: 1

      The idea that mere man could possibly unravel how God did anything can be very upsetting to these people and as long as you are entertaining them by allowing God into the conversation you've opened the door to their further interference.

      So in a failed attempt to quiet some idiots who take the bible not as the observed Truth about society but as if it were a literal account of how the earth was created you have quite nearly stooped to their level by declaring that evolution is not a best educated guess supported by evidence but instead an absolute unshakeable truth about how things were created.

      Many scientists are quite able to handle theology alongside science. In Christian theology one may say that it is the Holy Trinity which drives one to create. Devising theories about how the world was Created is in itself an act of human creation. The alternative to creating for a higher power or more generally for society is to create for selfish gain which generally makes for bad science.

      And that's why I say leave the theology out of the science classroom. Nature may have no subjects, but schools most certainly do.

      This is an unfortunate axiom of the currently practiced education system. It has not always been this way and I have strong doubts that it should remain this way. It clouds the students' minds by forcing them to break the natural connections among disciplines. How different really is the scientific method from a mathematical proof or well-thought rhetoric? How different is any of it from good theology (note: not religion) and philosphy? It is all ultimately a form of critical thinking.

      Christian theology does not demand its followers to be unthinking sheep. In fact, it demands quite the opposite. A good Christian should question the theology at every turn just as he should question every other statement made by any other person and even those he makes himself! One only actually need read the new testament, particularly something like Romans, to understand that it is not a set of absolute statements but rather the ramblings on of a man attempting to reconcile his beliefs with reality. He and others expected an all-powerful interfering God to send a great warrior to kill the Romans who were oppressing the Jews. What actually happened according to the accounts of the new testament is that God sent no such thing but rather sent a Son to be killed by the Romans because He recognized that the Jews were in effect oppressing themselves.

      That is, in a nutshell, the fundamental Christian belief. One must look inward and not expect God to fix ones problems. Perhaps if that were taught in school we would have less people looking for god replacements in people like politicians who profess to be the solvers of all the world's problems, or scientists who profess to speak the truth.

    668. Re:In unrelated news... by Ash+Vince · · Score: 1

      Its kind of hard to compare dates between the Bible and the Quoran as both dating systems have been messed with over the years.

      We know that Julius mucked with the calendar alot round about 45AD so dates before then are unreliable:

      http://www.bibletime.com/tool/spec/roman/index.htm l

      I dont know when such similar meddling took place in the muslim date system but I bet it did. The fact is that all data we have about that period is subject to serious interpretation and debate due to the number of years that have passed and the small volumes of written records that have survived intact.

      --
      I dont read /. to RTFA, I read /. to offend people in ignorance.
    669. Re:In unrelated news... by mobydobius · · Score: 1

      but those conditions dont exist. you cant discount relativistic effects and be any more than an approximation of what you would get had you included relativistic effects. GR is not the special case, which i think i understood you say. It is the general always-more-correct-than-newton case. which in my mind makes newton plain wrong.

      its got to be okay for scientists to say, "hey we weren't quite right, we're more right now than we were, and its highly likely we still are a little bit wrong; but this is the best model we have so far. see how well it predicts x and y; see how the old failed on x -- it was wrong". and right and wrong are fine, because in the end i think the creed for a scientist is: we are looking for truth, but we'll settle for getting out the best predictions we can". and when we get wrong predictions, and something else gives the right ones while still being consistent with older, correct predictions, then we should be unafraid to say "the old was wrong (because we value truth), the new is the most correct thing we know about, and at least makes all the right predictions now"

      so i have no problem saying newton was wrong. because his predictions didnt pan out. and we are after truth. i dont think that belittles him. i think its a testament to how close he was that it took so long to prove him wrong. but science is a big game of king of the hill, and when youre pushed off the hill thats it. and eventually most get proven wrong, but every time we get closer to truth.

      and if some ignorants use that to imply that their hair-brained alternatives have equal weight to all the current best working theories, so what? they arent even in the game; they are nowhere near the top of the hill. there will always be these sideliners trying to assert they are right without actually getting into the shoving match that is scientific peer review. why debate them or worry about them if they cant be bothered to get in the game.

      and i think that has to be the argument given to the politicals and others who arent scientists but make decisions that affect scientists and who listen to these sideliners: the game is this: try to get to the top of the hill. you get to the top by predicting things others cant say one way or the other, or by getting predictions right that others get wrong. the more you do it the higher you get, and if someone does it to you, you get shoved down. but if you dont play the game we cant have time for your out-of-the-blue ideas. because while we all want to find the truth, well settle for the best predictions we can get.

      --

      "I like to wear big boy pants."
    670. Re:In unrelated news... by amRadioHed · · Score: 1

      I'm having trouble following your point. Peter does sound modern and English, but that's only because it is still used in modern English. I doubt I pronounce my name the same as the Apostle Peter pronounced his since Peter is the English version of the name, but that's a bit aside from the point. Regardless of how we pronounce his name, the Apostle Peter, is still the Apostle Peter and he was still the first Pope.

      Also the legend I am referring to is the legend of Peter's death. Maybe you are confusing it with Christ's crucification, but if you look you will see that Peter's death was not recorded in the Bible. We have no hard proof how he died but, as I said, legend has it that he was crucified (upside down) by the Roman government.

      My original point was simply that if the early Popes served also as Roman Emperors that would have made Peter a Roman Emperor which would make his execution by the Romans pretty highly unlikely.

      BTW, I don't disagree with the point of your original post, just questioning some of the details.

      --
      We hope your rules and wisdom choke you / Now we are one in everlasting peace
    671. Re:In unrelated news... by Ash+Vince · · Score: 2

      I was referring to the fact that his name was probably pronounced Petra or something similar in Aramaic. (He may even have been a She)

      I was also suggesting that the entire Peter being first pope legend was written by the Catholic church sometime before the inventing of the printing press at the time of the reformation. Before this almost the only people who could write were scribes who had to rewrite a previous scribes work.

      Think of this as a huge game of chinese whispers that went on for 1500 years. The difference being that the only people who could actually pass a message on were the ruling class of the time (members of the Catholic Church). Anyone not in that club could not record and disseminate a message with the same ease and was also at risk of being burned at the stake for being a heretic if they did.

      I think that every word of the modern bible needs to be questioned due to the number of people who have rewritten it over the past 2000 years. Sorry if I was a bit too vague.

      --
      I dont read /. to RTFA, I read /. to offend people in ignorance.
    672. Re:In unrelated news... by sumdumass · · Score: 1
      This is starting to get fun and funny.

      first, You go about proving my point on the bacteria. So i think we are in agreement there.

      next, I didn't assume anyone was an idiot. At best, I questioned some one's credentials because of their name and suggested they had an agenda. Of course there is a troll I have been dealing with and I did assume he was an idiot, but he is and proves it on almost every post.

      Now to the meat.

      What, exactly, happens when individuals collect a small series of mutations over millenia? Please be specific, since you're claiming it's not macroevolution. My position is that lots and lots of little changes add up to big changes. Your position is....?

      That depends. The understanding of macro evolution and micro evolution is a change in species that isn't just another substrate of the previous species. In the sense of the term you are using it, a hole mas of micro evolutional changes over a larger period of time would be considered macro evolution. But this doesn't guarantee a different life form. It just shows a bunch of evolution changes over a longer period of time. Now according to the bubble theory of evolution, This is what happens but a human is always a human and a monkey is always a monkey. So it doesn't negate my point in how it is presented nor does it affirm that humans and monkeys shared a common ancestor outside the basic building block necessary for life..

      There is no such hunt. Human evolution is now quite well documented from Austrailopithicus to modern humans. At one time there were a few significant leaps in physiology, but discoveries in the last 20 years have filled in those leaps with examples of intermediate species.

      Actually, Discoveries have widened the gap. the Neanderthal man is considered human and a sub species of human in much the same way Asians and Indian and Caucasians are. And Lucy, the Austrailopithicus has some serious issues to her claim to fame. Like supposedly there were reports of a human skull being found at the same dig a few meter deeper then her. Also, It is my understanding that the pelvic joint was separated and then reconfigured in order to give the upright stances necessary to make the claim. Also, no hand or feet bones were found, But I hear that in mid to late 2006, they found another and it was a baby. Supposedly complete, but I haven't heard of any more about it.

      Now, I'm not saying that there isn't a record. I am saying the record is shaky in some spots and unsupported in some others. The actual gap between man and a predecessor or common ancestor with another species is verry wide. It will be more likely that any marked human will be just that, human and not some other primate in between.

      False. Or maybe not. You have to define speciation in asexual bacteria. I personally have done a lot of gene splicing that lead to what I'd consider new species. For example, I've made bacteria that produce several human proteins. They have 30% more DNA than their originating species, so I'm pretty confident at calling it a new species under any sane measurement.

      Ok, First, I'm not skewled enough in Microbes to explain the exact difference in RNA or DNA sequences to give you a separate entity. But that doesn't mean it is happening. I have been repeating what other scientist have been saying as fact. I didn't just make this up. And when you say your splicing them, then I think we are off the subject of evolution and going into manipulation. The difference is that one would be natural and the other is artificial. You could splice genes form one species to another. You could create a new species because of that. would it have happened without you specifically doing something to cause it? No. Could nature cause this splice without your intervention? Most likely not or you would already have specimens instead of having to manipulate them yourself.

      When has bacteria, Lets say E.coli mutated enough th

    673. Re:In unrelated news... by sumdumass · · Score: 1

      I believe the inquisition revolved around practicing other religions. Galileo wasn't executed for claiming the earth revolved around the sun, But he was given a hard time.

      The idea of all or nothing in science is very similar to the idea of no other religion or going against the religion. So maybe you are correct.

    674. Re:In unrelated news... by amRadioHed · · Score: 1

      Ahh, thanks for the clarification. What you wrote makes much more sense now!

      --
      We hope your rules and wisdom choke you / Now we are one in everlasting peace
    675. Re:In unrelated news... by xerxesVII · · Score: 1

      So in a failed attempt to quiet some idiots who take the bible not as the observed Truth about society but as if it were a literal account of how the earth was created you have quite nearly stooped to their level by declaring that evolution is not a best educated guess supported by evidence but instead an absolute unshakeable truth about how things were created.

      Nowhere in my post did I say anything about the unshakeable truth of evolution. I did not even hint at it. My concern here is teaching the scientific method to kids. These kids are (and I'll grant wholly that this is my opinion) served best by a system that says, "Anything we're going to present as fact has been labelled as such due to much observation and measurement and such. However, it is all up for reconsideration and you are welcome to challenge it if you find contradictory evidence. This is the method by which these conclusions have been reached and here's how you can apply them yourself." If there is ever an all-powerful magic man to fall back on in this process, there is only so much reason to keep up with the questioning.

      Many scientists are quite able to handle theology alongside science.

      Good for them. I'm quite able to handle playing piano while digesting dinner.

      This is an unfortunate axiom of the currently practiced education system. It has not always been this way and I have strong doubts that it should remain this way. It clouds the students' minds by forcing them to break the natural connections among disciplines. How different really is the scientific method from a mathematical proof or well-thought rhetoric? How different is any of it from good theology (note: not religion) and philosphy? It is all ultimately a form of critical thinking.

      It is ultimately a form of critical thinking. However, I think you and I are simply going to disagree. I simply fail to grasp why Mendel and Moses need to brought up in the same discussion. And let me still you now: I know that Mendel was a priest.

      Christian theology does not demand its followers to be unthinking sheep. In fact, ...(editing for brevity)... solvers of all the world's problems, or scientists who profess to speak the truth.

      Ask ten different Christians what Christianity means to them and what it demands of them and you will get a hundred different answers. Some will say love thy neighbor and accept Jesus as your savior, some will go on about the importance of proselytizing, one might even say that it means he needs to bomb an abortion clinic. I'm not here to discuss what your religion means to you. Jesus seems to be working okay for you. That's great. All I'm saying is that stories about floods and fishes and loaves and rising from the dead do not really have any place in a discussion about how sugar crystals are formed or how to make an electromagnet.

      So really, theology in theology class, science in science. Besides, most schools don't have enough money for the equipment to observe how many angels fit on the head of a pin.

      --
      "We shall grapple with the ineffable, and see if we may not eff it after all." - Douglas Adams
    676. Re:In unrelated news... by kbahey · · Score: 1

      DNA will have 100 other copies of memmove() in other places, all different, all incompatible, and most with bugs. Except that you can't call them bugs, because there is no spec. You expect them to do "wrong" things every now and then, indeed often.


      Hmmm, let us see.

      • Many copies of the same function.
      • All different.
      • All incompatible.
      • Most have bugs.
      • No specs.
      • Go wrong every now and then.


      Sounds like the majority of legacy software systems out there in large corporations ...
    677. Re:In unrelated news... by JustinY2K · · Score: 1

      I haven't heard this before, and I doubt that it holds a lot of water. Most Biblical scholars agree that Jesus was born around 3 AD. To try to put a month and date to His birth is ridiculous I think, and I question the authority of anyone who tries. I'm willing to accept that we can know what season He was born in, but little more.

      I've studied the events surrounding the Bible in the first century, and I've never come across anything like this. I think that the writer of that website means well, but is frankly wrong. Even if the dates before 45AD are unreliable (which I don't think they are), it's not like they're going to be off by more than a few years.

    678. Re:In unrelated news... by plunge · · Score: 1

      I hate to have to keep pointing this out, but it's just not true that creationists came up with those terms. They are terms that biologists use and have used. It's just that they don't have the significance and meaning that creationists place on them, because there is no biological barrier between one and the other. There is, however a real and important distinction between microevolutionary events and macroevolutionary events, like extinctions.

    679. Re:In unrelated news... by Casshan-Robot+Hunter · · Score: 1

      No, because your conclusion had no merit.

      --
      Why oh why didn't I take the purple pill?
    680. Re:In unrelated news... by plunge · · Score: 1

      Your dates are way way earlier than the scholarly consensus. Most scholars put Mark at the earliest, sometime around the 70s.

      "The Roman councils on the subject just left everything as it had already been for some time. "

      False.

      "The manuscripts that we have from the time match those that we have today, with minor variations for different spellings of the same name, that kind of thing."

      Also false.

      Again, if you want the facts, read the actual scholarly academic work done on the Bible. Don't listen to apologists with axes to grind.

    681. Re:In unrelated news... by plunge · · Score: 1

      "That is why we are still on the hunt ofr the missing link."

      No we aren't.

      You clearly don't know what you are talking about. It's become very helpful, however, because people who have been taken in by creationist nonsense always tend to spout the same canards, like this one. They are like a big red flag that says 'this person has never actually bothered to understand the theory he wants to criticize."

      "Humans have different DNA and are still humans."

      What do you think speciation is anyway? All speciation is, ultimately, is different ENOUGH DNA so that some point in the reproductive process is no longer compatible. There is no magic line. It's no different for bacteria or sexual beings: all speciation is is genetic difference big enough to cross some arbitrary line we use to classify it.

    682. Re:In unrelated news... by JustinY2K · · Score: 1

      According to John McArthur, the gospel of Mark was probably written in the 50's, and almost certainly before 63. I was mistaken in saying that it was written in the 40's. My bad.

      I'd appreciate evidence on your other two points. Just declaring something false doesn't make it false.

    683. Re:In unrelated news... by plunge · · Score: 1

      "This is what happens but a human is always a human and a monkey is always a monkey. "

      Do you even know what a clade is? Do you have any idea how common descent is structured in the first place?

      "Supposedly complete, but I haven't heard of any more about it."

      And you are thus the sort of informed expert that we are supposed to believe when they conclude things about the hominid fossil record???

      "The actual gap between man and a predecessor or common ancestor with another species is very wide."

      There are gaps in actual the fossil record in the sense that we do not have a fossil of every homonid that ever lived. but this has nothing to do with whether or not we know that we shared a common ancestor with other apes.

      We are apes. In every respect that an ape is different from all other primates, we are ape. Distinctively. Unequivocally. This isn't just a game of definitions either: it's a morphological reality that would be near impossible to explain via anything other than common descent even if we DIDN'T have a fossil record that clearly documents the relevant transitions or genetic records that just so happen to match up with that.

    684. Re:In unrelated news... by Jimithing+DMB · · Score: 1

      So really, theology in theology class, science in science. Besides, most schools don't have enough money for the equipment to observe how many angels fit on the head of a pin.

      How many angels fit on the head of a pin is not intended to be an exercise in measurement but rather an exercise in abstract thinking. Taking angels out of the equation I could phrase it as how many geometric points fit on the head of a pin? Recall that a geometric point is a nonexistant abstraction. That it is represented by a dot on a piece of paper does not change the fact that a point is defined to take no space. This is the point of the angels-on-the-head-of-a pin brain-teaser.

      On the other hand, you sound as if perhaps you already know that and were just being sarcastic. Aside from the absurdity of angels on the head of a pin there was one important point in your recent post I'd like to concur with.

      "Anything we're going to present as fact has been labelled as such due to much observation and measurement and such. However, it is all up for reconsideration and you are welcome to challenge it if you find contradictory evidence. This is the method by which these conclusions have been reached and here's how you can apply them yourself."

      Spot on. I misattributed the uncritical thinking of others (the third person) to you (the second person). What I oppose in the classroom and the university is the idea that facts are unchangeable dogma. There was a time when the elements were defined as Earth, Wind, Fire, and Water. Yet we now know there to be hundreds of them that make up more complex compounds like water. Then there was a time when we believed that these new elements were unbreakable, hence the term "element." Yet we now know that they can be broken apart and put back together, sometimes to devastating effect.

      Be it Mendel's plants or Darwin's finches the idea that a species has within it variations is not a particularly new one. The entire practice of husbandry exists because of it. And in fact few people, even those who do see religion as opposing science, will dispute this part of evolution. What is oft disputed is the idea that out of these variations an entirely new species will be formed. Saying that "god did it" is of course ignoring the scientific method.

      I do, however, question how scientific Darwin's methods really were. When it comes right down to it, what would be an experiment that could be performed to verify the truth of Darwin's claims? The current method seems to be examination of the fossil record but that is not really an experiment so much as a simple gathering of data points.

      Take, for example, something like Newton's laws. They are supported not through evidence but through actual experimentation. Granted, they fail to accurately predict behavior at insanely large or small scales but for most purposes, they work well. One can even do his own experiments to verify the validaty of Newton's laws. This, to me, defines the scientific method. Is it really a scientific method when one (Darwin) writes a broad theory that cannot actually be tested for validity? Or is it more of a philosophical exercise?

      It seems clear to me that the real reason Darwin's theory is trumpeted is that it is the only theory in existence that attempts to explain a mechanism for the origin of species. No competing scientific theories exist and so there is an imagined competition between the scientific theory of evolution and the biblical statement that God made the earth. For the most part, religious people do not see scientific principle in conflict with religion. And I hope that for the most part scientists don't see religion in conflict with science. Unfortunately, an article such as this one makes a blatant attempt to pit religion against science. And to what end? The cynic in me believes that those who eschew religion tend to seek it in other places. To them, Darwin is compelling because they believe it allows

    685. Re:In unrelated news... by sumdumass · · Score: 1

      We are apes. In every respect that an ape is different from all other primates, we are ape. Distinctively. Unequivocally. This isn't just a game of definitions either: it's a morphological reality that would be near impossible to explain via anything other than common descent even if we DIDN'T have a fossil record that clearly documents the relevant transitions or genetic records that just so happen to match up with that.
      Show me the money. Were is this fossil record? It isn't available for public display and as far as I can tell, there isn't a complete rendition of it on the internet.

      And it isn't a reality. Some of the fossils being describes as a different species turned out to be the same species. The problem is that humans are humans and if you subclass them, they are still humans. This doesn't appear to be what your saying and it doesn't appear to be what others are saying with bacteria and all. Also, using means other then natural means don't necessarily count as evolution but more like manipluaton.

      But, I'll consider that along with all the other evidence available to me, the other people making the claims that I'm just repeating(so much for a consensus), that I'm wrong and you are right, show me your side of the story. Point us to this record that is unchallenged and straight up and all. Last i saw of the record, It was falling apart with reclassifications of species and all. So I'm willing to look at this hidden evidence that is so clear it cannot be easily found by internet lookups or the science books used in schools.
    686. Re:In unrelated news... by skeftomai · · Score: 1

      Ok. They did not explicitly say "premodern" though, and I've had a lot of people say "I didn't come from no ape" and "If humans came from monkeys then why are there still monkeys today?" Malarky.

    687. Re:In unrelated news... by init100 · · Score: 1

      I believe the inquisition revolved around practicing other religions. Galileo wasn't executed for claiming the earth revolved around the sun, But he was given a hard time.

      No, but Giordano Bruno was executed for claiming that there might be other worlds than ours habiting intelligent species in the universe. This was too much for the church, which could not accept such a claim, and he was burned at the stake alive for it.

    688. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Sorry for posting as an AC, but unfortunately I usually do not post, and thus do not have an account.

      I believe your point is exactly what the parent is stating. A person of below average intelligence will not be capable of escaping this social conditioning.

    689. Re:In unrelated news... by Cybrex · · Score: 1

      The mapping from sociology to evolution is obviously a poor one, but it serves to illustrate a point: Academic study may self-select people who agree with ideas in that field, because people who do not agree with these ideas are unlikely to enter the field.

      Very interesting point and, ironically, spoken like a sociologist. ;-)

      --
      Boundless Expansion, Self-Transformation, Dynamic Optimism, Intelligent Technology, Spontaneous Order- BEST DO IT SO!
    690. Re:In unrelated news... by darkwhite · · Score: 1

      Surely the spontaneous origin of very simple life is more likely than the spontaneous creation of an all-powerful, all-knowing being who then created life, though. I never said it wasn't.
      --

      [an error occurred while processing this directive]
    691. Re:In unrelated news... by sumdumass · · Score: 1

      Interesting, I haven't specifically heard of him before.

      So maybe I should rephrase my statement to allow for a modern day equivalent. Anyways, It is getting bad.

    692. Re:In unrelated news... by diablomonic · · Score: 1

      you are correct

      --
      watch "the money masters" on google video
    693. Re:In unrelated news... by plunge · · Score: 1

      You mean John MacArthur? If we are thinking of the same guy, he isn't an academic Biblical scholar, and his claims are STILL on the very very early edge of what the scholarly consensus is.

      Like I said, just about any scholarly textbook can tell you about these things. You don't have to take my word for it.

    694. Re:In unrelated news... by plunge · · Score: 1

      "Show me the money. Were is this fossil record? It isn't available for public display and as far as I can tell, there isn't a complete rendition of it on the internet."

      Of course there is. The talk-origins section gives a perfectly reasonable assessment of things. Your problem seems to be that you want to see every single species that ever lived as a fossil. But none of that is necessary. As I said, even the fossil record itself really isn't necessary: it's just icing on the cake showing that what every other physical fact in the world already suggested would be the case: that there would be this transition.

      And you didn't answer my question as to whether you know what a clade is. It's a really really important concept if you are going to understand how the fossil record is used as evidence and why.

      "And it isn't a reality. Some of the fossils being describes as a different species turned out to be the same species."

      That's exactly the sort of problem you'd expect if common descent via evolution were true. In fact, it's a point of amusement with creationists, because while they all claim that this or that fossil is either "man" or "ape" (which belies ignorance to begin with, because man IS an ape), different creationists can't seem to agree with each other on which is which.

      None of this invalidates the very real and very obvious fossil record of hominid transition.

      "The problem is that humans are humans and if you subclass them, they are still humans. This doesn't appear to be what your saying and it doesn't appear to be what others are saying with bacteria and all. Also, using means other then natural means don't necessarily count as evolution but more like manipluaton."

      I don't know what you are talking about. Humans are a subclass of apes. Every feature that distinguishes apes from other primates is found in humans as well. We have the same distinctively ape pattern of bodily hair coverage (down to the follicle), we have molars that are unique in the animal kingdom... (unique to apes, that is) and virtually every other marker there is for "ape." In fact, we are so morphologically similar that creationist taxonomists wanted to group us together long before Darwin and the idea of evolution looked like a threat to creationist beliefs. About the only major morphological difference we have from apes that isn't just a size or balancing shift is the indent in the top of your mouth: the one in between all those ape teeth you have.

    695. Re:In unrelated news... by JustinY2K · · Score: 1

      Yes, John MacArthur. I realized that I had left out the 'a' a while after I posted.

      Well, I'm giving information from a Biblical scholar that I personally heard lecture a few months ago. I checked my notes from it to make sure that what I said before was accurate as far as the names of the two books the early church circulated, and when they were complete. What scholars are you referring to?

    696. Re:In unrelated news... by Bastard+of+Subhumani · · Score: 1

      Yes, but 99% of everything is bunk.

      --
      Only three things are certain; death, taxes, and apocryphal quotations - Ben Franklin.
    697. Re:In unrelated news... by sumdumass · · Score: 1
      First, Talk origins has some creditability issues. I have read things there that counter themselves in an effort to discredit some religious nut. Of course, I'm not lumping myself into either category but you could make the same assumption about me too.

      Of course there is. The talk-origins section gives a perfectly reasonable assessment of things. Your problem seems to be that you want to see every single species that ever lived as a fossil. But none of that is necessary. As I said, even the fossil record itself really isn't necessary: it's just icing on the cake showing that what every other physical fact in the world already suggested would be the case: that there would be this transition.

      Finally, we have made a full circle back to my original point. And you are making it for me right here. Without the fossil record of everything in the chain, we are just making guesses to what we think is happening. There is no proof outside the evidence pushing one way or another and the evidence can go the other way.

      According to the bubble theory of evolution, the fossil 2 million years ago is very much the same species as the fossil today the only difference is that it has evolved a different a looking creature with different capabilities but it has never branched and gave us pigs on one hand with dolphins on another. Once a pig, always a pig even though they looked different. To make the claim that some magical event happend that took a pig and turned them into an alligator or human takes as much faith in what is being told to you as something the church says. Now here is were it is important to the discussion.

      I made the statement that not believing in evolution has no relevance to the majority of functions in science. A reply stated that if you discard one thing in science, you will be likely to discard another in say physics. SO i replied that this isn't anything close to the truth because nothing else in the religion claims to govern any other process of thought and it isn't like evolution over creation is fact outside making guesses about what we have found. In commences the the bacteria and plasmid discusion with statements getting twisted and all. Now we are back to square one with evolution and speciation being defended in that you don't need to have a complete record to see it is _likely_ to have happened.

      And you didn't answer my question as to whether you know what a clade is. It's a really really important concept if you are going to understand how the fossil record is used as evidence and why.

      I don't need to know what a clade is to support this argument. But a clade is a group of organism thought to be the basis of other life based form that stem of life. It is still a hypothesis and not proof. The only thing linking the clade could be the elements making the primordial pool up when conditions for life were present. This is another part of the bubble theory of evolution too. It states the difference is in the concentrations of elements when conditions for life began. Different impurities create different organism that grew to be different species of animals. On the offset, the organism making up the clade could be different by a degree that isn't apparent in this stage. but a horse would have been very much a horse and a cow the same.

      This is however getting off track because I am not arguing that the species cannot adapt and change over time and develop into something that doesn't resemble what it was at one time, I arguing that some ancient horse didn't become a pig on one side of the family and a dog on the other.

      I don't know what you are talking about. Humans are a subclass of apes. Every feature that distinguishes apes from other primates is found in humans as well. We have the same distinctively ape pattern of bodily hair coverage (down to the follicle), we have molars that are unique in the animal kingdom... (unique to apes, that is) and virtually every other marker there

    698. Re:In unrelated news... by plunge · · Score: 1

      Raymond E. Brown's An Introduction to the New Testament is still considered to be pretty standard. Mark is generally dated anywhere from 68-72. It's true that many believers would like the dates to be earlier, and some even claim to be or are Bible scholars, but I'm simply pointing out that this is not the actual scholarly consensus.

    699. Re:In unrelated news... by JustinY2K · · Score: 1

      Ok, regardless of the dates for Mark, which we can't come to agreement on since the scholars can't either, this still doesn't say why you disagree about the makeup of the Bible having not really changed from the early 100's.

    700. Re:In unrelated news... by Anonymous Coward · · Score: 0

      It's very clear to all of us who have actually obtained an education in biology that you're just recounting some religious diatribe about why evolution is somehow flawed in some way. It's not; there are no "missing links", that expression was invented by knowledge terrorists (aka religious zealots).

      Denial of evolution is strongly linked to testable IQ; people who deny evolution are statistically less intelligent than those who don't. Go figure.

    701. Re:In unrelated news... by plunge · · Score: 1

      "Without the fossil record of everything in the chain, we are just making guesses to what we think is happening."

      The record is pretty darn clear and unambiguous. Demanding that every single creature that ever lived be turned into a fossil simply isn't reasonable. Fossilization doesn't work that way. Think of the fossils we have as random samples of what sorts of creatures were alive and when. All of these samples speak unambiguously with what we expect from evolution via common descent. There really isn't any plausible alternative. And remember, this fossil evidence doesn't stand on it's own: it's merely one piece in a convergence of all sorts of evidence, all confirming the same basic picture.

      "There is no proof outside the evidence pushing one way or another and the evidence can go the other way."

      But the evidence can't go any other way. This has been checked in virtually every way its possible to check.

      "According to the bubble theory of evolution"

      You keep bringing this up as if anyone cared what the "bubble" theory of evolution was. Whatever it is, it makes no sense and is grossly inconsistent with the fossil record, the genetic record, and virtually everything we know about past life on earth. It also seems ignorant of how evolution works, which is via nested clades. This is why I asked you if you knew what clades were. If you don't know, I can see why it might seem confusing to think of a pig turning into a crocodile. But evolution never suggests that such a thing happens. In fact, if such a thing happened, it would disprove a lot of key elements of evolution.

      "I don't need to know what a clade is to support this argument."

      Of course you do. If you didn't, then you'd say silly things like "pigs turn into people."

      "But a clade is a group of organism thought to be the basis of other life based form that stem of life. It is still a hypothesis and not proof."

      No, a clade is a _definition_, and the original definition of a clade is simply a group of creatures whose members share certain homologous features. The that all life, modern and fossil, falls quite well into nested clades (that is, clades within clades) is a FACT, and one that was recognized long before modern evolutionary theory. It is evolutionary theory that explains this state of affairs in the only way anyone seems able to: that these groupings are ancestrally derived. And remember, this is something one is forced to recognize before we even get into genetics and fossils.

      "I arguing that some ancient horse didn't become a pig on one side of the family and a dog on the other."

      Again, if you don't know what you are talking about, then why pretend to. Show me where any biologist claims that horses are a common ancestor of dogs and pigs. Again, anyone that understood what nested clades were and that common descent is descent with modification would know this right off the bat, instead of having to have it pointed out.

      "Lol.. The term Ape is just a classification"

      It is an classification based on real morphology, and as such, is unavoidable. It comes straight out of ANY attempt to group life based on similarities and differences. You can forget human beings for a second: once you look at all primates, you see that there is a group, apes, that share certain features that are distinctive and clearly set them apart as their own group within primates. When you note what these key features are, it turns out that human beings have them all. Human beings are apes: not by definitional trickery, but by unavoidable taxonomy.

      That these relationships are ancestrally derived is quite clear. All the fossil, genetic, morphologic, and other evidence confirms it.

      "If we all came form the same pond/ocean of sludge but more ammonia or gold(whatever) was concentrated towards the middle of the pool, it would have produce a different life that is very similar and possibly create the appearance of these connections and allowing for different breed in the same family."

      I don't have the slightest idea what you are talking about.

    702. Re:In unrelated news... by d_i_r_t_y · · Score: 1

      The fact you even bring up the fossil record shows how deeply ignorant and skewed your understanding of evolution really is. Discussing the fossil record in the context of refuting or supporting evolution might have been relevant prior to the 1980s when DNA evidence blew away everything else.

      Humans and chimpanzees share around 97% DNA sequence homology. 97% of the approximately 2.85 billion nucleotides that comprise the sum total of our DNA. DNA sequencing is so good we can predict with a high degree of accuracy what country & town your great-great grandfather came from by sampling your DNA. This is on top of the extant fossil record and developmental morphological evidence that has been around for 50+ years.

      You also make out that the fossil record is somehow incomplete - it's not. it hasn't been for decades. as for asking for links to evidence for evolution - man that is so profoundly ignorant I'm start to believe you're an evolutionary biologist out trolling cause seriously, it's hard to believe anyone could be this stupid. How about just reading the wikipedia entry? Even if you only read 1 level of links deep from that page, you'll be significantly better off; not that I think you have any real interest in getting to the facts; i know a religious agenda when i smell one.

      Choosing not to *believe* in evolution cause you *choose* to believe in fairies, or aliens, or a storybook written by a bunch of jewish & roman guys a couple of thousand years ago I have no problem with. I'll respect your belief, however ridiculous i may find it. Just keep the hell away from discussing things that thousands of really smart, hard-working people have literally spent their working lives researching until you've obtained the level of academic knowledge required to discuss it intelligently and factually. Neither of which you have achieved so far.

    703. Re:In unrelated news... by sumdumass · · Score: 1
      Lol.. we are starting to fall into the I believe so, so it must be true trap. It is the same thing as the religious nut cases do. I know it is a little more complicated then I said the sun would come up tomorrow so i made the sun come up. But it is along the same lines.

      The record is pretty darn clear and unambiguous. Demanding that every single creature that ever lived be turned into a fossil simply isn't reasonable. Fossilization doesn't work that way. Think of the fossils we have as random samples of what sorts of creatures were alive and when. All of these samples speak unambiguously with what we expect from evolution via common descent. There really isn't any plausible alternative. And remember, this fossil evidence doesn't stand on it's own: it's merely one piece in a convergence of all sorts of evidence, all confirming the same basic picture.

      The record is just that the record. All the assumption pulled from the record isn't as you say unambiguous. It is just a bunch of theories put together. That is why it is called the theory of evolution not the evolution fact! And as i said, There has never been the missing link that pulls two species together. If there is, show me the money. Show me this record that has the intermediate between ape and man. So far, all we have found is one or the other.

      You keep bringing this up as if anyone cared what the "bubble" theory of evolution was. Whatever it is, it makes no sense and is grossly inconsistent with the fossil record, the genetic record, and virtually everything we know about past life on earth. It also seems ignorant of how evolution works, which is via nested clades. This is why I asked you if you knew what clades were. If you don't know, I can see why it might seem confusing to think of a pig turning into a crocodile. But evolution never suggests that such a thing happens. In fact, if such a thing happened, it would disprove a lot of key elements of evolution.

      LOL.. It proves all of those to a better degree that evolution does. Beside, it doesn't need the missing link between any two subspecies.

      But the fact that you appear to not have any clue about it ("Whatever it is") but then dismiss it ("it makes no sense and is grossly inconsistent with the fossil record, the genetic record, and virtually everything we know about past life on earth" ) makes me wonder if we are talking about the religion of evolution or the science of evolution. How do you know if it is inconsistent if you don't know what it is? It does play into what we do know and can prove very nicely. What it doesn't do is play favors to the fairytales we make about what we think could of happened. And it has been around since almost the beginning of evolution as a theory of origin. It saddens me that you are convinced of evolution and have no knowledge of this.

      No, a clade is a _definition_, and the original definition of a clade is simply a group of creatures whose members share certain homologous features. The that all life, modern and fossil, falls quite well into nested clades (that is, clades within clades) is a FACT, and one that was recognized long before modern evolutionary theory. It is evolutionary theory that explains this state of affairs in the only way anyone seems able to: that these groupings are ancestrally derived. And remember, this is something one is forced to recognize before we even get into genetics and fossils

      Hmm.. Well, according to wikki, It is how I described it. But we know how accurate wikki can (not) be at times. So I looked other places, It shares your definition. But the flaw is in assuming a common ancestor. I'm saying this isn't possible and no one has proven it is. At most, It is just organism coming from the same area of creation. And Even then, it doesn't lose it's definition, it just refines it. So it really doesn't matter much to our discussion when the discussion is what i

    704. Re:In unrelated news... by Eternauta3k · · Score: 1

      Oh, that's rich coming from someone arguing against the evidence. Hope you enjoy your superstitions, you're welcome to them.
      I'm not arguing against the evidence (I believe in evolution), I'm arguing against you saying evolution is the truth. I see evolution as a very elegant and reasonable theory (and the one which evidence points to), but I'm open to new stuff.
      --
      Yeah. Would you choose a neurosurgeon who pokes around people's brains in his spare time? I wouldn't.
    705. Re:In unrelated news... by Kaki+Nix+Sain · · Score: 1
      --

      (C) Kaki Sain, 2011. By reading this, you have illegally copied my property to your brain.

    706. Re:In unrelated news... by Kaki+Nix+Sain · · Score: 1

      Here is something for you to try. Dig up lots of things and send pieces to different labs to be tested. If you can show that any of them systematically inflate the ages, you can put them out of business. One less godless lab to worry about! Get to work.

      --

      (C) Kaki Sain, 2011. By reading this, you have illegally copied my property to your brain.

    707. Re:In unrelated news... by Manchot · · Score: 1

      I realize I didn't say this in my post (and that is my fault), but I was mostly referring to the New Testament. It wasn't so much what they wrote directly as much as it was what they decided would be included in the Bible. The New Testament could've been completely different if some books had been included, or if others were excluded (e.g., the Gospel of Thomas).

    708. Re:In unrelated news... by Grail · · Score: 1

      The 50% split occurs at the median, not the mean. In a "normal distribution", the median and the mean might be close together. The IQ of the population might be more like a gamma distribution: the median is below the mean, with a long, shallow tail of people off into the "genius" axis. Whatever the distribution looks like, the correct statement is that "half the population is below median X" where X is the score of interest.

      I don't believe that intelligence or education have as much impact upon belief systems as schooling (indoctrination, rote learning, opinions statements from authority figures).

    709. Re:In unrelated news... by Alsee · · Score: 1

      Academic study may self-select people who agree with ideas in that field, because people who do not agree with these ideas are unlikely to enter the field.

      To some extent, sure. But across the entire multi-fields of life and earth sciences... not just the specific specialty of evolution but the entire multi-fields of life and earth sciences... the fundamental acceptance and agreement on evolution being overwhelmingly supported by the evidence and being true... is approximately 99.85%. (Newsweek magazine 29 June 1987 Page 23 puts the figure at approximately 700 out of 480,000 U.S. life and earth scientists who subscribe to the general theory that complex life forms did not evolve.)

      As this very Slash-story indicates, the majority of Americans, the majority of incoming students, they come in with with the belief that there is little or no evidence to support evolution. They come in with the belief that there is no scientific agreement on the subject, the majority of them come in to the subject with substantial doubts or even absolute certainty in their rejection of evolution. And many of the students with doubts, students with certainty in their rejection of evolution, many of them are very bright very capable students. Very dedicated and very intelligent people. And yes, *some* of them my be turned off to all areas of life and earth science because of evolution... some of them may even turn away from science in general... which is very very unfortunate. A loss to us all. However many of them are not run off so easily. In fact a fair number of them will specifically stick with their science degree exactly because they consider truth in science so important and exactly because they want to tear down this huge "wall of evolution" that scientists keep "shoving down everyone's throats". They want to do the good science picking away at all of the flaws and problems in evolution.

      And after studying the subject for a few years in college to get their degree anywhere in the life or earth sciences... after studying the subject and looking themselves at all of the evidence... all of the cross supporting and cross confirmed evidence from across dozens of scientific disciplines... after reviewing and all of the criticisms of evolution... after doing the research and checking the facts and evidence and checking the reasons and arguments and developing their own expertise in the field... 99.85% or so of all students anywhere in the life and earth science field... 99.85% of all of them... including the ones who specifically entered the field with the very goal of tearing down this evolution nonsense... 99.85% of them come out convinced that NONE of the criticisms of evolution and NONE of the "flaws" in evolution actually hold up... 99.85% of them come out convinced that the evidence really is overwhelming and irrefutable... 99.85% of them come out convinced that evolution really can and does work, that it really did happen and that it really is and was the mechanism producing the complexity and diversity of life on earth.

      And of that 99.85%... well this being America... pretty obviously almost all of those students are Christians. Many of them deeply religious and deeply devout Christians. Some of them come in with deep and very powerful concerns over a conflict between evolution and their faith. And *still* 99.85% of them... including many many thousands of deeply religious and deeply devout Christians achieve a degree somewhere in the earth of life sciences and come out convinced about evolution. It would be insane to suggest that deeply religious and deeply devout Christians could not or would no be able to get a science degree. It would be insane to suggest that deeply religious and deeply devout Christians who get any such degree all come out as atheists. No, deeply religious and deeply devout Christians who spend time in school studying the subject decide that truth does not conflict with truth. The laws of optics explain the mechanism for producing rainbows. Nuclear fusion explains

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    710. Re:In unrelated news... by jeff4747 · · Score: 1

      This is starting to get fun and funny.

      That's just 'cause you don't realize how foolish you're looking

      first, You go about proving my point on the bacteria. So i think we are in agreement there.

      Not even close. At this point I must question your literacy. My position is that we have seen speciation and done it ourselves. Your position is that this is false. Your dictionary must have a very strange definition for "agreement".

      next, I didn't assume anyone was an idiot.

      The vast majority of people will think a statement like, "Do you get it now? or it is still too complicated?" means you are calling someone an idiot.

      But this doesn't guarantee a different life form.

      What, specifically, could it possibly produce that is not a different life form? By definition, millenia of changes are going to produce enormous changes to the organism. So large that it's going to be a different organism.

      So it doesn't negate my point in how it is presented nor does it affirm that humans and monkeys shared a common ancestor outside the basic building block necessary for life.

      So humans and monkeys shared a common ancestor to get "the basic building block necessary for life"? How is it then that we are not monkeys? If we have a common ancestor, then a human can not have always been a human, as you claim. Some mechanism had to change both us and monkeys from our common ancestor to our current state.

      the Neanderthal man is considered human

      Wrong. Neanderthals are hominids, but they are not human. Humans are Homo sapiens, and Neanderthals are Homo neanderthalensis. We did not evolve from Neanderthals, they were an offshoot from a common ancestor to humans and Neanderthals.

      And Lucy, the Austrailopithicus has some serious issues to her claim to fame. Like supposedly there were reports of a human skull being found at the same dig a few meter deeper then her

      Link?

      Also, It is my understanding that the pelvic joint was separated and then reconfigured in order to give the upright stances necessary to make the claim

      Lucy was not a direct ancestor to humans. This should be abundantly clear because her genus is Austrailopithicus and not Homo. The members of the genus Homo evolved from Austrailopithicus, and their morphology changed over time, leading to Homo sapiens, aka us. In fact there are 11 other species in the genus Homo, which have been filled in by discoveries besides Lucy. http://en.wikipedia.org/wiki/Homo_(genus)

      Pointing out differences between Lucy and humans is as relevant as pointing out differences between yeast and humans.

      I am saying the record is shaky in some spots and unsupported in some others.

      No, I'm afraid it's your knowledge in this area that is shaky, not the fossil record.

      Ok, First, I'm not skewled enough in Microbes to explain the exact difference in RNA or DNA sequences to give you a separate entity.

      Yet you think you know enough to discredit someone claiming to have a PHD? You don't even seem to know the difference between RNA and DNA, since you suddenly introduced RNA in an irrelevant manner.

      I have been repeating what other scientist have been saying as fact

      Link? See, as I said OVER AND OVER AGAIN, in order to claim speciation has not happened, you have to provide a definition of speciation. If you're not capable of doing so, then hopefully these "scientists" will.

      Could nature cause this splice without your intervention? Most likely not or you would already h

    711. Re:In unrelated news... by conman90 · · Score: 1

      That's nice; however, it has nothing to do with this debate. Just becuase some Christians support this dating technology does not mean it is pefectly accurate. I'm here not to support a religion but to simply present the opposite side of an argument.

    712. Re:In unrelated news... by conman90 · · Score: 1
      Sorry for the slow reply, now that school has started up again I've been very busy, but I will try to keep posting, for now.

      No, they're not just guesses. If they were, you'd have a point, but the amount of C14 is measured from samples of known age. Counting down ice cores and tree rings allows scientists to create a catalog of what the atmosphere's C14 levels looked like over the years. You say they're just guesses, but in reality, quite a lot of work goes into standardizing the data. As I said before, though, there are other methods that are even better because they are able to self-check for problems like the ones you describe.

      Sure, scientists can look at what historically has been, but remember, an ape, a tree, and ice absorb C14 from the air. Each specimen will breath in a different amount of air giving a different original amount of C-14 So, even though hours of research have gone into it, they truly are little more than just assumptions. If you'd like some evidence to back this up, here it is: "Radio-carbon dating is a method of obtaining age estimates on organic materials. The word "estimates" is used because there is a significant amount of uncertainty in these measurements.......The C-14:C-12 atmospheric ratio is known to vary over time and it is not at all certain that the curve is "well behaved."" Here's the Source

      I've said this before in these discussions and I'll probably say it again but, please show your work. Don't take it personally, but the assertion you just made is far too handwavy to be taken at face value, and as far as I know, quantum mechanics gives us no theoretical reason for this to be true in the temperature regimes you're talking about. As far as I can recall (and I don't have copy of Dalrymple with me, so please forgive me from working from memory), changes of over 1000 degrees C don't seem to alter C14's decay constant. I seriously doubt that a few degrees C are going to do it under normal Earth conditions. If you have some numbers to show, I'd be interested.

      I'm sorry for the confusion here, what I meant by decay was non-radioactive decay. "In early September, British researchers reported that warmer temperatures were causing the soil to heat up and dramatically increasing rates of decay. The temperate forests and fields of the United Kingdom are becoming, in essence, semitropical." Here's the Source I was simply trying to point out that the earth is constantly changing and we can not just assume that processes are always occurring at the same rates. And since science is based on observation (look at the scientific method), observation is necessary to prove something. In this case, since the half-life of C-14 has been CALCULATED to be AROUND 5700 years, we can't actually observe the full length decay and thereby can't prove that it doesn't fluctuate over time.

      It should be noted that ad hominem isn't Latin for, "That was a mean thing to say!" I suggest that if you'd prefer that your physics be taken seriously, start doing some calculations and stop inventing physical laws that don't exist. I was already a bit grouchy when you responded to me, and you did so by essentially calling thousands of scientists incompetent, stupid, or frauds. You can't seriously think that the objections that you're bringing up have gone unnoticed by the scientific community until now, can you? Obviously not, so they must either be too thick headed or incompetent to understand them, or the entire community of atomic physicists is involved in a conspiracy to defraud us. I'll leave it to you to decide which one you were suggesting.

      Actually, for those latin scholars out there, Ad Hominem literally means "To the Man" it is when an argument is focused on a person rather than their argument and it's considered a logical fallacy. Radiometric

    713. Re:In unrelated news... by plunge · · Score: 1

      "The record is just that the record. All the assumption pulled from the record isn't as you say unambiguous."

      You don't seem to understand how science works. When there are assumptions made, the scientists next step is not to go out for beer and put their feet up, it is to and test those assumptions, and so on and so on until everything but the truth is eliminated. The end result of this process is pretty darn certain.

      "It is just a bunch of theories put together. That is why it is called the theory of evolution not the evolution fact!"

      This statement is another red flag pointing to your ignorance. Only creationists ever seem to make this mistake. In science, "theory" is not a level below fact. Theories are MADE of facts and explanations put together to make something comprehensive. Furthermore, we DO talk about the fact of evolution: that is, common descent. Things like natural selection are what explain that fact.

      Theories in science do not "become" laws or facts. They are bodies of explanation, and the are often COMPOSED of laws and facts.

      "And as i said, There has never been the missing link that pulls two species together. If there is, show me the money. Show me this record that has the intermediate between ape and man. So far, all we have found is one or the other."

      There are countless transitional fossils. Your problem is that you don't seem to understand what a transitional fossil is, so you can't recognize it when you see it. In terms of hominids, we have a fossil record that shows a very clear and obvious transition of a more generic ape form to the specific sort of ape that homo sapiens are. There is no "one or the other": humans are a type of ape just like they are a tpe of mammal, and the fossil record shows how that type developed from a more general form, just as the other apes did.

      "LOL.. It proves all of those to a better degree that evolution does."

      No, not in the slightest. It doesn't explain the evidence. It doesn't explain the particular pattern of similarities and disimilarities we see in genetic clades, some of which involve very specific insertions of virus code into some ancestral line at a specific point in time that later diverged and branched out.

      "But the fact that you appear to not have any clue about it ("Whatever it is") but then dismiss it ("it makes no sense and is grossly inconsistent with the fossil record, the genetic record, and virtually everything we know about past life on earth" ) makes me wonder if we are talking about the religion of evolution or the science of evolution. How do you know if it is inconsistent if you don't know what it is? It does play into what we do know and can prove very nicely. What it doesn't do is play favors to the fairytales we make about what we think could of happened. And it has been around since almost the beginning of evolution as a theory of origin. It saddens me that you are convinced of evolution and have no knowledge of this."

      You've already described what you think it is (and as far as I know, you made it up yourself, because I can't find any reference to it in any of the actual biology journals I read: the closest thing to anything called bubble theory in abiogenesis, but that doesn't seem to be what you were talking about. In any case, what you've already described is more than enough to see that, whatever it is, it's clearly false and contradicted by the evidence.

      "But the flaw is in assuming a common ancestor."

      No, the common ancestry is not simply assumed: it is something that was shown, and is now part of biological clades because it was shown that ancestry EXPLAINS the pattern of nested clades we find in nature.

      "I'm saying this isn't possible and no one has proven it is. At most, It is just organism coming from the same area of creation. And Even then, it doesn't lose it's definition, it just refines it. So it really doesn't matter much to our discussion when the discussion is what it is."

      It matters a lot, because you don't

    714. Re:In unrelated news... by Alsee · · Score: 1

      Science is not a democracy.

      Absolutely true. You cannot simply "vote" truth.

      Just because most scientists don't subscribe to creation science doesn't mean its true. Time will tell if they can convince other scientists that they are correct

      You have it backwards there. 150 years ago they were ALL "creation scientists". They have dwindled *DOWN* from 100% down to 0.15% who are rabid fanatic crackpots who ignore evidence in favor of what they wish to prove. And over the last 150 years all of their ideas and arguments have been analyzed to death. They have all been found inadequate at best, and fundamentally flawed in general.

      Suggesting creation science is going to convince other scientists they are correct is like suggesting alchemists are going to convince scientists THEY are correct, and overturn a 150 years of the entire science of chemistry.

      We can't dismiss them as crackpots just because there aren't many of them.

      True, but I am not labeling them as crackpots merely for being in the staggeringly overwhelming minority. In particular anything new always starts out in the extreme minority and then has to earn it's way up. But we are talking here about religious fundamentalist zealots, a radical irrational fringe clinging to the last vestiges of a dispute that was essentially over and done with in the scientific community many DECADES ago. I have looked at a lot of their work. The vast majority is embarrassingly scientifically illiterate and riddled with blatant errors and near delusional denial of the most basic facts. I am labeling them crackpots because all of their work has been properly reviewed by other scientists for decades... a very large portion of that work and those arguments literally being over a century old... and that work and those arguments have been consistently found riddled with the most basic errors and disconnect from reality and logic. These people are not motivated by science, not motivated by an honest objective pursuit of truth wherever it may lead. That is the road to crackpottery. These people have, without exception as far as I can tell, purely religious motivations. In particular they are deeply motivated to reach a very specific result in order to conform to a particular interpretation of religious truth. These people have almost without exception entirely abandoned any pretense of working with and attempting to convince the scientific community, instead turning their efforts to public relations campaigns and at times court battles and even legislative efforts. Anyone... ANYONE who even glances twice at such tactics in an effort to establish the "scientific legitimacy" or "scientific acceptance" of their ideas has immediately and likely irrevocably earned themselves the title of crackpot. You most certainly cannot legislate science, and the general public school and layman education in science must follow well tested peer review accepted science, not attempt to lead it.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    715. Re:In unrelated news... by Anonymous Coward · · Score: 0

      Romania have more atheists than US, don't compare this one anectotal example with statistics. During communist years religion was suppressed, and there is a bigger percent of people in Romania who trust in evolution rather in god.
      There is no "in god we trust" on Romanian money and in the court you're not forced to swear by god ;-)

    716. Re:In unrelated news... by mfrank · · Score: 1

      The Grand Canyon was formed by the land in the area *rising* over millions of years and the Colorado river cutting it away. Go fifty miles upriver or downriver and there's not really a canyon.

      If you dammed up the Grand Canyon, it wouldn't flood the midwest. The Colorado would change its course around the bulge.

      As far as the flood story in Genesis is concerned, it's based on what happened about 6000 BC when the Bosporus Strait opened up, and the Black Sea went from being a small freshwater lake to a large salt water sea.

    717. Re:In unrelated news... by Phil+Karn · · Score: 1
      Thanks for the correction. I'm not a biologist, but I read a lot of literature from the evolution wars so it certainly seemed like the terms macroevolution and microevolution were pure creationist inventions because their bogus definitions were the only ones I'd see.

      The creationists' definition of "microevolution" is "evolution that's so obvious that even we cannot deny it", while "macroevolution" is "evolution that we pretend doesn't exist because it bothers us on theological, political or dogmatic grounds".

      Even the scientific use of those two terms seems rather imprecise, but that's to be expected since, as you say, there is no biological barrier between them.

    718. Re:In unrelated news... by Copid · · Score: 1

      Sorry for the slow reply, now that school has started up again I've been very busy, but I will try to keep posting, for now.

      Not a problem. Slashdot is full of busy people, and students tend to be particularly so.

      Sure, scientists can look at what historically has been, but remember, an ape, a tree, and ice absorb C14 from the air. Each specimen will breath in a different amount of air giving a different original amount of C-14 So, even though hours of research have gone into it, they truly are little more than just assumptions.

      That's going to depend heavily on the organism. There's no known method by which organisms distinguish between C12, C13, and C14 when they absorb carbon from the atmosphere. I'd be very surprised if there was any reference that indicated concrete examples of this. There are, however, a few ways to get strange isotope ratios. The best known is through the shells of mollusks that get their carbon from the limestone they inhabit. Obviously, their source of carbon is not the present day atmosphere, so carbon dating is meaningless. Likewise, trees that live for hundreds or thousands of years will have layers of old tissue and new tissue, and anything that eats the old tissue will inherit a funky carbon ratio, as will anything that eats those organisms. Most animals, though, eat the parts of plants that have extremely short life cycles (leaves and fruits). The carbon from those parts is sourced from the atmosphere at the time those features grew. There's little practical way that a cow that eats grass whose blades grow seasonally could get old carbon into its system. I can see an argument for a primate that eats termites that eat old wood, but that's an exception to the rule. As I said, carbon dating isn't perfect, and it requires some knowledge of what it is that you're dating, but it's not nearly as flawed as you seem to want to make it out to be.

      It's worth noting that calibrated carbon dates do show very good accuracy through recorded history. If it were all as arbitrary as you say, that wouldn't be the case.

      If you'd like some evidence to back this up, here it is: "Radio-carbon dating is a method of obtaining age estimates on organic materials. The word "estimates" is used because there is a significant amount of uncertainty in these measurements.......The C-14:C-12 atmospheric ratio is known to vary over time and it is not at all certain that the curve is "well behaved."" Here's the Source

      As far as I can tell, the source is correct, but as discussed above, I don't think that the claim of differential rates of C14 absorption are accurate. As far as I have been able to find, bad ratios of carbon have to do with the source of absorption and the age of the organism, not on some method that allows them to "reject" certain isotopes of carbon.

      I'm sorry for the confusion here, what I meant by decay was non-radioactive decay. "In early September, British researchers reported that warmer temperatures were causing the soil to heat up and dramatically increasing rates of decay. The temperate forests and fields of the United Kingdom are becoming, in essence, semitropical."

      This is a very important distinction. Radioactive decay of the type we're discussing has absolutely nothing to do with the type of decay you just brought up. It's a complete red herring. Higher temperatures make the water from swimming pools evaporate faster as well, but that has nothing at all to do with the well understood process of atomic decay.

      I was simply trying to point out that the earth is constantly changing and we can not just assume that processes are always occurring at the same rates. And since science is based on observation (look at the scientific method), observation is necessary to prove something. In this case, since the half-life of C-14 has been CALCULATED to be AROUND 5700 years, w

      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
    719. Re:In unrelated news... by dbrutus · · Score: 1

      My point was to bring up an example of how science can go wrong not to provide an exhaustive list. Lysenkoism is merely the most obvious episode. The problem with evolution is that its professionals inadequately police themselves and permit an awful lot of unscientific christian bashing to go on under color of science (read up on Dawkins for a strong example).

      Once "science" as a profession leaves behind the scientific method and countenances pseudoscience if it's a particular, favored brand, then all that matters is who is holding the whip hand and it all becomes a political struggle. And why should we support that?

    720. Re:In unrelated news... by dbrutus · · Score: 1

      If a BC era herder writes up a highly sophisticated treatise on string theory stating that this is, in fact, how the universe works, once the original docs are authenticated as coming from that era you pretty much have to come to the conclusion that God exists because there is no other explanation for someone of that background knowing such things. Knowledge destroys faith whether by denying it or confirming it what you have afterwards is not faith, blind or otherwise.

    721. Re:In unrelated news... by Anonymous Coward · · Score: 0

      what are you basing that off of? Time to get a new blow up doll, chief.

      Stupid wankers.

      I fart in your car!
      I smell up your space!
      Want to bend over?
      Spook rice face!

    722. Re:In unrelated news... by huge+colin · · Score: 1

      "God does not play dice" - Albert Einstein (obviously not a "scientific person")
      It is generally accepted that Albert Einstein was using the word 'God' not to refer to the Judaeo-Christian god, but as a metaphor for the forces that drive the universe.
  2. Heathens dying of scurvy in New York by Harmonious+Botch · · Score: 3, Insightful

    Ok, there's a mislabeling of vitamin C, and NY politicians are posturing about something, and a majority of Americans are christians.
    THIS IS NEWS????
    C'mon editors, what happened to news for nerds, etc?

    1. Re:Heathens dying of scurvy in New York by Anonymous Coward · · Score: 0, Redundant

      "a majority of Americans are christians." This news item has nothing to do with Christianity, it just says that 48% of Americans don't believe in Evolution. What does that have to do with Christianity? I'm a Christian and I beleive in Evolution. I don't get it.

    2. Re:Heathens dying of scurvy in New York by Anonymous Coward · · Score: 0

      Simple; Rejecting evolution is part of the christian cult. Now, not all christians takes part of ALL the christian cults, but many do this one.

    3. Re:Heathens dying of scurvy in New York by RealGrouchy · · Score: 1

      I'm hoping that it will all turn out to be an elaborate April Fool's joke.

      - RG>

      --
      Hey pal, this isn't a pleasantforest, so don't waste my time with pleasantries!
    4. Re:Heathens dying of scurvy in New York by Anonymous Coward · · Score: 0

      You've seen the change in CNN when Fox News showed up. Same has happend to /. when Digg came.

    5. Re:Heathens dying of scurvy in New York by dbIII · · Score: 1

      Mainstream Christianity accepted evolution long ago. The merchants in the temple - paticularly the TV evangalist idiot that blamed 9/11 on lesbians - do not.

    6. Re:Heathens dying of scurvy in New York by Tibor+the+Hun · · Score: 1

      Oh boy are you in for a shock tomorrow!
      I hope you like your ponies pink!

      --
      If you don't know what AltaVista is (was), get off my lawn.
    7. Re:Heathens dying of scurvy in New York by Scrameustache · · Score: 1

      Ok, there's a mislabeling of vitamin C, and NY politicians are posturing about something, and a majority of Americans are christians.
          THIS IS NEWS????
      C'mon editors, what happened to news for nerds, etc? Highschool science fair bitchslaps giant corporation: News for nerds.
      Googlemaps reverting to outdated data: News for nerds.
      New poll shows that half the people you cross on the street have no fucking clue about biology? Scary news for nerds.
      --

      You can't take the sky from me...

  3. Quick, call in the Hippie Power Squad by heinousjay · · Score: 2, Insightful

    We'd better start evangelizing science to these poor bastards.

    Come on, who cares? Let people be ignorant. It's not like bringing people of below average intelligence or fundamentalist mindset into the scientific fold is going to make them valuable contributors. It'll just be a new type of ignorance to deal with. Let them be.

    --
    Slashdot - where whining about luck is the new way to make the world you want.
    1. Re:Quick, call in the Hippie Power Squad by Anonymous Coward · · Score: 5, Insightful

      So, to paraphrase, you're saying:

      Let ignorant people remain ignorant, because what harm could they possibly do to our society? ...incidentally, have you been off-planet for about six years?

    2. Re:Quick, call in the Hippie Power Squad by El+Cubano · · Score: 3, Interesting

      Come on, who cares? Let people be ignorant. It's not like bringing people of below average intelligence or fundamentalist mindset into the scientific fold is going to make them valuable contributors. It'll just be a new type of ignorance to deal with. Let them be.

      Hmm. Larry Wall is an evangelical Christian. According to his page, he attends this church.

      Now, since his contributions are not valuable by your estimation, what is the name of the programming language which you have been developing for over 20 years and is the de facto language for development of dynamic web content and for automating system administration tasks on nearly every operating system?

      I'm waiting.

    3. Re:Quick, call in the Hippie Power Squad by metlin · · Score: 4, Insightful

      Come on, who cares?

      We care, because these people are also making our laws, electing our politicians and teaching our kids.

      These people would be deciding that scientific research is bad (it's already begun, look at the funding cuts in science and technology and the government stance on stem cell research etc). These people will also be electing idiots into office, idiots who believe that a voice-in-the-sky talks to them. And these people will be teaching -- no proselytizing -- to our children.

      Do you really want to live in such a society? I, for one, do not. If anything, it scares me to no end.

    4. Re:Quick, call in the Hippie Power Squad by zymurgy_cat · · Score: 5, Insightful

      Come on, who cares? Let people be ignorant. It's not like bringing people of below average intelligence or fundamentalist mindset into the scientific fold is going to make them valuable contributors. It'll just be a new type of ignorance to deal with. Let them be.

      That would be all fine and well except for one thing: they're reproducing....and at a higher rate than those of us who value science. And those people and their progeny will vote.

      --
      -- Fugacity: Confusing chemists since 1908
    5. Re:Quick, call in the Hippie Power Squad by ignoramus · · Score: 2, Interesting

      That's too dangerous. It's not that we'd like them to contribute to scientific advancement--it's that they'll stop it dead in its tracks if they're clueless/fearful/ignorant and some guru/politician/power-hungry-jerk abuses they irrationality for personal gain.

      For many reasons, we--the scientist and scientifically minded--kind of gave up on trying to explain our understanding and objectives to the "layman" and now the rift between us just keeps growing... this is bad because sheeple they may be, but they elect those who set the rules and decide where funding goes (think stem cell research, etc.).

      Just like with racism or other unacceptable behavior, I always speak up and try to get across my point of view when faced with the irrational. At a minimum, I'm showing them that there is an alternate point of view, that not everyone agrees--usually only the fanatics are heard because they tend to speak most and loudest... Time to be heard!

    6. Re:Quick, call in the Hippie Power Squad by weorthe · · Score: 1

      It matters when they decide what to teach your children. It matters when they vote for politicians believing God wants us to defend God's official borders for Israel, God wants us to oppress homosexuals, God wants us to keep whatever they think is immoral out of libraries and stores and off the Internet, God wants us to go to war against Godless Muslim countries, God wants us to stop stem cell research, etc. Or how about God made the white race the world's natural rulers, or God wants us to wipe out infidels, or fly airplanes into buildings or blow up cities? When people choose to believe things based on mysticism instead of reason, every prejudice can be magically validated and every base impulse indulged.

      --
      cat * >> sig
    7. Re:Quick, call in the Hippie Power Squad by Anonymous Coward · · Score: 0

      Uh, when half the population thinks this way and they influence one of the most powerful governments in the world... it's not something you should just say "let it be" to.

    8. Re:Quick, call in the Hippie Power Squad by plover · · Score: 1, Troll
      Won't somebody think of the children?

      Specifically, their children are going to grow up to be as ignorant as their parents; even if they're much smarter than mom and dad, their ignorance will interfere with them becoming valuable contributors to the scientific community. Those smart kids would end up as so much wasted resources, like having Stephen Hawking mopping floors.

      And if we don't get enough of them thinking critically, we'll end up in aHarrison Bergeron future.

      --
      John
    9. Re:Quick, call in the Hippie Power Squad by heinousjay · · Score: 1

      Relax friend. Putting words into my mouth in an attempt to deflate my point won't get you far around here. Most of us see right through that technique.

      --
      Slashdot - where whining about luck is the new way to make the world you want.
    10. Re:Quick, call in the Hippie Power Squad by Tanuki64 · · Score: 4, Interesting

      Come on, who cares? Let people be ignorant. It's not like bringing people of below average intelligence or fundamentalist mindset into the scientific fold is going to make them valuable contributors. It'll just be a new type of ignorance to deal with. Let them be.
      I am afraid this is not so easy. Being stupid like that isn't an evolutionary disadvantage today. On the contrary, it seems to be an advantage. To learn todays science you have to invest time and hard work. Time where you are severely restricted in things you can do otherwise. The stupids don't bother with such efforts, believing is so much easier. So instead of hard work over books or in lecture halls, they have plenty of free time they can use to build their power base. What fundamentalists lack in brain power they easily compensate with aggressiveness and and falsehood.

      The braindead cry loudly evolution does not happen. Scientist silently go to work. Maybe to find a way to prove facts, which will convince even those, which of course is impossible. But more likely because they don't care, thinking truth will always win.

      The braindead cry more and louder, because there is nobody who really opposes them, they win more and more often. Without dedicated opponents they win at schools, they win in the public media. They are fare more visible than they deserve. The final result is, that two legged protein lumps, which would be better suited as emergency food rations in hard times govern you and tell you what is right and what is wrong.
    11. Re:Quick, call in the Hippie Power Squad by SatanicPuppy · · Score: 1

      Sure sure, people who go to church are so wise and well educated...It's just a huge coincidence that they effectively disbelieve biology. It could happen to anyone.

      BTW, in case you were unaware, your argument is based on a well known subset of the fallacy: Appeal to Irrelevant Authority. The fact that an otherwise intelligent person believes something stupid is not actually relevant to this discussion.

      --
      ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
    12. Re:Quick, call in the Hippie Power Squad by Clock+Nova · · Score: 1

      Which is why I think that they deserve to be treated like the animals that they are. I have absolutely no respect for those who embrace mysticism. None.

      --
      There they were, sitting in the van with all those dials, and the cat was dead. -V. Marchetti, CIA
    13. Re:Quick, call in the Hippie Power Squad by Yetihehe · · Score: 1

      It scares me more that USA is in charge of most of world's WMD, and soon the internet. There are also rumours from Russian intellgience that USA is going to attack Iran on 6 April.

      --
      Extreme Programming - Redundant Array of Inexpensive Developers
    14. Re:Quick, call in the Hippie Power Squad by pla · · Score: 2, Insightful

      Come on, who cares? Let people be ignorant. It's not like bringing people of below average intelligence or fundamentalist mindset into the scientific fold is going to make them valuable contributors. It'll just be a new type of ignorance to deal with. Let them be.

      As much as I may not want to, someday, I will get old.

      When that happens, I want stem cell therapies available to fix my joints and my heart and my cancer and my alzheimers and just about everything else that might go wrong with me short of sudden death. And if stem cells don't work, clone me a pithed organ donor. Not that I plan to live forever, but I would very much like to keep going at near full capability until the day I drop.

      But as long as we have enough ignorant fundamentalists around to vote even a few of them into places like the whitehouse, where they can block funding for such research, we have a huge problem.

      As the easiest and most obvious solution, we just need to ban religion (disclaimer - I believe in a creator deity; I just don't have a big enough ego to pretend I know what it wants). Failing that, if we can teach a large enough percentage of the population to (accurately) view books like the Bible and Koran as "inspirational fiction", then perhaps we'll stop seeing blocks on federal funding for stem cell research.

    15. Re:Quick, call in the Hippie Power Squad by Anonymous Coward · · Score: 1, Funny

      But Brawndo's got what plants crave! It has Electrolytes!
      We're well on our way to an Idiocracy.

    16. Re:Quick, call in the Hippie Power Squad by Seumas · · Score: 2, Insightful

      Sadly, their ignorance affects the rest of us. They get to vote. They make laws that affect us. They help decide the direction of the entire nation. If the number grows much larger, it's a small step from what we have now to a world in which we have no free speech and science funding is cut in favor of building more churches and religious statues in public places (remember, something like 50% of highschool students think the first amendment goes too far!).

      If these idiots didn't have a serious amount of weight behind them, this wouldn't matter. But that means only one or two percent of the other side have to be swayed into voting along the lines of these idiots and you can see how things like stem cell research, space exploration and biological discoveries will be limited by sheer ignorance.

      Also, I find these statistics to be somewhat questionable because only last week I read that 18% of people 18 to 30 classify themselves as atheists (as opposed to the current 2% of the entire population that considers themselves atheists).

    17. Re:Quick, call in the Hippie Power Squad by heinousjay · · Score: 1

      Great idea. I just have one question: How does one ban a belief, exactly?

      --
      Slashdot - where whining about luck is the new way to make the world you want.
    18. Re:Quick, call in the Hippie Power Squad by fireboy1919 · · Score: 4, Interesting

      In this entire line of reasoning, the assumption appears to be that these people can't possibly hold one wrong view yet also do anything else right.

      Rejecting evolution makes you a gibbering idiot who is unable to govern your own life and hates science? Do you realize how incredibly arrogant that is?

      I don't believe in Evolution. I haven't seen enough facts to support it. I hold the same to be true for all mechanisms whereby the earth, life, and the universe were created. Nothing has enough evidence to support any kind of solid conclusion. There's a bit too much guesswork for me to accept it.

      So, IMHO, all it takes is a few preconcieved notions to get you to pick one theory over another. Which one is right? Beats me. I, like most of society, have the luxury of not needing to know how things started to function. And not just function - an understanding of virtually all science, technology, culture, art, and search for truth is available to me without being sure about that.

      The only thing I have to deal with is a very special kind of ignorance. The ignorance of the halfway educated - of those who believe that they have Learned and now Know the Right Answer and can therefore Show Others the Way. Once you really start to getting into how things work, you realise that you Know Very Little and Always Will.

      How can you be so sure?

      --
      Mod me down and I will become more powerful than you can possibly imagine!
    19. Re:Quick, call in the Hippie Power Squad by ukemike · · Score: 1

      hese people would be deciding that scientific research is bad (it's already begun, look at the funding cuts in science and technology and the government stance on stem cell research etc). These people will also be electing idiots into office, idiots who believe that a voice-in-the-sky talks to them. And these people will be teaching -- no proselytizing -- to our children.

      Do you really want to live in such a society? I, for one, do not. If anything, it scares me to no end. Uh... DUH!

      We do live in that exact society!

      Bush has on several occasions stated that he takes policy advise from God.
      http://www.bbc.co.uk/pressoffice/pressreleases/sto ries/2005/10_october/06/bush.shtml

      http://www.democracynow.org/article.pl?sid=04/10/2 0/1423216
      --
      -- QED
    20. Re:Quick, call in the Hippie Power Squad by Gerdts · · Score: 1

      Kinda ironic that evolution tends to favor those that dismiss it.

    21. Re:Quick, call in the Hippie Power Squad by zippthorne · · Score: 1

      Biology is a fuzzy science. Not as fuzzy and infantile as psychology, but it still can't be trusted like physics can.

      I haven't seen any evidence that proves evolution. I've heard of quite a few experiments that fail to disprove it, or don't really prove anything at all, but the best evidence we have for evolution is indirect observation. It's a good theory, and it fits most of the facts, but it's simply not beautiful yet like F=dp/dt or E=hnu.

      What the scientists want is for science education to be as complete as possible, but what the slashdotters seem to want is for people to place faith in evolution instead of Christ. or YHWH. or Budda. or Zoroaster. or His Grand Noodliness.

      Faith is the domain of religion, and should remain there. It has no place in science. Ask me to believe your theory, but don't ask me to believe in it. We'll both be disappointed.

      --
      Can you be Even More Awesome?!
    22. Re:Quick, call in the Hippie Power Squad by Micah · · Score: 1

      FWIW, Larry Wall is an evolutionist.

      As is Francis Collins, the leader of the human genome project. He is a Christian who has contributed quite a bit!

    23. Re:Quick, call in the Hippie Power Squad by zippthorne · · Score: 1

      I should've added that I mean psychology is infantile as in it's still in its infancy, not that we have nothing to learn from the field. But progress is necessarily slow in a field where it may be unethical to perform any significant experiments.

      --
      Can you be Even More Awesome?!
    24. Re:Quick, call in the Hippie Power Squad by Scrameustache · · Score: 1

      who cares? Who votes?
      --

      You can't take the sky from me...

    25. Re:Quick, call in the Hippie Power Squad by metlin · · Score: 1

      We do live in that exact society!

      Bush has on several occasions stated that he takes policy advise from God.


      Ummm, that's why I said that, gee.

    26. Re:Quick, call in the Hippie Power Squad by tshak · · Score: 1

      Come on, who cares? Let people be ignorant.

      You're overlooking an important fact: These people vote.

      --

      There is no longer anything that can be done with computers that is nontrivial and clearly legal. -- Paul Phillips
    27. Re:Quick, call in the Hippie Power Squad by Watson+Ladd · · Score: 1

      Stephen Hawking can't mop a floor. He's paralyzed.

      --
      Inventions have long since reached their limit, and I see no hope for further development.-- Frontinus, 1st cent. AD
    28. Re:Quick, call in the Hippie Power Squad by haggus71 · · Score: 1
      OK. So China, where they accept the major fundamentals of science and biology, is a rapidly rising world power. Japan, where science was encouraged by the US after World War 2, is one of the top major economic and technological powers. In the US, where a theory as relevant as King Kanuk of the Congo popping the world out of his but is accepted by nearly half the population, is only becoming better at buying stuff and getting in debt. The only time we were a success and advancing was when the scientists were considered heroes instead of Oprah and Brad Pitt.

      Does anyone see a correlation here?

    29. Re:Quick, call in the Hippie Power Squad by pla · · Score: 1

      Great idea. I just have one question: How does one ban a belief, exactly?

      Simple - You don't ban it, you teach people to consider it a joke. Make it laughably quaint.

      And if you don't consider that serious, tell me how seriously you take the threat of Zeus striking you down for failing to observe the ancient Greek pantheon.

    30. Re:Quick, call in the Hippie Power Squad by crashfrog · · Score: 4, Interesting

      I don't believe in Evolution. I haven't seen enough facts to support it. I hold the same to be true for all mechanisms whereby the earth, life, and the universe were created.

      Wow. I love when people talk about how arrogant it is to accuse people of being gibbering idiots, and then go on to prove what gibbering idiots they are? Arrogant? Seems more like prescient.

      Evolution isn't an explanation for the origin of the universe. It's not really an explanation for the origin of life, either. It's the scientific model that explains the history and diversity of life on Earth by means of mechanisms like random mutation and natural selection.

      And to the extent that a scientific model can be proven, evolution has been proven. Life on Earth evolved and continues to evolve (we know that from the fossil record and from continuing observations.) The theory of evolution tells us how that evolution happened. If you haven't "seen the evidence", then it's because you've never been in a biology classroom, or because you don't even understand what you're looking for evidence of.

      How can you be so sure?

      Who has to be sure? You need to accept uncertainty into your life. Just because we don't know everything doesn't mean we know nothing. There are questions in biology that evolution doesn't yet answer. Thank goodness, there's a lot of biologists who would be out of work, otherwise.

      --
      I never have frustrations, the reason is, to wit:
      If at first I don't succeed, I quit!
    31. Re:Quick, call in the Hippie Power Squad by Kjella · · Score: 1

      ow can you be so sure?

      Sure, I am not. But if Creation literally happened anything like Genesis said it does, God is playing the biggest practical joke on us ever. There are tree rings, glacier records, fossil records, DNA records and plenty more which appears to make earth much older. Even that just barely covers the topics from biology to archeology to geology to astrophysics which all inevitably end up at predating Creation (at least the 4kBC creation). I say "appear to" because against an omnipotent God, anything is possible.

      There is a fallacy here, and that fallacy is that even though we cannot say what is the Truth(tm), we cannot say what is false. Of course if you put it up as God's test of faith and that to worship God you must deny reason, nothing is sacred. But if you assume a honest God, a benevolent God, in short anything like the christian God the it doesn't add up. Either Creation happened the way it appears to through scientific evidence, with the Big Bang and evolution from 13 billion years ago until today ultimately producing humans, or God is bullshitting you. That are the only two choices if you believe in a god (or Allah or whoever).

      --
      Live today, because you never know what tomorrow brings
    32. Re:Quick, call in the Hippie Power Squad by paiute · · Score: 1

      Come on, who cares?

      Maybe we care because these people have political control over 10,000 nuclear warheads.

      --
      If Slashdot were chemistry it would look like this:Cadaverine
    33. Re:Quick, call in the Hippie Power Squad by Tacvek · · Score: 1

      I hold the same to be true for all mechanisms whereby the earth, life, and the universe were created.
      I believe that is your problem. Evolution DOES NOT address creation of the earth, of life, or of the Universe.
      Evolution explains only what has happened since life was created and the present.
      --
      Stylish sheet to fix many problems in Slashdot's D3: https://gist.github.com/801524
    34. Re:Quick, call in the Hippie Power Squad by Dirtside · · Score: 1

      I, like most of society, have the luxury of not needing to know how things started to function.

      Geesh -- you're so proud that you "don't believe in Evolution" (why did you capitalize it? evolutionary biologists don't), and yet the quoted sentence here indicates that you don't even know what it is. The various theories surrounding natural evolution say nothing about the origin of life. Evolution is about how one species turns into another, not about how the first lifeform(s) arose. That's called abiogenesis, and is a completely separate field.
      --
      "Destroy science and religion. Science would re-emerge exactly the same; but not religion." - Penn Jillette, paraphrased
    35. Re:Quick, call in the Hippie Power Squad by Garse+Janacek · · Score: 3, Insightful

      Exactly. For most of my life, even past college, I was a creationist (raised Evangelical). This didn't in any way hinder my ability to think intelligently, or to do lab work for a biotech company, or to ace my science classes, or to graduate from a good school with honors. In most of life, your opinions on the practical origins of life just don't matter very much. Now, one of the places where it does matter is if you're a biologist, or a teacher of biology, or someone who is in a position to legislate on the actions of the former two, so this is a legitimate political conflict. But it's very frustrating when people assume that this one opinion is the only important factor between "intelligent supporter of science" and "superstitious Neanderthal."

      Now, eventually, I did change my opinion, and now I'm quite convinced of evolution. But the reason I changed my mind highlights another issue here: I read more about it, and finally found persuasive evidence that answered the objections I'd had for years. I couldn't reconcile that evidence with what I had believed, so I changed my mind.

      The thing is, it's not like people had never before tried to argue with me or change my mind. Plenty had, and some had been quite smug about it, too. But no one had actually been able to answer my objections. I would even go so far as to say that I had a better understanding of the scientific method than many of the people who had tried to change my mind, since they often offered very poor or contradictory "scientific evidence," or used simple tautologies and ended up saying "See? It's obvious!" Essentially, I now think they were right, but not because they had any particularly good understanding of the subject, but because they had been taught the right thing and believed it.

      Now, most of the time there's nothing wrong with believing what you're taught within reason. Skepticism is healthy, but it can't be applied to literally everything or society couldn't function. But in this case, these people who believed their teachers without really understanding the issue were treating me as stupid for... believing my parents/acquaintances/pastors/whatever without really understanding the issue. Even though I understood more about the issue than they did.

      Ultimately, I'm not saying it doesn't matter what people believe. It's largely irrelevant to daily life, but some people are interested in legislating about this issue. And even though the bulk of the population will never be scientific experts, I think more correct impressions are generally preferable to less correct impressions. So in fact, I think people should teach and advocate evolution -- but they need to drop the instant contempt for people who disagree. People who don't believe in evolution are not generally any stupider than people who do. I happen to think they're incorrect, but smart people believe incorrect things all the time, and it's very easy to condemn the belief coming from an environment where all the pressure from an early age is in favor of evolution. Most of the people who believe in one or another form of creationism were raised in environments where the opposite is true. So, if you're trying to advocate or explain evolution, show a little more respect for people who haven't had the exact same life experiences that you do, and be aware that this is not the litmus test of their intelligence (in either direction :-P).

      My favorite comic on this subject.

      --

      I am the man with no sig!

    36. Re:Quick, call in the Hippie Power Squad by Lars512 · · Score: 1

      I agree, whether or not people believe in evolution is not a litmus test for their intelligence. However, taking these beliefs over a large groupings of people can provide a litmus test for both scientific awareness in the communities in which they were raised, and for science education in the institutions they were educated in.

      If we call evolution a process, then we know that this process exists and we have large amounts of evidence for it. There is no real debate about this in the scientific community, thus an education which claims there that there is this debate is poor, at best misleading. People who deny that this process exists, and is applicable for all living things including humans, are actually the victims here, victims of a poor education system.

      A lot of reason for the debate is that the discovery of evolution was a significant blow to a literal interpretation of the bible. For this reason, there exists a lot of religious tension around the issue. If people debating it with you were smug, it's because there is no room in science for a blending of science and religion. Where questions are answerable, science will never turn to religious beliefs to support a theory. Even if their beliefs were wrong in their current form, they would still be eventually vindicated in their choice to leave theology out of it, as some new scientific theory displaced the old one.

    37. Re:Quick, call in the Hippie Power Squad by Garse+Janacek · · Score: 1

      I love when people talk about how arrogant it is to accuse people of being gibbering idiots, and then go on to prove what gibbering idiots they are?

      GP: "Being mistaken on topic X doesn't mean someone is a complete idiot in every area of life."

      P: "Aha! You claim not to be an idiot, but you must be, because you misapplied a term from topic X!"

      This questionable display of reading comprehension (not to mention unnecessary rudeness in actually calling someone a gibbering idiot to their face) is given a pass because the parent reaches the correct conclusion on topic X. Post is modded insightful.

      *Sigh*...

      --

      I am the man with no sig!

    38. Re:Quick, call in the Hippie Power Squad by crashfrog · · Score: 1

      This questionable display of reading comprehension

      Yeah, about your reading comprehension... maybe you noticed that I was just using a term the parent used first?

      Man, some people. I thought my point was pretty clear that it's fairly ridiculous to call foul on calling someone ignorant just because they have a different view, when it's obvious that they themselves only hold that view out of ignorance. In other words you shouldn't try to refute accusations that you yourself prove true.

      --
      I never have frustrations, the reason is, to wit:
      If at first I don't succeed, I quit!
    39. Re:Quick, call in the Hippie Power Squad by Anonymous Coward · · Score: 0

      > There is no real debate about this in the scientific community, thus an education which claims there that there is this debate is poor, at best misleading.

      I had this argument with a guy on a literature discussion board-- he claimed that scientists "were abandoning the theory of evolution in droves."

      I asked him to name five. He actually named about seven, but:

      * Only three of them were biologists
      * Five of them were fundamentalist Christian creationists to begin with, and thus did not 'abandon' evolution because they had never accepted it
      * The other two were opposed to some aspects of evolution but did not reject it in its entirety

      Interesting that we don't see ANY biologists abandoning evolution for SCIENTIFIC reasons, if the case for creationism is so compelling, isn't it?

    40. Re:Quick, call in the Hippie Power Squad by Eli+Gottlieb · · Score: 1

      So anyone less scientifically educated than you (for instance, liberal arts majors) deserves to be made into food?

    41. Re:Quick, call in the Hippie Power Squad by Garse+Janacek · · Score: 1

      Yeah, about your reading comprehension... maybe you noticed that I was just using a term the parent used first?

      Err... yes. I understood your point fine. I know you were using a term the parent used, however since he was just saying you shouldn't call people that, whereas you were actually calling him that, I still thought it was needlessly rude.

      I thought my point was pretty clear that it's fairly ridiculous to call foul on calling someone ignorant just because they have a different view, when it's obvious that they themselves only hold that view out of ignorance.

      Well, except for the fact that here you're saying "ignorant" whereas before you said "gibbering idiot," which is completely and fundamentally different (every human suffers from the former about many topics for the entirety of their lives; most do not suffer from the latter, at least by most reasonable standards) -- with that exception, yes, that point was clear. I disagreed with it. Specifically: I question your claim in this sentence that the poster was only saying you shouldn't call people idiots because of ignorance. As a counterexample to your claim, I submit myself: I think evolution is true, and yet I still think you shouldn't call all creationists idiots, especially in any respect that is not very directly related to evolution.

      Maybe you would say that my insistence on at least a modicum of respect for the humanity (if not the correctness) of huge groups of people is still reflective of some sort of ignorance. Oh well...

      --

      I am the man with no sig!

    42. Re:Quick, call in the Hippie Power Squad by crashfrog · · Score: 1

      Well, except for the fact that here you're saying "ignorant" whereas before you said "gibbering idiot,"

      Parent used them as synonyms; I'm just continuing the same usage for clarity. For my own word choice, I would stick with "ignorant."

      And the ignorant shouldn't complain about being recognized as ignorant. They should correct their ignorance.

      Maybe you would say that my insistence on at least a modicum of respect for the humanity (if not the correctness) of huge groups of people is still reflective of some sort of ignorance.

      I doubt it, but honestly, I'm not sure what would prompt someone to excercise such intense righteous indignation on behalf of someone else. I suspect you're simply addicted to being righteously indignant.

      --
      I never have frustrations, the reason is, to wit:
      If at first I don't succeed, I quit!
    43. Re:Quick, call in the Hippie Power Squad by Archangel+Michael · · Score: 1

      "Specifically, their children are going to grow up to be as ignorant as their parents;"

      What does faith have to do with ignorance? Who is more ignorant the person who doesn't believe in God, but accepts everything teachers say without any regard, or the person of Faith who challenges everything, INCLUDING "theories"???

      Excuse me, but I'd put my kids (faith) against your "average" atheist's in just about anything (except sports). They are not "ignorant" by a long shot. And yes, they can spew Evolution back at the teacher's who require it. Just because someone doesn't have faith in the "scientific theory" doesn't make them ignorant.

      I'm really sick of the "holier then thou" science crowd.

      "Stephen Hawking mopping floors."

      Stephen Hawking, brilliant as he thinks he is, hasn't been proven right much. Just because he has all sorts of fanciful theories doesn't make him god. He's just a smart man, just like many others. And there just might be someone much smarter than Stephen Hawking who does sweep floors. You ever think of that? Perhaps such a person LIKES to sweep floors rather than seeking self glory based upon making shit up (albeit very deep shit).

      "And if we don't get enough of them thinking critically"

      You mean like challenging conventional wisdom? I remember that Gorillas were thought to be the fancy of crazy "wild men" (Negros). Of course no white man had ever seen them, and therefore they couldn't possibly exist. Gorillas were made fun of, exactly as the FSM makes fun of what you cannot understand because you cannot see it. Just because YOU can't see it, doesn't mean it doesn't exist.

      --
      Agent K: A *person* is smart. People are dumb, stupid, panicky animals, and you know it.
    44. Re:Quick, call in the Hippie Power Squad by evilviper · · Score: 1

      But as long as we have enough ignorant fundamentalists around to vote even a few of them into places like the whitehouse, where they can block funding for such research, we have a huge problem.

      Teaching people evolution isn't going to magically stop them from being religious, so your comment is utterly off-topic.

      Failing that, if we can teach a large enough percentage of the population to (accurately) view books like the Bible and Koran as "inspirational fiction", then perhaps we'll stop seeing blocks on federal funding for stem cell research.

      I hate to burst your bubble, but a great many people, who are infinitely smarter than you could possibly be, were devout religious believers. Your opinions is just that, it's not "right" or wrong.
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
    45. Re:Quick, call in the Hippie Power Squad by niXcamiC · · Score: 1

      they're reproducing....and at a higher rate than those of us who value science.

      Ironicaly, this means they have an evolutionary advantage over you....

      --
      Chances are any disscution on Slashdot will degrade into a flamewar about ID/Christianity within 14 posts.
    46. Re:Quick, call in the Hippie Power Squad by Anonymous Coward · · Score: 0

      Nobody but a fool *believes in* evolution. That would be anti-scientific. Evolution's supporters choose evolution over the alternative explanations only because they *prefer* evolution as being superior to the others. Those who confuse this issue as a matter of believing in this-or-that miss the point of science (or evolution) entirely.

      Evolution is scientific because it employ *only* natural law to explain biological change among populations over time. Nobody, certainly not good scientists, are *sure* that evolution is correct. But until another theory comes along that does a better job than evolution of explaining the changes to animal/plant societies that have been observed in history, thoughtful people will believe that it is closest to the truth.

              Randy

    47. Re:Quick, call in the Hippie Power Squad by evilviper · · Score: 1

      Specifically, their children are going to grow up to be as ignorant as their parents; even if they're much smarter than mom and dad, their ignorance will interfere with them becoming valuable contributors to the scientific community.

      I guess racism is just getting worse... And people are getting more ignorant through the generations...

      It's a good thing we had those magical aliens come along, that weren't exposed to ignorance (the contagious disease it is), and single-handedly make all scientific advancements in human history, while people just kept getting more ignorant.
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
    48. Re:Quick, call in the Hippie Power Squad by evilviper · · Score: 1

      Evolution isn't an explanation for the origin of the universe. It's not really an explanation for the origin of life, either. It's the scientific model that explains the history and diversity of life on Earth by means of mechanisms like random mutation and natural selection.

      Actually, it includes all of that, and more.

      And to the extent that a scientific model can be proven, evolution has been proven.

      I fail to see how that is relevant. Many theories were proven, before they were disproven...
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
    49. Re:Quick, call in the Hippie Power Squad by wyldeone · · Score: 1

      Do you not realize that more-or-less all of modern Biology is based on Evolution? That the technology used to create antibiotic and antiviral drugs is based wholly on the theory of Evolution? You state that you haven't seen enough facts to support evolution. I would assume, then, that you have some sort of alternate theory. It would seem pretty silly to just ignore a theory that has been evidenced again and again and again for the past couple centuries without some sort of incredible alternative. If that alternative is, as I would imagine if you are an evangelical Christian, some form of creationism, there is a large difference between that and a scientific theory like Evolution. In science, there is the requirement--in order for something to be considered a natural explanation--that it be disprovable. Any sort of supernatural explanation for how things are is inherently unable to be disproved, and therefore does not qualify as science.

      At this point, it really is impossible to claim that there isn't enough evidence for evolution. Biologists have been directly observing evolution in action for decades. The modern theory of evolution, meanwhile, has never been found in conflict with findings of Biologists in all this time.

      Perhaps at one point--early 19th century or so--one could get away with claiming that there was not enough evidence to accept evolution. But that excuse is a bit outdated in the 21st century.

      --
      In the beginning the universe was created. This made a lot of people very angry and is widely considered as a bad move.
    50. Re:Quick, call in the Hippie Power Squad by Anonymous Coward · · Score: 0

      Well if I understood before that all that had to be done was to influence people's opinions on religion on a mass scale I wouldn't have mocked the idea in the first place.

    51. Re:Quick, call in the Hippie Power Squad by Anonymous Coward · · Score: 0

      Those smart kids would end up as so much wasted resources, like having Stephen Hawking mopping floors.
      Or, you know, Stephen Hawking rolling around in a fucking wheelchair instead of writing on a blackboard?
    52. Re:Quick, call in the Hippie Power Squad by fireboy1919 · · Score: 1

      You're inferring things I didn't write. Let me be more clear.

      I do not believe in evolution, and I ALSO do not believe in any other mechanisms having to do with life.

      Furthermore, I don't believe in any mechanisms explaining how the earth was created, or any mechanisms that explain how the universe was created.

      I don't believe that any mechanism that explains these things is good. They're all lacking in the supporting facts department. I'm willing to accept one of them. But they're not ready yet.

      --
      Mod me down and I will become more powerful than you can possibly imagine!
    53. Re:Quick, call in the Hippie Power Squad by fireboy1919 · · Score: 1

      You're inferring things I didn't write. Let me be more clear.

      I do not believe in evolution, and I ALSO do not believe in any other mechanisms having to do with life.

      Furthermore, I don't believe in any mechanisms explaining how the earth was created, or any mechanisms that explain how the universe was created.

      I don't believe that any mechanism that explains these things is good. All the theories I've ever read on any of these subjects are lacking in the supporting facts department. They're just not ready yet.

      --
      Mod me down and I will become more powerful than you can possibly imagine!
    54. Re:Quick, call in the Hippie Power Squad by fireboy1919 · · Score: 1

      I would assume, then, that you have some sort of alternate theory.

      No. Lack of alternatives is not sufficient to select an inferior theory. You have the option of saying, "I don't know." This is my choice.

      Do you not realize that more-or-less all of modern Biology is based on Evolution? That the technology used to create antibiotic and antiviral drugs is based wholly on the theory of Evolution?

      I disagree. Modern antibiotic and antiviral developments are based upon natural selection. Certain limited traits can be developed by breeding to be more advantageous for people. This is one of the first technlogies developed by man and is a well established fact.

      I don't believe that you can extrapolate all of evolutionary theory from this. The probabilities of changes in complexity using randomness in cell mutation are not high enough for me to accept improvement by this means. I am very intersted to know about the key points - like how a single celled organism could suddenly become multicelled. There needs to be something else as part of the theory that helps introduce order to change my mind.

      Biologists have been directly observing evolution in action for decades.

      To my knowledge this is untrue. They've seen natural selection. They've seen characteristics that are designed to allow mutation among a specific selection of possible states change states. I've told that I don't agree and why. Your next step, should you choose to take it, will be to supply supporting arguments that show why I'm wrong. Merely claiming that I'm wrong is just yelling.

      If that alternative is, as I would imagine if you are an evangelical Christian, some form of creationism, there is a large difference between that and a scientific theory like Evolution. In science, there is the requirement--in order for something to be considered a natural explanation--that it be disprovable.

      I've heard this old chestnut time and again. Didn't I say I don't accept any explaination for how anything began yet? I don't think that "it's not a real scientific theory" is sufficient for me to reject alternatives as false any more than its a reason to accept one as true.

      In reality, there are a lot of things that we operate with without the benefit of rigorous science. I continue to accept, for example, that time will continue to function as it has despite the fact that the human race has almost no idea why this has continued to be true - other than overwelming number of times that it has done so. I think that if a big, booming voice saying, "I made the Earth and everything on it through spontaneous creation. Now I'm making some unicorns" was suddenly heard by every man, woman and child on earth, and this was followed by unicorns suddenly popping into existence right in front of millions of witnesses, then I'd forsake the disprovable theory in favor of spontaneous creation.

      Similarly, if a scientist in a lab figured out a way to make a puppy out of nothing but some amoebas, and then told everyone that he used evolutionary processes to do it, I'd be totally convinced that evolution is how it all works.

      Either case means we've got a theory that's been tested and works in at least one specific case. One case takes a lot less of a leap of faith than no cases at all. Right now we've only got ideas that have no direct evidence - only lots of indirect evidence. I haven't gotten my puppy or my unicorn.

      --
      Mod me down and I will become more powerful than you can possibly imagine!
    55. Re:Quick, call in the Hippie Power Squad by Tanuki64 · · Score: 1

      So anyone less scientifically educated than you (for instance, liberal arts majors) deserves to be made into food?
      Thought that someone would choke on that. :-)

      But to answer your question, it does not have to do with scientific education, but more with a frame of mind. None needs to be able to calculate the hydrogen atom or needs to be able to explain the difference between a boson and a fermion. But, let me give you an exaggerated example to make clear what I mean. If someone still believes in the earth being flat because the bible says so (it doesn't but suppose it does for the sake of the example) , even if you show him photos of a round earth taken from the moon, I refuse to regard someone like this as my equal. I am something better. Of course, the food stuff was a provocation, I would be totally content to have those as slaves. ;-)
    56. Re:Quick, call in the Hippie Power Squad by houghi · · Score: 1

      Those people will not just be ignorant about science. They will be ignorant about other things as well. Those are the people who will vote.

      Education is the best way to stop ignorance. It feels as if certain politicians understand this and try to produce ignorant people, so they will have more votes in the future.

      --
      Don't fight for your country, if your country does not fight for you.
    57. Re:Quick, call in the Hippie Power Squad by houghi · · Score: 1

      Not entirely true. You have three groups, not two.
      The scientists, who do all the work on the science side
      The teologist, who do all the work on the non-science side.
      The polulation, that is looking at who they believe more.

      Both of the first groups take up a LOT of time, efford and money. look at the time and efford that went into religion in history in the last 6000 years or so (or forever). look into the amounts that go into getting either new believers or keeping those that you already have.

      I have no worldwide figures on how much is invested in religion and how much in science, altough it would be nice to see those next to each other. And I mean science, not research and development, although I understand that it might be hard to make the difference sometimes.

      --
      Don't fight for your country, if your country does not fight for you.
    58. Re:Quick, call in the Hippie Power Squad by The+One+and+Only · · Score: 1

      Skepticism is healthy, but it can't be applied to literally everything or society couldn't function.

      Prove it.

      --
      In Repressive Burma, it's not just your connection that dies. slashdot.org/comments.pl?sid=314547&cid=20819199
    59. Re:Quick, call in the Hippie Power Squad by Tanuki64 · · Score: 1

      Both of the first groups take up a LOT of time, efford and money.
      True, but one group spends a LOT of time, effort and money into public relations and indoctrination, the other spends huge amount of time, effort and money more or less invisibly. Same thing why loudmouthed managers get all the money, while quit technicians in some back corner do all the work and are laughed at.
    60. Re:Quick, call in the Hippie Power Squad by The+One+and+Only · · Score: 1

      or the person of Faith who challenges everything

      A logical impossibility. Faith is the willful choice not to challenge a given belief, but rather, to accept it literally without reason.

      --
      In Repressive Burma, it's not just your connection that dies. slashdot.org/comments.pl?sid=314547&cid=20819199
    61. Re:Quick, call in the Hippie Power Squad by pla · · Score: 1

      Teaching people evolution isn't going to magically stop them from being religious, so your comment is utterly off-topic.

      No, "utterly off-topic" would involve my talking about the best brand of compressor oil to use in a thread about evolution. My comment, while you may disagree with it, fell quite on-topic.



      I hate to burst your bubble, but a great many people, who are infinitely smarter than you could possibly be, were devout religious believers.

      Right! And why did they hold such absurd beliefs? Because their culture ingrained those ideas from before they had the rational capacity to reject them as laughable.

      That behavior I meant to direct my comment toward - Indoctrination of the helpless. We claim to do "anything for the children", yet before they ever make it to pre-school, their parents have already poisoned their minds with fantasies of silver cities in the clouds, of a magical Santa-like being who knows if you've behaved naughty or nice, and either gives you presents (an afterlife in paradise) or coal (a lake of fire).

      Now, I really don't care what people "believe". I myself admitted to believing in a creator. But when your beliefs prevent me from having a cloned organ-donor, we've encountered a situation in need of remedy.

      "Well there son, you have a disease called Huntington's Chorea. In the few decades you have before it kills you, science could probably cure it. But, that would make the baby Jesus cry, so, just make the best of it and thank Allah for letting you live to 40 - unless he strikes you down before then."

      Sick, sick, sick!

    62. Re:Quick, call in the Hippie Power Squad by Garse+Janacek · · Score: 1

      Skepticism is healthy, but it can't be applied to literally everything or society couldn't function.
      Prove it.

      Prove I haven't already :-D

      --

      I am the man with no sig!

    63. Re:Quick, call in the Hippie Power Squad by siegesama · · Score: 1

      You've made up a bunch of shit in your head again, and are responding to it as though it actually happened. Your entire post is a non-sequitor.

      --
      what the hell is a 'junk character', anyway?
    64. Re:Quick, call in the Hippie Power Squad by Harin_Teb · · Score: 1

      "We know that from the fossil record and from continuing observations"

      - not entirely true. we can hypothesize from the fossil record and we can prove micro-evolution (ie intraspecies evolution) Science has never observed and thus has never PROVEN the existence of a species jump as would be required to prove the theory of Macro-evolution...

      a little nit-picky but it is a BIG point because the theory of evolution requires species jumps, and the only thing the fossil record can possibly PROVE is that there used to be a species with this particular bone configuration...

    65. Re:Quick, call in the Hippie Power Squad by Anonymous Coward · · Score: 2, Insightful

      "not entirely true. we can hypothesize from the fossil record and we can prove micro-evolution (ie intraspecies evolution) Science has never observed and thus has never PROVEN the existence of a species jump as would be required to prove the theory of Macro-evolution..."

      Entirely true. Speciation has been observed in the lab and in the wild many times. A quick glance at pubmed will quickly turn up many articles showing speciation events.

      Second, we don't prove theories in science, we disprove them. It's been over 150 years and nobody's done so much as put a dent in evolution, but the evidence in support keeps piling up.

      Third, there is no known barrier between microevolution and macroevolution. In nature what constitutes a species is not always clear, so neither is where microevolution ends and macroevolution begins.

    66. Re:Quick, call in the Hippie Power Squad by geordieboy · · Score: 1

      Could you elaborate on exactly what it was that changed your mind? Were you one the of the camp that accepts "microevolution" but posits some magical barrier to species level "macroevolution" (the barrier being "irreducible complexity" perhaps)? Was there an 'aha' moment or was it a gradual accumulation of information that lead you to reject creationism? Was your error a logical fallacy or a lack of knowledge? It'd be interesting to find out what the process was, since this might shed some light on how to enlighten the intelligent but as-yet-unconverted creationists out there.

      --
      The world is everything that is the case
    67. Re:Quick, call in the Hippie Power Squad by Anonymous Coward · · Score: 0

      That doesn't mean he wouldn't have accomplished anything had he not gone to church. Giving an example of a good religious person is just as a bad as naming supposed atheists who were bad.

    68. Re:Quick, call in the Hippie Power Squad by mattsucks · · Score: 1

      Come on, who cares? Let people be ignorant. It's not like bringing people of below average intelligence or fundamentalist mindset into the scientific fold is going to make them valuable contributors. It'll just be a new type of ignorance to deal with. Let them be.
      That would be all fine and well except for one thing: they're reproducing....and at a higher rate than those of us who value science. And those people and their progeny will vote.

      Gee, sounds like evolution in action to me :-)
    69. Re:Quick, call in the Hippie Power Squad by RespekMyAthorati · · Score: 1

      Evolution isn't an explanation for the origin of the universe. It's not really an explanation for the origin of life, either. It's the scientific model that explains the history and diversity of life on Earth by means of mechanisms like random mutation and natural selection.


      Actually, it includes all of that, and more.
      And where did you get that from?
      I'll bet it came from some preacher who wouldn't know a scientific therory if he tripped over it.
      You certainly didn't get that from a biologist, or anyone else who actually knows anything about evolution.
    70. Re:Quick, call in the Hippie Power Squad by evilviper · · Score: 1

      And where did you get that from?

      Two years of biology.

      Evolution doesn't quite cover the very first proteins assembling, however, it applies 100% from that point on.
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
    71. Re:Quick, call in the Hippie Power Squad by crashfrog · · Score: 1

      Evolution doesn't quite cover the very first proteins assembling, however, it applies 100% from that point on.

      That's exactly what I said. You replied in such a way that it seemed like you were implying that evolution does cover the formation of the universe and the origins of life; that's why you were asked where you got such crazy ideas. Creationists are the ones who typically suggest that evolution is the explanation for everything.

      I'd suggest you be a little more careful.

      --
      I never have frustrations, the reason is, to wit:
      If at first I don't succeed, I quit!
    72. Re:Quick, call in the Hippie Power Squad by Alsee · · Score: 1

      How can you be so sure?

      I have looked at the evidence. I have spent quite a lot of time looking at the evidence. I have understood the evidence. I have looked at the arguments against it. I have found errors and misunderstandings... quite often insanely laughable errors and misunderstandings... in all all of the arguments against.

      But most importantly I have run my own experiments. I understand mathematically how and why evolution works. Mathematicians have studied and proven this. I have run my own experiments and personally witnessed the fact that the evolution process CAN and in fact DOES spontaneously create complexity and new information.

      According to Newsweek magazine figures, there are approximately 480,000 degreed earth and life scientists in the US on the "pro-evolution" side and approximately 700 against. That is not a scientific controversy. That is every degreed professional in a wide range of fields against a handful of crackpots. That is about 99.85% against ZERO.15%. That is approximately 685 to 1. That is the Flat Earth Society.

      If you had the impression that there was was any division among PhD biologists over evolution... if you had the impression that it was anything less than 99.8% of PhD biologists... then someone has given you false or misleading information.

      assumption appears to be that these people can't possibly hold one wrong view yet also do anything else right. Rejecting evolution makes you a gibbering idiot who is unable to govern your own life and hates science?

      I agree with you there. Most people have little to no education in the subject, and they have absolutely no need to know anything about the subject. It is pretty much just in the United States that there is this widespread misinformation that there is ANY genuine controversy withing science over evolution. It is pretty much just in the United States that there is this this widespread misinformation that the evidence for evolution is lacking or nonexistent. There are millions and millions of perfectly intelligent rational people haven't looked at it closely and haven't gotten good information on the subject, and in general they don't have any particular need to. Across the country our highschools have been supplying everyone with a dismal-to-nonexistent education in the subject... schools that neglect the subject just to avoid the hassle of some ignorant troll throwing a hissyfit over it. And the media hasn't been much help either... what with the routine practice of picking a controversy and digging up one troll to represent one side and grabbing pretty much any handy scientist to represent the other side. It's like taking the psychotic president of the Flat Earth Society and any one rational person to represent the "other side". Taking the psychotic president of the Flat Earth Society and presenting him as a reasonable legitimate equal position with equal respect and equal time to a PhD Nobel prize winning physicist... and presenting it as a reasonable genuine debate between two reasonable equal sides in a debate... that is wildly misleading.

      But I can explain why there is a fairly common attitude or implication that people doubting or rejecting evolution are "gibbering idiots". The reason is that must such people don't know much about evolution and don't care much about evolution and don't get into passionate insane arguments desperately trying to shoot down evolution. Whenever one comes across someone actually bothering and motivated to work up a big argument over evolution... that is not the average person who doubts evolution but doesn't know or care much about it. Whenever you come across a big argument over evolution it is almost inevitable a passionate ill-informed gibbering idiot... someone who is passionately motivated to distort and subvert their own rational capacity in a desperate effort to reach the result they want to reach.

      I swear to God, I can't tell you how many times I have run into people who ADMIT I have shown their argument flaw and

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    73. Re:Quick, call in the Hippie Power Squad by Garse+Janacek · · Score: 1

      Hmm, I didn't notice this when you posted it, but maybe you'll still see my reply...

      Yes, basically I accepted microevolution but not macroevolution. My objection wasn't so much irreducible complexity, though (at least, not by around college age when I'd thought things through more) -- in fact, long before I changed my mind I was pretty disturbed by "creation science" or "intelligent design" or whatever the latest name is, since it was clear to me that the leaders of these movements were being completely unscientific, and were duping a lot of people who didn't know any better by fraudulently claiming authority they didn't have. (I was creationist myself, but didn't claim it was "science" -- it was just what I believed had happened.)

      Primarily, I think my error was lack of knowledge, though I'm sure you could point to many logical fallacies that supported the main error -- but my central objection was that evolution is not falsifiable. There were various other smaller issues that I objected to, but less emphatically: no one had ever been able to justify for me the central premise of carbon dating, for example (they still haven't, actually, but having passed the main hurdle of falsifiability I'm willing to largely accept that "on faith").

      I think the actual catalyst for changing my mind was probably 29+ Evidences for Macroevolution, which is a wonderful site -- it's completely (and, I think, deliberately) non-hostile towards religion in general and creationists in particular, it just clearly states the central evidence for common descent. It gave a lot of evidence, especially the wonderful results from genetic analysis, that I had never heard of before, and that really didn't mesh with my "evolution isn't falsifiable" claims up to that point. If there was an 'aha' moment it came from this site, though it still took a while for me to think things over.

      A big thing feeding this whole conflict is that many of the leaders on both sides have completely ascientific agendas. A huge hangup for most creationists is, quite obviously, that they can't reconcile evolution with their understanding of Christianity or the Bible or what have you. Now, most major Christian groups have worked past this (both the [last few] Pope[s] and the Archbishop of Canterbury have explicitly said not just that there's nothing wrong with evolution, but that it is probably substantially true... I don't know if other large denominations have stated it as explicitly, but for the most part they think evolution is fine). In fact, religious objections to evolution are mostly a phenomenon of American fundamentalists and evangelicals, and other closely allied groups. Having been raised evangelical, though, I wasn't even aware that most (global) Christians didn't think the same way.

      A huge issue here is: what many creationists need to hear, in order to be more open-minded and objective about the debate, is "Evolution doesn't need to conflict with your faith. You can believe in God and the Bible and still believe in evolution." They might not believe this, at least not the first few times they hear it, but this is a hugely important message to get across. Having come out of this culture, I can assure you that if these people are forced to choose between their faith (which for many of them is the defining aspect of their life) and evolution, there is no choice there. They'd be throwing out their faith, alienating themselves from their friends and their culture and their upbringing, removing the meaning from their lives, and all they'd get in return is abstract agreement with some scientists they'll probably never meet, and many of whom probably still think they're stupid anyway. But of course, all of these things are by no means necessary consequences of belief in evolution.

      On the flip side, though, this assurance they need, that belief in evolution need not invalidate their entire lives, is exactly what many advocates of evol

      --

      I am the man with no sig!

  4. This is Exciting News by ReidMaynard · · Score: 5, Funny

    I'm keeping a close eye on my neighbor's 911 Turbo with the I Love Jesus bumber sticker. The minute The Rapture hits, that baby is mine!

    --
    -- www.globaltics.net

    Political discussion for a new world

    1. Re:This is Exciting News by Anonymous Coward · · Score: 1, Funny

      If only that 911 Turbo could outrun the legions of demons awaiting to torture you post-rapture...

    2. Re:This is Exciting News by at_slashdot · · Score: 1

      An idea... if somebody disappears can you claim in justice that The Rapture just happened? Not that I have any murderous ideas, but I'm interested how those claims work... personally I don't think that would work and I think it would be a pretty clear sign that people know that's complete bullshit.

      Hypothetically if Jesus returns (not that I believe he could) he would be interned in the first insane asylum.

      --
      "It is our choices, Harry, that show what we truly are, far more than our abilities." -- Prof. Dumbledore
    3. Re:This is Exciting News by SatanicPuppy · · Score: 1

      Well, theoretically, if rational thought breaks down, then why not? They won't have the intellectual toolkit to disbelieve a notion that they're predisposed to believe in.

      I just find the whole thing kinda depressing. There are some damn stupid people in this country, that's always been obvious. But close to half? That sucks.

      --
      ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
    4. Re:This is Exciting News by at_slashdot · · Score: 1

      Well... be happy that you are in the good half ;)

      --
      "It is our choices, Harry, that show what we truly are, far more than our abilities." -- Prof. Dumbledore
    5. Re:This is Exciting News by Anonymous Coward · · Score: 0

      QFT

    6. Re:This is Exciting News by guhknew · · Score: 1

      Well, you have the people who are above average and those who are below average.

    7. Re:This is Exciting News by atrocious+cowpat · · Score: 1

      "I'm keeping a close eye on my neighbor's 911 Turbo with the I Love Jesus bumber sticker. The minute The Rapture hits, that baby is mine!"
      Funny thing is: He'd probably be perfectly OK with this arrangement. Maybe you two should have chat the other day so he can prime you on the quirks and needs of the car.
      --
      sig? Oh, that sig...
    8. Re:This is Exciting News by SatanicPuppy · · Score: 1

      Well, sure, but I don't think it takes a lot of brains to say, "Well this guy's got hair like a used car salesman, and acts like a bit of a freak, and he says evolution's wrong, and I'm going to hell if I don't give him all my savings...And this guy's a doctor that came up with a cancer drug that saved my momma's life, and he's says evolution's right, I guess I'm going to go with the guy who actually DOES things."

      Seriously. To me it's a no-brainer. This isn't some country where there isn't evidence of science everywhere...How damn dumb do you have to be to decide that all that stuff is perfectly logical...except when it comes to evolution.

      --
      ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
    9. Re:This is Exciting News by bky1701 · · Score: 1

      When you have the choice of demons vs. fundamentalists, the car can be the deciding factor of rapture'in vs. not...

    10. Re:This is Exciting News by tim620 · · Score: 1
      Why is it that creationist are considered "stupid"? I know a number of highly intelligent people who are creationists. Most fully understand evolution, how it works and have read Darwin's "Origin of Species". They just choose not to believe it. That doesn't make them "stupid".

      I fully understand the reasons Bush went to war with Iraq. That doesn't mean I have to believe in or support his war.

    11. Re:This is Exciting News by Anonymous Coward · · Score: 0

      .... because if you did, you would be stupid:)

    12. Re:This is Exciting News by rohan972 · · Score: 1

      Well, sure, but I don't think it takes a lot of brains to say, "Well this guy's got hair like a used car salesman, and acts like a bit of a freak, and he says evolution's wrong, and I'm going to hell if I don't give him all my savings...And this guy's a doctor that came up with a cancer drug that saved my momma's life, and he's says evolution's right, I guess I'm going to go with the guy who actually DOES things."

      The problem with that being that I know people for example that have been told by a doctor that they can't have children, the preacher prays for them, and later they have children. (Also also know people who skipped the preacher praying step). Yes, yes, I know there could be jokes about what else that praying the preacher might have done, but seriously, there are plenty of people who have experienced benefits from listening to preaching, even if they are not benefits exclusively available to Christians. One obvious example is in drug rehab, which very often has a strong religious theme. People who have gone from being addicts to having an enjoyable life through faith, or who have close relatives/freinds who have done so, are unlikely to regard a preacher as not "doing things" or producing results.

    13. Re:This is Exciting News by SatanicPuppy · · Score: 1

      To be a pure creationist, you have to be willing to ignore the mountains of evidence that suggest that the earth is substantially older than the bible states, and all the evidence suggests that the creatures who exist on the earth started as very simple life forms and, over millions of years, evolved into the life forms we see today.

      There are branches of christianity that are fine with evolution and the fact that the earth is older than the bible suggests...I would consider them to be "smart" creationists, because they understand that evolution and all that jazz are not incompatible with god, but only with a very strict read of a very old book.

      All the other ones, who think that the world is 6000 years old and everythign on it was created in it's current form? Stupid.

      --
      ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
  5. which farm animal represents 48% of america? by CapsLock343 · · Score: 0, Troll

    sheep...

    1. Re:which farm animal represents 48% of america? by salparadyse · · Score: 1

      Unfortunately for that argument, scripture says a lot about sheep, most of it positive and encouraging - My sheep hear My voice, I am the good shepherd, and He separates the sheep from the goats etc

      To accuse a Christian of being a sheep is not an insult.

    2. Re:which farm animal represents 48% of america? by grammar+fascist · · Score: 5, Insightful

      Everyone's a sheep. Modern neuroscience pretty much confirms that most of us run on autopilot most of the time. The real question is, who's your shepherd?

      I think the average Slashdotter mostly agrees with Jesus about this. The difference is, the average Slashdotter believes that he's not a sheep, and sees this as insulting. Well, reality check. You are. But who's your shepherd? If there's a single most important decision you can make in your life, it's this. Is it Jesus? Mohammad? Richard Stallman? Pamela Jones? Jimmy Carter? Al Gore? Brad Pitt? Your parents? A good friend? A friendly and knowledgeable professor at school?

      A little bit back on topic, is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?

      --
      I got my Linux laptop at System76.
    3. Re:which farm animal represents 48% of america? by 42Penguins · · Score: 1

      Most have not seen any proof of it.
      Most have an extremely difficult time understanding or explaining it.
      About half the people believe in it, and the other half are quite hostile.

      Is "it" evolution, or God?
      I think it takes about the same amount of faith, whether it's some powerful man in the sky or some incredibly slow, yet constantly happening biological process.

    4. Re:which farm animal represents 48% of america? by Sockatume · · Score: 1

      You say that as though all sheep have shepherds. However, as you say, we run on autopilot most of the time: we have no pilot, or shepherd, or whatever. It's rather patronising to assume we each follow a single leader in making our decisions.

      --
      No kidding!!! What do you say at this point?
    5. Re:which farm animal represents 48% of america? by Sockatume · · Score: 1

      Actually, scratch all but the final sentence of that. Don't drink and post, folks, you wind up with word salad.

      --
      No kidding!!! What do you say at this point?
    6. Re:which farm animal represents 48% of america? by Anonymous Coward · · Score: 0

      My shepherd is Cowboy Neal, you insensitive clod!

    7. Re:which farm animal represents 48% of america? by Bin+Naden · · Score: 3, Insightful

      A little bit back on topic, is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?

      I disagree. The best intelligence litmus test is to be skeptic and never accept everything as the complete unquestionable truth. The way I see it, the creationists have about 0.000001% chance of being completely right, the evolutionists have about a 30% chance of being completely right. The complete truth is probably either a slight modification of the evolution theory or a completely different concept that either no one has ever thought of, or that no one is capable of thinking of.

      --
      There should be a "-1:Groupthink"
    8. Re:which farm animal represents 48% of america? by misanthrope101 · · Score: 4, Insightful

      But who's your shepherd?
      When religion builds an airplane, I'll buy into your figures of speech. Until then, I'm down with science. It works.

      A little bit back on topic, is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?
      It hasn't. The issue is that "skepticism" towards the theory of evolution is emblematic of a rejection of science itself. This rejection of science takes place within a context of all the technology, medicine, and other wonders that the scientific method has produced. This all-out denial of the obvious fact that the scientific worldview is useful, productive, and beneficial does tend to call these people's intelligence into question. If they aren't stupid, what are they?

      I read a comment on Slashdot just a few days ago (really wish I had bookmarked it, since I'd love to read it again) where the poster mentioned evolution, the Y2K bug, avian flu, and said "science just has no credibility left." I wanted to say "so I guess you won't be using medicine, driving in cars, or POSTING ON THE INTERNET anymore...?" but I've said it before, and the absurdity of rejecting science while depending on it so heavily is just lost on these people.

    9. Re:which farm animal represents 48% of america? by NeoBeans · · Score: 1

      The way I see it, the creationists have about 0.000001% chance of being completely right, the evolutionists have about a 30% chance of being completely right.
      Of course, the probabilities you assign are derived from hard science, right?
    10. Re:which farm animal represents 48% of america? by zeroduck · · Score: 1

      Yes, but evolution you can read up about. You can study it in school, become involved in the research. It's all out there waiting for you to figure it out.

      Now the church route? Well... good luck on proving the existence of a supernatural being. Much less that it had a few spare days to create all this and leave behind the evidence of evolution we have now.

    11. Re:which farm animal represents 48% of america? by Anonymous Coward · · Score: 0

      Of course, the probabilities you assign are derived from hard science, right?
      I've seen as much proof to the existence of the Abrahamic god as I've seen proof of the existence of the Flying Spaghetti Monster. Meanwhile, I've seen much supporting evidence for evolution.

    12. Re:which farm animal represents 48% of america? by Anonymous Coward · · Score: 0

      Very well said!

    13. Re:which farm animal represents 48% of america? by VJ42 · · Score: 1

      is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence? Yes, despite my own belief in evolution, I also happen to be mildly (non-Christian) religious. I have to say that the zealotry and downright bigotry that some slashdotters have come out with appals me. But then, I don't live in a country where the subject is so politicised. Here in the UK, I don't know anyone, religious or otherwise, that believes in creationism. Perhaps if the subject was removed from the political arena the debate would be a little more rational.
      --
      If I have nothing to hide, you have no reason to search me
    14. Re:which farm animal represents 48% of america? by thryllkill · · Score: 1

      It's not faith, but accountability of those doing the teaching. On one hand we have scientists, who are undoubtedly smarter than I, whose motivation is learning how the world and universe work. On the other hand there are a multitude of un-named authors from thousands of years ago (several if you're talking old testament) whose motivation appears to be social control, and perpetuation of their own superiority over the common folk. Scientists tend to apply logic to their theories and then test them (over and over again) to verify or discredit the theory. While the biblical authors regurgitated the camp fire tales of illiterate desert nomads, with a edit or addition here and there to ensure they stayed in control.

      --

      Note to self: No more arguing with the faithful.

    15. Re:which farm animal represents 48% of america? by SpinyNorman · · Score: 3, Insightful

      is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?

      Why is it disturbing to define intelligence as having a modicum of knowledge and rational analysis capability?

      DNA + "survival of the fittest" = evolution. It's not a theory - it's just a plain consequence of the the tautology "survival of the fittest" and the fact that we're based on a naturally varying chemical hereditory mechanism (DNA). If you don't understand that people who have more children leave more descendents, or that we're based on DNA, then, YES, you are stupid.

    16. Re:which farm animal represents 48% of america? by professionalfurryele · · Score: 1

      "A little bit back on topic, is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?"

      I often tell my biologist friends that they are lucky that evolution came before a well developed theory of statistical mechanics. Evolution is a direct consequence of border line cast iron assumptions made in statistical mechanics. And statistical mechanics is so reliable no one questions it's assumptions. I wouldn't even call evolution a theory, it borders on a tautology because it is so obviously true. It isn't like Newtonian Gravity, or Quantum Mechanics, or even special relativity, it is unique. I say that as a physicists who wishes it was a physical theory rather than a biological one. Evolution is special in science because it is one of those theories that no matter what we discover we will always call the process of how life went from the single cell to it's current form evolution, unless the very foundations of science itself are destroyed. It borders on a mathematical proof because the assumptions made arriving at it are few and so well tested.

      That is why no one in science of any credibility questions the central tenets of evolutionary theory. That is why anyone who does not has their credibility questioned.

    17. Re:which farm animal represents 48% of america? by SpinyNorman · · Score: 2, Insightful

      Evolution can not be wrong. It's not a theory - it's just a plain fact.

      If your DNA causes you to have more children than me, then the DNA of our species has taken a step in the direction of your DNA rather than mine. If the DNA of species A group #1 has diverged from that of species A group #2 to the extent that they can't interbreed then (by definition) one of these groups is a new species.

      There may be additional subtleties to how evolution actually plays out (there's plenty of post-Darwin realizations such as that it's environmental change that drives punctuated equilibrium), but the mechanism itself can't be wrong - it's just plain fact. More children = more descendents with your DNA.

    18. Re:which farm animal represents 48% of america? by Bin+Naden · · Score: 1

      Evolution can not be wrong. It's not a theory - it's just a plain fact. If your DNA causes you to have more children than me, then the DNA of our species has taken a step in the direction of your DNA rather than mine. If the DNA of species A group #1 has diverged from that of species A group #2 to the extent that they can't interbreed then (by definition) one of these groups is a new species. There may be additional subtleties to how evolution actually plays out (there's plenty of post-Darwin realizations such as that it's environmental change that drives punctuated equilibrium), but the mechanism itself can't be wrong - it's just plain fact. More children = more descendents with your DNA.
      Actually, evolution is an interpretation of facts observed in nature and is thus a theory. All the data observed could conveivably be used to support another theory as to how life came to be the way it is. Also, such things as proof of http://www.sfgate.com/cgi-bin/article.cgi?f=/c/a/2 007/01/21/ING5LNJSBF1.DTL retrocausality could throw a curveball to evolutionism.

      --
      There should be a "-1:Groupthink"
    19. Re:which farm animal represents 48% of america? by nbritton · · Score: 1

      is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?

      Nope.
    20. Re:which farm animal represents 48% of america? by ScrewMaster · · Score: 1

      From a purely scientific perspective, the creationists (or Intelligent Designers or whatever their current name-of-the-month-so-people-won't-know-we're-creat ionists) are not so much right or wrong as they are irrelevant. That's why scientists have a hard time understanding what they're fighting, or that they need to fight at all. I mean, it's just so hard to take Creationists seriously because you don't really believe that rational human being would believe what they're saying. I mean, they have to be joking, right? No, they're not, they're dead serious. Now, I'm not entirely sure that all of them do believe ... there are other agendas at work here and that makes them even more dangerous.

      Science is all about modeling reality, and refining such models to more closely reflect what is to an increasing degree of accuracy. Consequently, no scientific theory is ever considered perfectly correct, only correct to within a certain probability ... but for many theories the margin of predictive error is so small that they are considered physical Law. Evolution and natural selection are in that category, regardless of what the creationists want you to believe. Is there a one hundred percent correspondence between current evolutionary theory and observable fact? No ... but there is zero correspondence between creationist "theory" and those same observations. Evolution wins on points alone. It's the best we have to date, it explains so much of what we know about how life changes over time. Will something better come along? Sure ... but like you said it will be a refinement of what we already know, and I guarantee that it won't involve a 10,000-year-old Earth or fossils placed here just to fool us. Creationists make the frequent mistake of assuming that what we know now is all that we will ever know.

      Scientists will accommodate religion to the point where religious beliefs conflict with reality. Many religions have reached the point where they will alter their dogma to accommodate new knowledge, whereas the creationist movement insists upon making a simple value judgement: we are right and science is wrong. They leave no room for compromise, and when you get right down to it, neither should we. What is, is.

      Contrary to what some would have us believe, ignorance is not bliss. It is downright dangerous, in fact, especially to the ignorant.

      --
      The higher the technology, the sharper that two-edged sword.
    21. Re:which farm animal represents 48% of america? by Panzergheist · · Score: 1

      Because the education level in one subject area does not indicate the overall intelligence of an individual. Especially an area as hotly debated as macroevolution, which most people uneducated in evolutionary theory will immediately associate with the word, evolution.

      Personally, I don't consider all those people stupid. I consider them to be poor biologists. However, if you want to define intelligence in the manner you did above, then by your own standards you're not so intelligent yourself. You certainly failed in your rational analysis of those who don't believe in evolution.

    22. Re:which farm animal represents 48% of america? by ffujita · · Score: 1

      >I've said it before, and the absurdity of rejecting science
      >while depending on it so heavily is just lost on these people.

      These people are rejecting science and depending on technology. Science := Technology.

    23. Re:which farm animal represents 48% of america? by qbwiz · · Score: 1

      Why can't I be my own shepherd? When I do think, I can make decisions that I will use when I'm on autopilot. I don't run out in front of cars all the time, because I've previously decided that that would be a bad idea. Why can't I do the same with my beliefs?

      --
      Ewige Blumenkraft.
    24. Re:which farm animal represents 48% of america? by Scrameustache · · Score: 1

      Everyone's a sheep. [...]
      A little bit back on topic, is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence? 1- No, some people are sheep, some people are weasles, some are pigs, etc.
      You might be a sheep, but I'm a platypus.

      2- 'Is evolution well-supported by evidence and widely accepted within the scientific community?'

      Well supported, widely accepted, unwavering belief... yeah, those are the same.
      --

      You can't take the sky from me...

    25. Re:which farm animal represents 48% of america? by tonigonenstein · · Score: 1

      Until then, I'm down with science. It works.
      You're not alone: http://xkcd.com/c54.html
      --
      The sooner you fall behind, the more time you have to catch up.
    26. Re:which farm animal represents 48% of america? by Anonymous Coward · · Score: 0

      (For information, I am an atheist, working in CS. Creationism is bull. Long live to FSM)

      > This all-out denial of the obvious fact that the scientific worldview is useful, productive, and beneficial does tend to call these people's intelligence into question.

      I was with you until the word "beneficial". Can you explain how pollution, nuclear weapons, economic war, natural resource exhaustion and global warming are beneficial ?

      Science work, no doubt about that. But blindly saying that it is "beneficial" may be a bit overreaching...

    27. Re:which farm animal represents 48% of america? by RobBebop · · Score: 1

      I agree with you about the benefits of the scientific method, invention, and other things that advance society, but I want to play devil's advocate.

      Modern Meds, cars, and the internet... science or business?

      During the Black Plague... using science to cure the disease was crucial for survival. These days we have medical companies being accused of the life-long treatment of disease instead of actually finding a cure. These days, it seems everyone worships the power of the holy "buck".

      And here's a different tangent...

      The internet? Yes, the original Arpanet was a magnificient development - but what it evolved into (the internet) is ubiquitous. My guess would be the 75% of the users of the internet don't even know what Arpanet was (and that is was created as a weapon during the Cold War).

      Then again... this article is about how half the country doesn't believe in evolution, so how could Arpanet evolve into the internet?

      We've always been at war with East Asia and the internet has always allowed us to post our ignorances to the world.

      ===

      Sorry for jumping around and not staying on topic. I had two different points to make, and couldn't find a good transition.

      --
      Support the 30 Hour Work Week!!!
    28. Re:which farm animal represents 48% of america? by griffenjam · · Score: 1

      "is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?"

      Not really, mostly because I've never encountered this. In the world of science, you know...*real* science, unwavering belief is generally looked down upon. If you can bring actual reasons to the table to call evolution into question people will generally listen to them, and I think that the crowd that believes in evolution has been more than accommodating when it comes to listening to cock and bull crackpot refutations of evolution (no matter how long you shake a box of electrical components you'll never get a radio to fall out...) However when it comes down to it I've never once heard a real reason that evolution can't exist. Keep in mind that God may well have created everything and evolution can still be possible. So, in conclusion the litmus test you describe really only applies to people that argue non-reasons for why evolution can't work, people that have no idea what they're talking about and talk as if they've studied the subject and have come to solid conclusions.

    29. Re:which farm animal represents 48% of america? by ScrewMaster · · Score: 1

      Can you explain how modern communications, transportation, efficient industrial processes, satellites, computers, medicines, vaccines and treatments, the whole litany of technological accomplishments borne directly from scientific research are not beneficial? Your argument seems to be that since the application of our newfound understanding is sometimes flawed that the scientific process itself is somehow deficient. Or should we simply suppress any research results that might have negative application? Many have suggested that, but the problem is that a. you can't always tell and b. it might go both ways. Usually it does, and usually any applications are far more positive than negative. Otherwise we'd have discarded the scientific method a long time ago and tried something else.

      Put it this way: the scientific method is nothing more than a way to figure out how the Universe works. That's it, that's all it is, all it ever meant to be. Science is the only pattern of thought the human race has ever invented (and we've tried a bunch!) that reliably determines fact from fiction. Some people perceive that as a threat, for reasons that only make sense if you wish to promulgate ignorance. As a civilization, we need that ability or all of the problems we are facing will never be solved because we'll all be dead. That's enough benefit to convince me, anyway.

      It sounds like you are concerned about the applications of such knowledge. And that's fine, because there are a number of legitimate complaints that can be lodged against corporate and government misuse of scientific research. That is not a problem with science, however ... it is a problem with people. Science is a tool, nothing more, and it's people that use (or misuse) their tools.

      --
      The higher the technology, the sharper that two-edged sword.
    30. Re:which farm animal represents 48% of america? by glwtta · · Score: 1

      Jesus is the only one on that list who fits his description of "shepherd" (Mohammad was merely a prophet and teacher, the rest are of course jokes). It's no great trick to assume the Christian world-view and then show that Christianity fits it best.

      People are sheep, most of the time, but we also have those few flashes of non-sheepdom when we notice that our (human) shepherds are stepping outside of what our personal overriding principles dictate. For many religious people those principles are dogmatic, for the secular minded they are based in reason and ethics.

      A little bit back on topic, is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?

      I certainly would be, if it did, but it hasn't come to that. Many of these polls are poorly worded, and miss a lot of nuance, but they have been very consistent in showing that those who reject the concept of evolution entirely, do so in favor of creationism, not some other scientific theory.

      When the options are:
      (A) Evolution
      (B) Creationism
      (C) Both
      (D) Other

      almost no one chooses D (the popularity of the other ones is usually: B, then C, then A).

      Calling the acceptance of evolution as the best supported theory a "belief" is the old tactic of repeating a strawman ad nauseam, in the hopes that people get tired of denying it every single time (kinda like calling atheism a religion).

      --
      sic transit gloria mundi
    31. Re:which farm animal represents 48% of america? by adrianmonk · · Score: 1

      Why is it disturbing to define intelligence as having a modicum of knowledge and rational analysis capability?

      It's disturbing because you're defining intelligence in terms of whether someone accepts materialism and empiricism as the canonical, and only correct, avenue to gaining knowledge. It's almost as if you have never even heard of epistemology, and yet you're ready to call anyone dumb who has a different epistemological stance than you.

      I am not impressed with the idea that all religious people are dumb, or that all people who reject evolution are dumb. My uncle was a Baptist minister and fairly fundamentalist in his beliefs, yet he had multiple graduate degrees in various subjects, played the organ well enough to participate in the occasional recital, was an avid reader, was a pretty good chess player (better than me, at least), and was virtually invincible at Trivial Pursuit. There are other people like that. To believe that all religious people or all creationists are dumb is itself to ignore the facts, ironically.

    32. Re:which farm animal represents 48% of america? by ScrewMaster · · Score: 1

      My guess would be the 75% of the users of the internet don't even know what Arpanet was (and that is was created as a weapon during the Cold War).

      Probably way less than that. But ARPANET was primarily a way for researchers to share supercomputer power and research (and by no means was all of that used for military purposes) and as a part of the military's CCC structure. Really not a weapon per se, just an enhanced communications medium, and the benefits to the scientific community were legion long before it turned into the advertising medium now known as "The Internet".

      Generally, when I can't find a good segue, I simply fall back on John Cleese's "And now for something completely different."

      --
      The higher the technology, the sharper that two-edged sword.
    33. Re:which farm animal represents 48% of america? by sc0p3 · · Score: 1

      very insightful. I am curious though, what is your religious bais?

    34. Re:which farm animal represents 48% of america? by glwtta · · Score: 1

      The issue is that "skepticism" towards the theory of evolution is emblematic of a rejection of science itself.

      That person does not speak for most scientifically inclined people.

      I can guarantee that as long as I live I will never assign a negative connotation to the word "skepticism" (I am of course going strictly by its Greek origin "skeptomai" - "to examine, consider").

      --
      sic transit gloria mundi
    35. Re:which farm animal represents 48% of america? by Anonymous Coward · · Score: 0

      "But who's your shepherd? If there's a single most important decision you can make in your life, it's this. Is it Jesus? Mohammad? Richard Stallman? Pamela Jones? Jimmy Carter? Al Gore? Brad Pitt? Your parents? A good friend? A friendly and knowledgeable professor at school?"
      Considering that all those entities are figments of my imaginiation, I choose myself.
    36. Re:which farm animal represents 48% of america? by Anonymous Coward · · Score: 0

      furthermore evolution (and evolution is a fact. evolution can be defined as the change of alleles over time) does not "destroy" believe

      you can be a scientist and believe in god. but you dont have to.

      science is knowledge. religion is believe.

      science != religion

      dont mix it and dont abuse religion or science for politics. (yeah I talk with you bush, osama bin laden and all the other assholes in the whole world)

    37. Re:which farm animal represents 48% of america? by NeoBeans · · Score: 1
      Naturally, the Anonymous Coward deleted the context of my response, so let me restore it:

      The way I see it, the creationists have about 0.000001% chance of being completely right, the evolutionists have about a 30% chance of being completely right.

      To which I said:

      Of course, the probabilities you assign are derived from hard science, right?

      Which then caused this rant:

      I've seen as much proof to the existence of the Abrahamic god as I've seen proof of the existence of the Flying Spaghetti Monster. Meanwhile, I've seen much supporting evidence for evolution.

      Which of course is based on even harder science.

      Let's not turn Darwinism in to a new religion with its own close-minded zealots -- but if you're going to make claims, then don't be like your "opponents" -- back it up with science.

      If you can't, don't just fall in to an apoplectic rage and begin spouting about how everyone else is wrong. You'll start to sound like one of those fundamentalists, with the only difference that you've got a poster of Darwin and an evolution fish on your car.

      At this rate, with all the vitriol on this topic, it's only a matter of time before followers of the Flying Spaghetti Monster start beheading hostages... :-)

    38. Re:which farm animal represents 48% of america? by couchslug · · Score: 1

      "the absurdity of rejecting science while depending on it so heavily is just lost on these people."

      Their contemptible level of superstition is armor against logic.

      What this tells us is that in order to make headway against them, we need to relentlessly attack their nonsense with even more logic and evidence. This is not to convince the religious, who are only fit to be ruled the the Karl Roves of the world, but to sow resistance among the young and the freethinkers who are not American Taliban. Every person we can encourage to doubt religion is a small victory.

      We can't change the ignorant masses, but the people who embrace science and technology are often in position to influence and rule lesser humans.
      We shouldn't scorn what NeoCons do with the mob. We should learn from it.

      --
      "This post is an artistic work of fiction and falsehood. Only a fool would take anything posted here as fact."
    39. Re:which farm animal represents 48% of america? by CannonballHead · · Score: 1

      Ah, but there's a difference between what we see survival of the fittest as (sure, it exists amidst various breeds of animals) and animals actually creating new genetic material... as in, gaining systems of whatever, through many small modifications.

      How evolution works itself does not seem to be a simple thing. Is it small tiny modifications (if so, then how would any small modifications last, since it'd just be extra random junk hanging around that does nothing), or is it more of a sudden one-generation-jump and you have eyesight, etc.

      Even in the theory itself, there are a lot of mechanics that I think everyone would have to simply say, "We don't know."

      Now my question is, why should evolutionists or creationists say that the other is stupid and unintelligent when both parties believe in things they can't prove? You can't prove, empirically, your mechanics of evolution, can you? We just recently had an article on the mechanics being rethought (well, the path the presumed mechanics took, anyways). So you're taking it sorta on faith (gasp, the evil word).

      (of course, we all know that the real measure of intelligence is whether or not they use linux... *bites tongue*)

    40. Re:which farm animal represents 48% of america? by SpinyNorman · · Score: 1

      Actually, evolution is an interpretation of facts observed in nature and is thus a theory.

      No... Evolution is just the word we use to describe hereditory systems that change due to "survival of the fittest". Applied to the evolution of species it was only a theory as long as it was based on a theorized heereditory mechanism... when that mechanism (DNA) was then discovered, it became a fact.

    41. Re:which farm animal represents 48% of america? by SpinyNorman · · Score: 1

      People compartmentalize, so it's not surprising to find people who are otherwise intelligent but don't accept evolution, but OTOH there comes a point where denial is a form of stupidity or abnormaility. What if I was a college graduate who didn't accept gravity, or didn't accept that we're all going to die? At what point do you say that despite the degree I'm stupid?

      People can have all the additional beliefs they want, but evolution (changing of species, creation of new species) is something that HAS to happen given that we're based on a changeable hereditory mechanism. Denying that the gene pool will change due to natural selection is like denying that the sea will come in.... I don't case how many degrees you have - that's just plain dumb.

    42. Re:which farm animal represents 48% of america? by SpinyNorman · · Score: 1

      You can't prove, empirically, your mechanics of evolution, can you?

      The mechanics of evolution is just DNA and genetic inheretence, so I'd say it's pretty well proved! ;-)

      Unless maybe you're denying that if I have more children that you then there'll be more copie of my DNA in our children's generation?

    43. Re:which farm animal represents 48% of america? by orkysoft · · Score: 1

      Actually, the evolution of complex organs has been researched for a long time now, and it has been found that yes, partial functionality (e.g. light-sensitive cells instead of a full-blown eye with retina and lens) is better than no functionality (no light sensitivity).

      --

      I suffer from attention surplus disorder.
    44. Re:which farm animal represents 48% of america? by servognome · · Score: 1

      When religion builds an airplane, I'll buy into your figures of speech. Until then, I'm down with science. It works.
      Science cannot define good and evil, only philosophy (of which religion is a subset) can do that. Things like Free speech, human rights, and privacy are philisophical ideas not scientific.
      I'm not religious, but I do recognize that science is not the end-all-be-all, it needs to be complimented by philosophy

      The issue is that "skepticism" towards the theory of evolution is emblematic of a rejection of science itself.
      The irony is a "healthy" skepticism is the heart of science. Though it would be interesting to see how the question was asked, was it loaded such that it included the evolution of man? Many people, have a desire to be special, and being the exceptional case of decending directly from a higher power fills that need. For example I know a few religious biology majors who believe in evolution in all cases but people. It doesn't stop them from being intellgent productive scientists, they just have closed their mind to a specific case.
      --
      D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
    45. Re:which farm animal represents 48% of america? by truckaxle · · Score: 1

      Everyone's a sheep. Modern neuroscience pretty much confirms that most of us run on autopilot most of the time.

      Sheep != Autopilot

      The fact that the mind can perform autonomous functions without conscious input does not equate to sheep like behavior when it comes to philosophical beliefs.

      is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?

      I don't think it has and you exaggerate this assertion.

      However, a belief that the creator of the magnificent universe would muddy itself and act in way of a tribal warlord (ie the lord is man of war) or command genocide and child rape, is in my mind, yes an indicator of either lack of intelligence or at least susceptibility to brain washing.

      A belief that the world was flooded at short time ago when there is abundant geological evidence that it did not, proves something of ones intelligence or lack of critical thinking ability.

      A belief that the creator of the great and small would feel threatened by a bronze age culture building a tall tower is... well indicator of someone who needs to believe in a bronze age god.
    46. Re:which farm animal represents 48% of america? by Garse+Janacek · · Score: 1

      DNA + "survival of the fittest" = evolution. It's not a theory - it's just a plain consequence of the the tautology "survival of the fittest" and the fact that we're based on a naturally varying chemical hereditory mechanism (DNA). If you don't understand that people who have more children leave more descendents, or that we're based on DNA, then, YES, you are stupid.

      People have known for a very long time that people who have more children leave more descendants, and that attributes of the parents were often expressed in their children (even before there was a clear scientific explanation of why). And yet, countless brilliant people over thousands of years didn't really figure out what was going on. In fact, that the degree of speciation observed in nature is completely explainable by those two things is very surprising if you come at it without the benefit of modern scientific knowledge and philosophy. You may recall that this was a pretty big deal when the pieces started falling together, even for people who didn't have any particular objections to the possibility (religious or otherwise). For most of history, correct understanding of or belief in evolution has had zero correlation with intelligence, and to claim that after such a short timespan it now has a 100% correlation is kind of ignoring the culture we live in and the time that fundamental philosophical shifts always take to sink in.

      You can say that evolution is true, and you can say that poor acceptance of it is, among other things, a worrying aspect of our educational system, and should be addressed. I'll agree with you there. But that doesn't mean that all, or even most, of the people who reject evolution are stupid (or at least, not any more so than most people who believe in evolution).

      And it is disturbing to define intelligence, not by "a modicum of knowledge and rational analysis capability" as you misleadingly say, but by one's conclusions about a single empirical fact, disregarding all other opinions about all other subjects, as well as the means by which the conclusion was reached, the importance attached to it, and so on -- you're just going to throw all that out and reduce it to a single true/false question? That isn't intelligence, or if it is, then the bar is bizarrely and arbitrarily low...

      --

      I am the man with no sig!

    47. Re:which farm animal represents 48% of america? by rohan972 · · Score: 1

      The mechanics of evolution is just DNA and genetic inheretence, so I'd say it's pretty well proved! ;-)

      Inherited features by definition existed in previous generations. This by no means proves that new features arise, a requirement of evolution.

      Natural selection is sound, observable and demonstrable in theory and practice. However it is the mechanism by which certain traits within a population become predominant, not how new features form. New features require the addition of genetic code, which although there is evidence consistent with this, is far from being proven to the standard of natural selection. Not even close to gravity etc.

    48. Re:which farm animal represents 48% of america? by Archangel+Michael · · Score: 0, Troll

      "Evolution can not be wrong. It's not a theory - it's just a plain fact."

      Once upon a time, it was a fact that gorillas couldn't possibly exist. We know better today.

      No, Evolution is a theory, because it CANNOT be SCIENTIFICALLY TESTED. Nobody has created a new species in a lab. They have changed one species, often dramatically, but it remains what it was beforehand. Nobody has taken a Bacteria, and made it into a Amoeba, and nobody has taken a virus, and turned it into a bacteria.

      It cannot be tested, scientifically, so it remains a theory. Much like most of Quantum Physics is theory, and not likely to be testable anytime soon.

      It is this kind of crap that should piss off every scientist. It is this kind of crap that I resent being shoved down to our children, theories as fact. It is no more fact than the FSM is.

      --
      Agent K: A *person* is smart. People are dumb, stupid, panicky animals, and you know it.
    49. Re:which farm animal represents 48% of america? by Archangel+Michael · · Score: 1

      "When religion builds an airplane,"

      Religion cannot build an airplane, and science cannot explain a Creator. They are mutually exclusive. Because some one believes in one, doesn't mean they can't believe in the other, even if you don't understand this.

      And, just so you realize this: From ... http://www.adherents.com/people/pw/Wright_Brothers .html

      Orville and Wilbur Wright: The Wright Brothers were the sons of a minister for the United Brethren Church. So much for ignorant fundamentalists.

      --
      Agent K: A *person* is smart. People are dumb, stupid, panicky animals, and you know it.
    50. Re:which farm animal represents 48% of america? by misanthrope101 · · Score: 1

      These people are rejecting science and depending on technology. Science := Technology.
      Technology is the application of what was learned from science. Technology is the tangible proof that science isn't "just so stories." Technology works, ergo the science is valid. Evolutionary theory, for example, is used every day in the development of antibiotics, and many other fields. To embrace new antibiotics and modern medicine while rejecting the mental model that allowed for their development is stupid and arrogant.
    51. Re:which farm animal represents 48% of america? by trawg · · Score: 1

      Religion cannot build an airplane, and science cannot explain a Creator. They are mutually exclusive. Because some one believes in one, doesn't mean they can't believe in the other, even if you don't understand this.


      I think you misunderstand the point of science. You don't need to believe in science. It just is. That's the cool thing about it!

      Science could quite easily explain a Creator, if such a thing existed and there was evidence to support it. However, all the facts point to this not being the case.
    52. Re:which farm animal represents 48% of america? by SpinyNorman · · Score: 1

      New features require the addition of genetic code

      Genes don't code for features - they are much lower level than that (creating proteins, controlling expression, etc), so putting existing genees in novel combinations also makes a unique individual (why you share features from your parents but have you own unique features too). Nowadays we can sequence DNA and see these changes directly.

      The nature of evolution is necessarily to modify what has gone before in some incremental way rather than creating brand new features, but a few million generations of incremental changes (longer legs, shorter neck, more hair, etc, etc) will still create something very different (incl. new species) from the original. Old structures such as gills get repurposed into new functions such as ears as behavior and habitat changes... Legs shrink and almost disappear to turn a walking animal into a slithering snake, etc, etc. Thinking in terms of "new features" is really a wrong way to look at it - that may be the cumulative effect of millions of evolutionary steps if you look at the end points, but it's not how evolution actually occurs; evolution occurs by incrementally changing *existing* features.

    53. Re:which farm animal represents 48% of america? by SpinyNorman · · Score: 1

      Do you even understand what the definition of species is? Two groups of animals are considered as a separate species if they can't successfully interbreed.

      The way new species are created isn't by some magic or anything different than normal incremental change... there just becomes a point where the DNA has diverged due to those accumulated tiny incremental steps that the two groups of animals can no longer viably mate (even if they wanted to, which is unlikely).

      There are animals around us in absolutely every stage of speciation you can imagine. Just to pick one, lions and tigers are close to becoming separate species... they can currently still interbreed, but in the wild they do not and therefore they will carry on diverging. Or how about horses and donkeys - just past the point of speciation - they can breed, but the offspring (mules) cannot, so they (horses, donkeys) have therefore permanently diverged into new species.

      I don't know why so many people get hung up on the creation of new species as if it were something different from any other type of incremental change... I can only assume it's because people don't even realize that speciciation is just the loss of ability to interbreed.

    54. Re:which farm animal represents 48% of america? by moz25 · · Score: 1

      Neither the person you replied to, nor you have a clue when it comes the criteria for a valid scientific theory or why science models reality only with theories and never with "facts".

      Btw, please do not make statements about what has or has not been done in a lab. You look as clumsy as Behe when he was confronted in court with a whole pile of publications and books which he claimed did not exist.

      And I repeat: you show no clue about concepts of theory, falsifiability, testability of reproducibility. All concepts of course which alternatives of evolution theory eagerly dismiss.

    55. Re:which farm animal represents 48% of america? by Archangel+Michael · · Score: 1

      "However, all the facts point to this not being the case."

      All the facts you as you believe them. Just because you don't accept facts outside the realm of your senses doesn't make them false. Once upon a time, white men didn't believe in the existence of gorillas, even though there was experiential evidence from outside the realm of white man's experience.

      Eventually, they experienced the gorilla for themselves, and believed. Same will happen with the Creator.

      --
      Agent K: A *person* is smart. People are dumb, stupid, panicky animals, and you know it.
    56. Re:which farm animal represents 48% of america? by Archangel+Michael · · Score: 1

      "Two groups of animals are considered as a separate species if they can't successfully interbreed."

      Actually, this is false statement, and typical of Evolutionists. A lion and tiger are separate species, and yet, there are clear examples of them breeding. Same with Horses and Donkeys (Mule). How about Wolf and Dog?

      So, your first statement is a lie or a deliberate misstatement of fact. And they call us creationists ignorant. Sheesh

      You see, ignorance has little or nothing to do with Evolution and Creationism. Both sides can have ignorant people, as you just proved.

      --
      Agent K: A *person* is smart. People are dumb, stupid, panicky animals, and you know it.
    57. Re:which farm animal represents 48% of america? by Archangel+Michael · · Score: 1

      Except that Evolution cannot explain certain unchanging species, because the reality is, if Evolution is true, then these species would HAVE to have changed, substantially.

      http://news.nationalgeographic.com/news/2007/01/07 0124-sharks-photo.html

      http://en.wikipedia.org/wiki/Coelacanth

      Evolution cannot explain LACK of change in a SEA of change, because Evolution requires change, and the LACK thereof is very hard to explain. Of course Evolution doesn't really address lack of change, because it cannot, it just marks it as an "exception". Enough "exceptions" and the theory becomes less likely.

      Another exception is the Cambrian (and Pre Cambrian) explosion.

      "The question of how so many immense changes occurred in such a short time is one that stirs scientists. Why did many fundamentally different body plans evolve so early and in such profusion? Some point to the increase in oxygen that began around 700 million years ago, providing fuel for movement and the evolution of more complex body structures. Others propose that an extinction of life just before the Cambrian opened up ecological roles, or "adaptive space," that the new forms exploited. External, ecological factors like these were undoubtedly important in creating the opportunity for the Cambrian explosion to occur. "

      So, here we have circular logic of Evolution. To prove evolution, they assume evolution. They cannot explain this "explosion" in fauna via normal evolutionary models, so they make a huge bunch of assumptions(guesses), all of which presuppose evolution.

      Of course, there is no other explanation that evolutionists accept for it. Again, another "exception", whereby the theory doesn't explain the explosion, without first accepting the theory. Slow steady changes doesn't explain it, so they modify the theory to include periods of rapid changes without any facts to actually support two types of evolution (fast, slow).

      "Scientists have also long been puzzled by its abruptness, and the apparent lack of obvious predecessors to the Cambrian fauna. Three questions in particular are of importance currently: I) is the "explosion" real?; II) what does it tell us about the origin and possible evolution of animals? and III) what were its causes?"

      To claim that all creationists are ignorant (not knowing the facts) is a huge lie. I was once a Evolutionist, until I started reading the SCIENCE behind it. I once blindly accepted it as "Fact" until I read example after example of exceptions and holes in the "fossil record". And there are plenty of them.

      --
      Agent K: A *person* is smart. People are dumb, stupid, panicky animals, and you know it.
    58. Re:which farm animal represents 48% of america? by SpinyNorman · · Score: 1

      The definition of species (can't interbreed) I gave you is the modern evolutionary one. The old classifications were based on external chanracteristics and are functionally meaningless. The interbreeding definition of species makes sense becuase once the DNA of two groups (formerly same species) has diverged beyond the point of them being able to interbreed then there is no going back - the DNA can no longer be mixed and therefore the newly branched species will now evolve indpendently. Correpondingly, if two populations of the same species have genetically diverged, but NOT beyond the point of being able to interbreed, then there is still a chance that they may interbreed and remix the DNA.

      Lions and Tigers can interbreed (and have healthy young), therefore - by definition - they are the same species, despite looking a bit different (just as dachshunds and pitbulls are also the same species as each other, despite looking and behaving different).

      Mules are (generally) sterile, so the combined DNA can't be further mixed and the interbreeding has therefore effectively failed. Actually it's more subtle than that because *sometime* a horse/donkey mix (M=mule, F=hinny) can breed, so really it's more accurate to say that horse/donkey is currently - right nbw - in the process of forming two seperate species.

      Wolf and (all breeds of) dog are able to interbreed.

      It's interesting how you think this is a word game rather than having anything substantive to say, or any response to the fact that I've just explained how trivial the creation of new species is. Oh well.

    59. Re:which farm animal represents 48% of america? by Anonymous Coward · · Score: 0

      > Usually it does, and usually any applications are far more positive than negative. Otherwise we'd have discarded the scientific method a long time ago and tried something else.

      You know, that is the exactly what I opposed to from your original post.

      "Usually any applications are far more positive than negative". How do you measure that ?

      "Otherwise we'd have discarded the scientific method a long time ago and tried something else.". What kind of un-scientific reasoning is that ?

      You *assume* that science is beneficial in its applications (using weasel-words, like "usually"). I used to think that, but I am not as sure as I used to be 20 years ago. When I hear people thinking that technological solutions will help us out of global warming (or out of iraq), I cringe.

      Look at the developed world now, and look at it 40 years ago.

      Can you sense progress ? I can't (unless you define progress by "more advanced science applications", which is circular reasoning)

      "Science sans conscience n'est que ruine de l'ame"

    60. Re:which farm animal represents 48% of america? by eggfoolr · · Score: 1

      That will be the animal that voted for Bush in the last two elections.

      Sad, very sad. Could it be Christian extremists could be more extreme than Muslim extremists?

    61. Re:which farm animal represents 48% of america? by mapkinase · · Score: 1

      Am I disturbed by foolish behavior of fools?

      --
      I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
    62. Re:which farm animal represents 48% of america? by 4D6963 · · Score: 1

      So, basically, one cannot think up something on his own and is necessarily the follower of someone?

      Everyone's a sheep. Modern neuroscience pretty much confirms that most of us run on autopilot most of the time.

      Yeah, most of the time, like when I take a crap or that I pick my nose, I'm on autopilot, big whoop. If we're on autopilot most of the time, what do you mean by most of the time (55%? 98%?) and then, what goes on when we're not on "auto-pilot"?

      Anyways, all you americans are kind of losing it with evolution and global warming. We, the reasonable people of Europe, are not into stupid retarded debates/clashes like this.

      --
      You just got troll'd!
    63. Re:which farm animal represents 48% of america? by Archangel+Michael · · Score: 1

      so, your definition fits the theory you're trying to prove. How convenient. Circular, but convenient.

      It is funny how Environmentalists call all sorts of animals "different species" when in reality they are not, just to get "endangered" label attached.

      Oh, that is a different classification? So, on the one hand, they are the "same" on the other hand they are "Different".

      Call me back when Evolutionists and Environmentalists can agree on a common definition that can be applied to both.

      --
      Agent K: A *person* is smart. People are dumb, stupid, panicky animals, and you know it.
    64. Re:which farm animal represents 48% of america? by SpinyNorman · · Score: 1

      I am explaining to you how animals with different DNA evolve. Call them teletubbies rather than species if you prefer.

      The point is just that new species are trivial to create - and are being created all around us right now. Lion/Tiger are almost divereged - soon to be new species. Horse/Donkey are in the process of diverging right now. Man/Chimpanzee diverged quite recently and are now separate species.

      Modern DNA sequencing makes denying the evidence rather, uh, stupid. Darwin (pre DNA) had a theory. Darwin + DNA = proof.

      New species creation:
      1) Red teletubbies group #1 evolve and become purple
      2) Red teletubbies group #2 evolve seperately (maybe they live on their own island) and become orange
      3) Purple and orange teletubbies can't successfully breed ----> Now they are separate teletubbies (since no more DNA mixing)
      4) Purple teletubbies continue to evolve and maybe become tall and hairy
      5) Orange teletubbies continue to evolve and maybe become short with a long tail
      6) Creationist realizes that the tall hairly purple teletubbies are a different species from the short orange ones with the long tail, and falls out of his tree

    65. Re:which farm animal represents 48% of america? by Alsee · · Score: 1

      is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?

      An unwavering belief in the theory of evolution is not a litmus test for intelligence, however Is evolution well-supported by evidence and widely accepted within the scientific community?', some 48% of Americans said 'No' is an issue of just plain ignorance.

      Your average man of the street generally has no particular need to study the details of physics electromagnetism or chemistry element theory nor biology evolution. He does not need an unwavering belief in any of them. But any most minimal highschool education absolutely must inform of the fact that these things *ARE* all established beyond any reasonable doubt and that they *ARE* all considered the accepted and established foundations of all work in the fields of physics chemistry and biology by effectively 100% of all degreed professionals working in those fields.

      According to Newsweek magazine figures there are approximately 480,000 degreed earth and life scientists in the US on the "pro-evolution" side vs approximately 700 against. That works out to 99.85% or so. For any reasonable highschool education, 99.85% rounds off to "ALL OF THEM".

      The average person does not need to understand elements, the average person does not particularly need to "beleive" in elements. However it is inexcusable ignorance to be unaware of the FACT that elements are effectively the indisputed established truth and foundation of all work in related fields of science.

      The average person does not need to understand evolution, the average person does not particularly need to "beleive" in evolution. However it is inexcusable ignorance to be unaware of the FACT that evolution is effectively the indisputed established truth and foundation of all work in related fields of science.

      The very reason that evolution is accepted by about 99.85% of everyone who ever gets any college education and degree in any area of the earth and life sciences is because in the course of that education they study the subject and they study the evidence and the arguments and counter arguments, and they come to the conclusion that the evidence is overwhelming and conclusive, and that none of the counter arguments hold up. And as this very poll shows, many if not most of the students entering any of these fields goes in initially believing the exact opposite. Almost all of those students doing in are Christian, and many of them are deeply religious and devout Christians. Some of them even go into the field for the explicit purpose of tearing down all this "evolution nonsense". And virtually without exception they all come out of that education convinced by the evidence. Even the deeply religious most devout Christians who enter the field with the intent of tearing down evolution almost without exception come out having learned and having been convinced of evolution. Just as one taking a chemistry course would come out convinced about elements. The they do not all magically become atheists. They realize that there is no conflict between God and evolution. They simply accept evolution as God's mechanism for the diversity of life. Just as they accept optics as the mechanism for producing rainbows, and nuclear fusion for creating light for the earth.

      You don't need to believe evolution any more than you need to believe elements, but you have been either lied to or horribly misled if you have the impression that there is any genuine scientific controversy or doubt around evolution. There is a public relations controversy over evolution, and there is political controversy over evolution, but scientifically the number of biologists against evolution is approximately equal to the number of astronomers who claim the sun is powered by electricity, and that number is only slightly higher than the number of geologists in the Flat Earth Society.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    66. Re:which farm animal represents 48% of america? by moz25 · · Score: 1

      Dude, you can make a huge post by copy-pasting some of the popular creationist propaganda and from 10 feet distance from my screen, it'll actually look like a response if I'm not wearing my glasses, but upon closer inspection, it's simply not in any meaningful way a response to what *I* wrote.

      How are we ever to have a real discussion on this subject when all the creationists do is keep spouting already-refuted propaganda? The creationists fall into two groups: the ones who are simply ignorant and the ones who aren't ignorant, but do whatever they can to keep the first group ignorant.

      Whichever way you look at it, trying to attack a theory in favour of one that states that everything was just put there the way it is now has nothing whatsoever to do with science or reality.

  6. This is interesting, but... by Raindance · · Score: 5, Interesting

    This is interesting, but not for the obvious reasons.

    The poll looks fairly well-constructed, but the problem is that evolution has become extremely politicized. For many, this question wasn't asking about science-- it was a political question (are you with the conservative-christians or the liberal-atheist-scientists?).

    I think the real story here is the process by which scientific issues get politicized. It's a process that we really need to understand. John Timmer over at Ars Technica often writes about this.

    1. Re:This is interesting, but... by Anonymous Coward · · Score: 5, Insightful

      Actually that's not a well constructed poll. It's asking 2 things at once in a single yes/no question (Is evolution well supported, is evolution well accepted). So of the people who said no are they saying no to one of the questions or both?

    2. Re:This is interesting, but... by Anonymous Coward · · Score: 0

      Or it could be that by definition, 50% of Americans have an IQ below 100.

    3. Re:This is interesting, but... by Anonymous Coward · · Score: 1, Informative

      The mean does not necessarily equal the median. For example, a great majority of people have more than the average number of arms and legs.

    4. Re:This is interesting, but... by Anonymous Coward · · Score: 2, Informative

      Quite correct. I worked on some polls for Rutgers a few years back and it was interesting how one could 'load' a response simply by changing the inflection of ones voice while asking the question. Of course I am talking about phone polls or face to face but I expect a written poll could likewise be swayed.

    5. Re:This is interesting, but... by swillden · · Score: 5, Insightful

      Actually that's not a well constructed poll. It's asking 2 things at once in a single yes/no question (Is evolution well supported, is evolution well accepted). So of the people who said no are they saying no to one of the questions or both?

      My thought exactly, except that I'd point out another aspect of the question that's overly broad. "Evolution" isn't a single theory, it's a whole complex set of theories, some of which have very solid observational evidence supporting them and others of which are almost pure hypotheses. For example, on the one hand, it's scientifically indisputable that species do evolve. We have seen it happen under controlled conditions in the laboratory, as well as having a deep fossil record. On the other hand the theory of punctuated equilibrium is just a fairly random stab at trying to explain why the fossil record seems to show long periods of little change separated by short periods of massive change. There are lots of other examples all across the spectrum.

      Personally, I'd have had a hard time answering yes to the question "Is evolution well supported", not because I don't believe it is, but because I *know* it's a political question, not a scientific question, and I know that if I say "yes" I'll be indicating assent to a much broader range of ideas than those I actually believe are supported.

      A better poll would have asked several, more precisely-focused questions, such as: "Do you believe evolution occurs?"; "Do you believe that the large number of species that exist today evolved from a small number of ancient species?"; "Do you believe that humans evolved from earlier species?"; "Do you believe that evolution is a result of purely random chance?"; plus similar questions oriented towards getting the individual's opinion about the scientific support and opinions of scientists, such as "Is there solid scientific evidence that evolution occurs?" and "Do most scientists believe that evolution occurs?".

      The result would have been a much better view into the understanding and beliefs of Americans, rather than just their religio-political views.

      --
      Note to ACs: I usually delete AC replies without reading them. If you want to talk to me, log in.
    6. Re:This is interesting, but... by Odin's+Raven · · Score: 2, Funny

      Actually that's not a well constructed poll. It's asking 2 things at once in a single yes/no question (Is evolution well supported, is evolution well accepted). So of the people who said no are they saying no to one of the questions or both?

      Yes.

      --
      A marriage is always made up of two people who are prepared to swear that only the other one snores.
    7. Re:This is interesting, but... by DrFalkyn · · Score: 1

      "Do you believe that evolution is a result of purely random chance?"

      To anyone who's studied even a overview of the the ToE the answer to this question should be "No." Evolution occurs due to the mechanisms of natural selection, sexual selection and genetic drift*. Only the last of those three can be considered to be "purely random".

      *I know there are some others, but those are the major ones.

    8. Re:This is interesting, but... by Anonymous Coward · · Score: 0

      of course the mean doesn't necessarily equal the median, but in the case of IQ (a Gaussian distribition), they're defined to be identical. IQ tests are regularly renormed to ave the average/median be 100, and the standard deviation (depending on the test) be 15 points.

    9. Re:This is interesting, but... by SnowZero · · Score: 1

      Well said. I'd give you mod points if I had them.

    10. Re:This is interesting, but... by flyingfsck · · Score: 1

      Actually, evolution isn't nearly as politicized as it was in the 19th century. See the Huxley files: http://aleph0.clarku.edu/huxley/ Prof Huxley was known as "Darwin's Bulldog".

      Even as recent as 75 years ago, there were law suits between believers and unbelievers, for example the case between Prof Du Plessis and the University of Stellenbosch in the 1930s. Basically, Prof Du Plessis contended that one should not take the creation myth of the bible literally. The problem was that he was the chief of the theological seminary - oops. So he was dismissed. He then sued and was re-instated, with full pay, then told to go home and stay there!

      Even his statue was moved around town several times and only in 2006 - 70 years later - was it moved to the grounds of the seminary as a sign of "reconciliation".

      So if you think that the creation myth is controversial today, it is nothing compared to 100 years ago.

      --
      Excuse me, but please get off my Pennisetum Clandestinum, eh!
    11. Re:This is interesting, but... by RMB2 · · Score: 1

      Nice post. Maybe you should get a job writing survey questions for Newsweek.

      The fact that you can accurately use the term "religio-political" in a serious context makes me sad

      --
      [/sarcasm]
    12. Re:This is interesting, but... by Phroggy · · Score: 1

      (are you with the conservative-christians or the liberal-atheist-scientists?). Do you support warrantless domestic wiretaps, or do you support gay marriage?

      Do you support the war in Iraq, or do you support abortion?

      This political dichotomy extends far beyond just science.
      --
      $x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
      $x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
    13. Re:This is interesting, but... by swillden · · Score: 1

      To anyone who's studied even a overview of the the ToE the answer to this question should be "No." Evolution occurs due to the mechanisms of natural selection, sexual selection and genetic drift*. Only the last of those three can be considered to be "purely random".

      And where do the genetic changes that create new traits that are selected for or against come from? Ultimately from random mutations and crosses. The crosses aren't purely random, of course, but they can be viewed as a largely independent random variable (i.e. the factors that determine selection of a mate don't necessarily have anything to do with survival, except insofar as they help getting selected as a mate).

      --
      Note to ACs: I usually delete AC replies without reading them. If you want to talk to me, log in.
    14. Re:This is interesting, but... by DrFalkyn · · Score: 1

      And where do the genetic changes that create new traits that are selected for or against come from? Ultimately from random mutations and crosses. The crosses aren't purely random, of course, but they can be viewed as a largely independent random variable (i.e. the factors that determine selection of a mate don't necessarily have anything to do with survival, except insofar as they help getting selected as a mate).

      You seem to be thinking on an individual level - and evolution is not about individuals but groups. Mutation events for individuals might be 'random', but the selection on the phenotype that results from the mutation(assuming it does actually change the phenotype) is not, in a statistical sense. Mutations are either beneficial, harmful or neutral in terms of survival - and unless you are talking about sexual selection have little to do with selection of mate. I don't know of any biologist that would claim that evolution is a completely "random process".

    15. Re:This is interesting, but... by Bowling+Moses · · Score: 1

      "Personally, I'd have had a hard time answering yes to the question "Is evolution well supported", not because I don't believe it is, but because I *know* it's a political question, not a scientific question, and I know that if I say "yes" I'll be indicating assent to a much broader range of ideas than those I actually believe are supported."

      The actual question was: "13. Do you think the scientific theory of evolution is well-supported by evidence and widely accepted within the scientific community?" Even though the question is a two-parter, the answer to the second half logically follows from the first. In science, evidence is the only thing that matters when it comes to whether or not a theory is accepted. And if you ask scientists the answer is overwhelmingly yes nearly to the point of unanimity.

      As a biochemist, I encounter evolution's fingerprints on a daily basis at work, as do all those who work in life sciences fields no matter what their personal political and relgious beliefs are. Whenever a DNA or protein sequence is BLASTed, enzymatic or signalling pathways between different organisms examined, protein structures overlaid and analyzed, morphology and the patterns of development investigated, the underlying principle of evolution through common descent by mechanisms such as mutation, selection, genetic drift, horizontal gene transfer is required to explain our observations. Evolution to a life scientist is an inescapable conclusion. Where the controversy in science occurs is in disputes over ideas like the relative importance of those different mechanisms and exactly which species split off at precisely what time and in what order, not if evolution occurs. In ten years I've worked with people with political views ranging from communism to neoconservatism, and religious beliefs including Catholics, Protestants, Mormons, Hindus, Muslims, atheists, agnostics, Buddhists, neopagans and newagers (oddly no Jews as of yet). In all that time with all of those different people, I've only come across one person, a lab mate of mine, who didn't "believe" in evolution. Sure he'd read papers in our field of study describing with molecular phylogenetics and mutagenic experiments how our protein family had evolved over the course of the last few million years. He'd also see that the conclusions would be used by another lab mate of ours to engineer a related protein demonstrating, in vibrant color (we worked on colored proteins), the reality of those evolutionary events and predictions. On a more basic level, he'd observe natural selection in action if one of the undergrads forgot to include the antibiotic kanamycin in a bacterial culture, as by morning bacteria with the plasmid encoding the resistence gene would be handily out-competed by those who had no plasmid. Or that spontaneous mutation also (frustratingly) happened by comparing his protein structure to the gene he sequenced a year prior.

      My labmate happened to be a conservative Republican and an evangelical christain. His rejection of evolution was due to his religious beliefs and in spite of the evidence. My and most of our peers acceptance of evolution is driven by the evidence. So is the question "is evolution well-supported" a political (as American tendency to be religious evangelicals currently correlates with political conservatism) one just because a certain political/religious minority says it is? If so, would acceptance of the proposition that the Earth orbits the Sun be a political issue because a political/religious group says the Earth is the Center of the Universe (yes geocentrists still exist--even on slashdot)? Or is it instead an incidence where political/religious dogma trumps evidence for some people?

    16. Re:This is interesting, but... by swillden · · Score: 1

      And where do the genetic changes that create new traits that are selected for or against come from? Ultimately from random mutations and crosses. The crosses aren't purely random, of course, but they can be viewed as a largely independent random variable (i.e. the factors that determine selection of a mate don't necessarily have anything to do with survival, except insofar as they help getting selected as a mate).

      You seem to be thinking on an individual level - and evolution is not about individuals but groups. Mutation events for individuals might be 'random', but the selection on the phenotype that results from the mutation(assuming it does actually change the phenotype) is not, in a statistical sense. Mutations are either beneficial, harmful or neutral in terms of survival - and unless you are talking about sexual selection have little to do with selection of mate.

      You just restated what you said before. Should I do the same?

      I don't know of any biologist that would claim that evolution is a completely "random process".

      But you're referring only to the selection part of the process. Do you know any biologists that would argue that the source of the traits that are selected for or against is not a random process?

      --
      Note to ACs: I usually delete AC replies without reading them. If you want to talk to me, log in.
    17. Re:This is interesting, but... by swillden · · Score: 1

      Even though the question is a two-parter, the answer to the second half logically follows from the first.

      Only if you assume that scientists aren't human. Eventually, discrepancies between evidence and belief get ironed out, but it often takes a while (a generation or so). Science is just as prone to faddishness in the short term as any other human endeavor.

      In ten years I've worked with people with political views ranging from communism to neoconservatism, and religious beliefs including Catholics, Protestants, Mormons, Hindus, Muslims, atheists, agnostics, Buddhists, neopagans and newagers (oddly no Jews as of yet). In all that time with all of those different people, I've only come across one person, a lab mate of mine, who didn't "believe" in evolution.

      Did you miss where I said the fact that evolution occurs is indisputable? Yet there's still lots of room for disagreement about processes, results and their interpretations, and many of them are not as well-supported, yet are widely accepted, particularly among scientists whose field is not in the life sciences.

      So is the question "is evolution well-supported" a political (as American tendency to be religious evangelicals currently correlates with political conservatism) one just because a certain political/religious minority says it is?

      Partly. But mostly it's a political issue because it happens to be one area in which a couple of significant and otherwise opposed groups disagree. It's like Judaism vs Islam in the Palestine area. The real conflict is over land, not religion, but because the parties are of different religions, religion becomes mixed into the issue.

      People are messy, complicated and illogical, especially in large groups. Issues that are logically distinct don't necessarily stay distinct, especially when they're considered in very broad strokes like "evolution". This is true for scientists just like any other people. Well, scientists are probably a little better at drawing distinctions than average, but not much, and only when they want to.

      --
      Note to ACs: I usually delete AC replies without reading them. If you want to talk to me, log in.
    18. Re:This is interesting, but... by Alsee · · Score: 1

      You're wrong and you're stupid.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    19. Re:This is interesting, but... by Anonymous Coward · · Score: 0

      "Do you believe that evolution is a result of purely random chance?"

      Ouch. I liked the others, but talk about a loaded question. I'd want to write a couple of pages to answer that one. "Yes" or "no" isn't going tot ell you a lot about what the person thinks or what they think you meant.

    20. Re:This is interesting, but... by swillden · · Score: 1

      "Do you believe that evolution is a result of purely random chance?"

      Ouch. I liked the others, but talk about a loaded question. I'd want to write a couple of pages to answer that one. "Yes" or "no" isn't going tot ell you a lot about what the person thinks or what they think you meant.

      You see what the question was intended to get at though, right? Can you offer a set of questions that do a better job?

      --
      Note to ACs: I usually delete AC replies without reading them. If you want to talk to me, log in.
    21. Re:This is interesting, but... by gfreeman · · Score: 1

      Sir Humphrey: "You know what happens: nice young lady comes up to you. Obviously you want to create a good impression, you don't want to look a fool, do you? So she starts asking you some questions: Mr. Woolley, are you worried about the number of young people without jobs?"
      Bernard Woolley: "Yes"
      Sir Humphrey: "Are you worried about the rise in crime among teenagers?"
      Bernard Woolley: "Yes"
      Sir Humphrey: "Do you think there is a lack of discipline in our Comprehensive schools?"
      Bernard Woolley: "Yes"
      Sir Humphrey: "Do you think young people welcome some authority and leadership in their lives?"
      Bernard Woolley: "Yes"
      Sir Humphrey: "Do you think they respond to a challenge?"
      Bernard Woolley: "Yes"
      Sir Humphrey: "Would you be in favour of reintroducing National Service?"
      Bernard Woolley: "Oh...well, I suppose I might be."
      Sir Humphrey: "Yes or no?"
      Bernard Woolley: "Yes"
      Sir Humphrey: "Of course you would, Bernard. After all you told you can't say no to that. So they don't mention the first five questions and they publish the last one."
      Bernard Woolley: "Is that really what they do?"
      Sir Humphrey: "Well, not the reputable ones no, but there aren't many of those. So alternatively the young lady can get the opposite result."
      Bernard Woolley: "How?"
      Sir Humphrey: "Mr. Woolley, are you worried about the danger of war?"
      Bernard Woolley: "Yes"
      Sir Humphrey: "Are you worried about the growth of armaments?"
      Bernard Woolley: "Yes"
      Sir Humphrey: "Do you think there is a danger in giving young people guns and teaching them how to kill?"
      Bernard Woolley: "Yes"
      Sir Humphrey: "Do you think it is wrong to force people to take up arms against their will?"
      Bernard Woolley: "Yes"
      Sir Humphrey: "Would you oppose the reintroduction of National Service?"
      Bernard Woolley: "Yes"
      Sir Humphrey: "There you are, you see Bernard. The perfect balanced sample."

      --
      Ceci n'est pas un sig.
    22. Re:This is interesting, but... by JavaRob · · Score: 1

      Maybe it's the difference between reading what you first wrote as either:
          "Do you believe that evolution is purely a result of random chance?"
      vs. (actual quote)
          "Do you believe that evolution is a result of purely random chance?" ...which doesn't quite make sense -- what other kind of "chance" is there besides the purely random kind?

      But even drop the "purely" altogether, and it's still like standing by a sawmill and saying, "these planks are the result of water flow: true or false?".

      Sure, without the water flow the mill wouldn't run -- but you can run all the water you want and you won't get a single 2x4 without the waterwheel there, directing the unfocused water power to a saw that cuts the wood along the guides, etc..

      In the same way, random mutations (without the direction of natural selection) do not result in "evolution". Take a single-cell organism, and throw in a HUGE number of random mutations, and your chances of coming up with, say, a hummingbird are still pretty much nil.

      This is the straw man that confused creationists keep knocking down.

      This is why anyone who understands evolution would probably answer that question "no". Or "mu". Randomness and entropy is everywhere (there are lots of different causes for genetic mutation, for example). Natural selection - the directing force - is the special sauce of evolution, not the randomness.

    23. Re:This is interesting, but... by Bowling+Moses · · Score: 1

      "Only if you assume that scientists aren't human. Eventually, discrepancies between evidence and belief get ironed out, but it often takes a while (a generation or so). Science is just as prone to faddishness in the short term as any other human endeavor."

      Science is replete with examples where new ideas overtook old ones after a struggle lasting as much as a few decades. Evolution is an excellent example of this process. By the 1880's it was undeniable that evolution occured, although the importance of natural selection was still debated. In the 1920's it came to be realized that Darwin's mechanism of natural selection could act on mutable genes, finally killing off vitalism and Lamarckism. The modern synthesis occurred from the 1920's to the 1950's. Recent decades have seen epigenetics, endosymbiosis, punctuated equilibrium, and other additions to evolutionary biology. So it's been 130 years since the fact of evolution ceased to be a scientifically debateable position. Scientists from that time are all long dead. It's been 90 years since natural selection and mutation was debateable. Scientists from that time are also long dead. It's been 60 years since the modern synthesis period ended. The major architects have been dead a while, and the very youngest scientists from the end of that period are now in their 80's. It was a generation a few generations ago, even for the modern synthesis.

      "Yet there's still lots of room for disagreement about processes, results and their interpretations, and many of them are not as well-supported, yet are widely accepted..."

      There's disagreement, but not over the main points: evolution occurs, and that natural selection, random mutagenesis, and genetic drift are among the most important mechanisms. This brings us back to question 13: "Do you think the scientific theory of evolution is well-supported by evidence and widely accepted within the scientific community?" Unless you can offer evidence that major processes, results, and interpretations are not well-supported yet widely accepted, the only accurate answer is "yes."

      "But mostly it's a political issue because it happens to be one area in which a couple of significant and otherwise opposed groups disagree."

      It is this I disagree with and why I responded to your post in the first place. To claim that question 13 is political implies the equivalency of answering yes or no. However answering yes to question 13 is the simple acknowledgement of the fact that evolution is well-evidenced and has not been in any doubt in the scientific community for many, many years. Answering no requires that the respondent is unaware of those two facts, has some conspiracy belief as to the motivations of scientists, or (most commonly) has a religously fueled disbelief, or some combination thereof. Only for those answering no could question 13 be political, and only in that religious conservatism currently correlates with political conservativism. This is what I was alluding to with geocentrism: if there were a significant political party out there that had a plank in its platform stating that the earth is the center of the universe and all other bodies orbit it, that still would not make geocentrism a political issue. It just be a particular group of people rejecting science.

    24. Re:This is interesting, but... by swillden · · Score: 1

      Only for those answering no could question 13 be political, and only in that religious conservatism currently correlates with political conservativism.

      Not at all. I know liberals who don't know the science of evolution from pyramidology, but believe in it simply because people who agree with them on other things believe in it and some of the people who disagree wit them on other things argue against it.

      --
      Note to ACs: I usually delete AC replies without reading them. If you want to talk to me, log in.
    25. Re:This is interesting, but... by Anonymous Coward · · Score: 0

      You are a halfbred fuckwit who wouldn't know a joke if it danced in front of you in a pink tutu singing "The Return of the Joke".

    26. Re:This is interesting, but... by Alsee · · Score: 1

      I don't know if you made the anon reply to my comment to your comment, but in any case it appears I should probably clarify my previous reply. It was supposed to be a joke to your joke. Perhaps a badly executed joke on my part. Your "yes" was a deliberately nonsensical answer to the question, and my opposite position was supposed to be equally nonsensical. The insult was entirely gratuitous, and was supposed to be a parody of typical internet flamewars... two people making equally nonsensical arguments topped off by gratuitous insults. Maybe "and your mother dresses you funny" might have worked better than "stupid". Oh well, c'est la vie. No offense was intended.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
  7. Not even about evolution as a concept by Threni · · Score: 1

    It's about whether it's accepted by the scientific community. It's like disagreeing with gambling and denying that you add up the opposite faces on a die and end up with 7.

    1. Re:Not even about evolution as a concept by Anonymous Coward · · Score: 0

      I am not surprised. In general, americans are just so stupid.
      10% of this country is super-brilliant and they run and represent the country well.
      The rest 90% are just what I call 'dumb slaves', eating,drinking,believing and thinking exactly what this 10% wants you to believe.

    2. Re:Not even about evolution as a concept by voice_of_all_reason · · Score: 3, Insightful

      Exactly. Let's look at the question again: Is evolution well-supported by evidence AND widely accepted within the scientific community?

      Note the logical construct "and". They're asking for A and B to be true. This rules out:

      People who think A is false (any religious zealot)
      People who think B is false (anyone who believes in evolution but is disallusioned by its acceptance)

    3. Re:Not even about evolution as a concept by 808140 · · Score: 1

      The lucidity of your post leaves little doubt which group you belong in...

    4. Re:Not even about evolution as a concept by Wilson_6500 · · Score: 1

      And humans, being illogical creatures, will for the most part say to themselves, "If I say yes, it's like saying that I believe in evolution," and answer based on that. I think very few people take poll as literally as poll designers would like to believe.

    5. Re:Not even about evolution as a concept by Phroggy · · Score: 1

      If the answer to one half of the question is yes but the answer to the other half is no, most people's brains will reinterpret the question to mean something other than precisely what was asked, so that they can give a single yes/no answer. There's no way to tell what question these people were really giving their answer to.

      --
      $x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
      $x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
  8. haha by Anonymous Coward · · Score: 0, Funny

    Religious people are funny.

  9. The Prostate by mark0 · · Score: 3, Funny

    Anyone who believes in Intelligent Design has never considered the prostate, let alone actually had prostate trouble. Even a human engineer wouldn't design a component like that. They want me to believe omnipotent, omniscient being did that?

    1. Re:The Prostate by Khaed · · Score: 1

      Devil's advocate: Why would we evolve something like that?

    2. Re:The Prostate by ewhac · · Score: 4, Funny
      Dude, it's even worse than that. Consider the entire region of genetalia. What kind of "intelligent" designer puts a recreational facility next to a waste disposal site?

      :-),
      Schwab

    3. Re:The Prostate by mark0 · · Score: 1

      Because the chance mutation didn't kill us or disadvantage us before we had the opportunity to pass it on.

    4. Re:The Prostate by Anonymous Coward · · Score: 0

      God is clearly a civil engineer, because only a civil engineer would run a sewer through a playground.

    5. Re:The Prostate by taskforce · · Score: 1

      God must be a Civil Engineer.

      --
      My 3D Texturing Skinning work (under construction)
    6. Re:The Prostate by Ivecowarrior · · Score: 1

      Forget the prostate, what about the appendix?

      Proof of evolution (very useful in rabbits for example), while at the same time proving that the Intelligent Creator of this ticking timebomb of infection wasn't that intelligent.

    7. Re:The Prostate by lenski · · Score: 1

      Because prostate problems do not affect reproduction, and do not even affect a male's ability to support his progeny until they are essentially ready for breeding themselves.

    8. Re:The Prostate by j+h+woodyatt · · Score: 1

      You think that was a bad design? I have two words for you: Cephalopelvic Disproportion.

      --
      jhw
    9. Re:The Prostate by umbra_dweller · · Score: 1

      Because it doesn't interfere with our ability to survive long enough to reproduce and raise a couple of kids. Any design flaws in an organism may remain for a long time provided they don't interfere with the essenials.

    10. Re:The Prostate by Khaed · · Score: 1

      I'm not a good enough devil's advocate on this topic to keep going, so instead I'll resort to my tired geek outrage devil's advocate:

      why in hell haven't we evolved past needing sleep yet?!

      (or, why did the Intelligent Designer make us need sleep?! if you want to annoy IDers.)

    11. Re:The Prostate by Khaed · · Score: 5, Funny

      You've obviously never been to New Jersey.

    12. Re:The Prostate by kcbrown · · Score: 2, Insightful

      Anyone who believes in Intelligent Design has never considered the prostate, let alone actually had prostate trouble. Even a human engineer wouldn't design a component like that. They want me to believe omnipotent, omniscient being did that?

      An omnipotent, omniscient being always gets what it wants, by definition.

      All that pain and suffering in the world? All the bad things that simply happen on their own without human intervention? If an omnipotent, omniscient being exists, those things are there intentionally.

      The bottom line is that if you believe in an omnipotent, omniscient creator, then you believe in an evil, sadistic being, by definition, and one need only look at the world to see it. No being that cared about what it creates would intentionally set up the universe such that pain and suffering were possible, much less undeserved pain and suffering, and certainly not one in which pain and suffering were necessary for survival (i.e., hunters and prey).

      And no, "free will" doesn't help you here, because the universe constrains your free will, sometimes to the point where all your available choices are bad. No being that truly cared about you would set up the universe to make that possible unless said being had no other choice (so much for omnipotence).

      Call this a troll if you will, but before you do, work through the logic. You'll find that an omnipotent (can do absolutely anything), omniscient (knows everything) being that cares about its creation and allows undeserved suffering in the world is a logical contradiction.

      --
      Use 'slashdot stuff' in the subject line in any email you send me if you want to get past the spam filter.
    13. Re:The Prostate by Anonymous Coward · · Score: 0

      "Dude, it's even worse than that. Consider the entire region of genetalia. What kind of "intelligent" designer puts a recreational facility next to a waste disposal site?"

      Dude, my entire body is a recreational facility.

    14. Re:The Prostate by bubkus_jones · · Score: 1

      Oh, please, the recreational facility is a waste disposal site.

    15. Re:The Prostate by A+beautiful+mind · · Score: 1

      The best case against any design claims of the human body I have found is vitamin C. Most mammals produce ascorbic acid for themselves (in way larger quantities than the official recommended human intake btw), but humans don't synthesize it for themselves. The really interesting part is that the body _tries_, but then 3/4th through the process, there is a damaged step that makes the body incapable of doing so. The process still repeats in the human body over and over again until 3/4th completion, and then the unusable in-between product is simply broken down by the body.

      To be honest, if I were looking into the genetic betterment of the human race, this would be one of the first things I'd fix. It's well understood and studied, close primate relatives to the humans have the "good" genes to make the process work and it might extend life expectancy by years if not more, because digesting ascorbic acid can never be as effective as having it produced by the body, given that you don't normally eat while asleep and ascorbic acid has a very short lifetime until it is used up by the body. So well, no way in hell that this was a result of a sentient design.

      --
      It takes a man to suffer ignorance and smile
      Be yourself no matter what they say
    16. Re:The Prostate by mbeans · · Score: 1

      why in hell haven't we evolved past needing sleep yet?!
      The 24/7 'always on' lifestyle is a relatively new development in our culture. Evolution doesn't happen overnight.
      --
      "It was a billion times better than cobol, but still really retarded." -AC
    17. Re:The Prostate by A+beautiful+mind · · Score: 1

      Can omniscient God, who
      Knows the future, find
      The omnipotence to
      Change His future mind?

      /Karen Owens/

      --
      It takes a man to suffer ignorance and smile
      Be yourself no matter what they say
    18. Re:The Prostate by rhakka · · Score: 5, Insightful

      as a devil's advocate, the alternate explanation could be that your idea of what it means to care about something could be wrong, what is "undeserved" sufferring could be wrong, and that sufferring for some is not in fact the best the thing for the creation as a whole.

      Since you don't know the "End state" of the creation, or its purpose, you have no way to judge that. You are using your own arbitrary guidelines for all of these things, and since you are neither omniscient nor omnipotent you have no logical grounds with which to judge such a being... to even presume you have the barest idea of what such a creature would do and why, and whether that means it "cares" about its creation or you or not is totally irrational.

      don't get me wrong, I'm not saying there IS such a massively perfect, caring being out there. But as a flawed, limited being such as you or I cannot possibly construct any logical arguement that addresses the motivations of such a superior being... you have absolutely no qualification to judge. All you know is what "feels bad" to you; and you are not perfect, so you don't really know what IS bad, just what seems bad to you.

    19. Re:The Prostate by ipsender · · Score: 1

      Very simple and effective mechanism for ensuring brain size does not increase as a result of selection - unless of course - the hourglass figure becomes a more important signifier in selection than does the narrow-hippedness of chronic anorexia.

    20. Re:The Prostate by farker+haiku · · Score: 3, Funny

      What kind of "intelligent" designer puts a recreational facility next to a waste disposal site? You've obviously never been to New Jersey.
      God made man with the recreational facility next to the waste disposal site.
      Man made New Jersey with the recreational facility next to the waste disposal site.

      Proof that God made man in his image! --
      Your sig(k) has been stolen. There is a puff of smoke!
      --
      Your sig(k) has been stolen. There is a puff of smoke!
    21. Re:The Prostate by ipsender · · Score: 1

      Intriguing. Do you have a net-based reference for this? One is tempted to hypothesise that the faulty genetic step may be a result of compromise in order to allow development of other steps - e.g. bipedal gait, bain size, or more likely, omnivorous diet - but I suspect it is more likely a deletion resulting from increased dietary availability.

    22. Re:The Prostate by Dadoo · · Score: 1

      They want me to believe omnipotent, omniscient being did that?

      I've asked a few fundies that question and the ones who have an answer say our bodies were perfect, until we were kicked out of the Garden of Eden.

      --
      Sit, Ubuntu, sit. Good dog.
    23. Re:The Prostate by Anonymous Coward · · Score: 0

      Thank you, bash.org...

      :P

    24. Re:The Prostate by Rostin · · Score: 1

      No, actually, they don't. Arguments for ID as science have nothing to do with an "omnipotent, omniscient being". They pass entirely on speculating about the identity of the designer(s). It's strictly about detecting design.

    25. Re:The Prostate by A+beautiful+mind · · Score: 1
      Wiki article. Choice quotes:

      The presence of ascorbate is required for a range of essential metabolic reactions in all animals and in plants and is made internally by almost all organisms.

      The vast majority of animals and plants are able to synthesize their own vitamin C, through a sequence of four enzyme-driven steps, which convert glucose to vitamin C.

      (...)humans have no capability to manufacture vitamin C. The cause of this phenomenon is that the last enzyme in the synthesis process, L-gulonolactone oxidase, cannot be made by the listed animals because the gene for this enzyme, Pseudogene GULO, is defective.

      In 1959 the American J.J. Burns showed that the reason some mammals were susceptible to scurvy was the inability of their liver to produce the active enzyme L-gulonolactone oxidase, which is the last of the chain of four enzymes which synthesize vitamin C.

      The biological halflife for vitamin C is fairly short, about 30 minutes in blood plasma, a fact which high dose advocates say that mainstream researchers have failed to take into account.

      Humans carry a mutated and ineffective form of the gene required by all mammals for manufacturing the fourth of the four enzymes that manufacture vitamin C.[47] The inability to produce vitamin C, hypoascorbemia, is, according to the Online Mendeleian Inheritance in Man database, a "public" inborn error of metabolism. The gene, Pseudogene GULO, lost its function millions of years ago, when the anthropoids branched out.[48] In humans the three functional enzymes continue to produce the precursors to vitamin C, but the process is incomplete; these enzymes ultimately undergo proteolytic degradation.
      --
      It takes a man to suffer ignorance and smile
      Be yourself no matter what they say
    26. Re:The Prostate by Plutonite · · Score: 1

      You are trying to dictate a utopia/paradise as being the only situation where the monotheist God would be plausible, and in doing so have ignored pretty much the entirety of monotheist theology concerning purpose. There are far more convincing arguments on the atheist side. This one - the question of why the human universe isn't perfect - will be dismissed by the monotheists via the concept that it is not meant to be. An everlasting afterlife provides overwhelming justice for the issues that trouble you so much.

      And it is the afterlife, in fact, that poses the real problem.

    27. Re:The Prostate by tehdaemon · · Score: 1

      Intriguing. Do you have a net-based reference for this?

      Try wikipedia - they have a decent writeup with references.

      If the Central Dogma of biology is correct, then the deletion cannot be caused by increases in dietary vitamin C. The large amounts in the diet is simply what allowed this deletion to not be fatal.

      T

      --
      Laws are horrible moral guides, moral guides make even worse laws.
    28. Re:The Prostate by ozbird · · Score: 1

      Ob. Time Bandits quote:

      Evil Genius: When I have the map, I will be free, and the world will be different, because I have understanding.

      Robert: Understanding of what, master?

      Evil Genius: Digital watches. And soon I will have understanding of videocassette recorders and car telephones. And when I have understanding of them, I shall have understanding of computers. And when I have understanding of computers, I shall be the Supreme Being! God isn't interested in technology. He knows nothing of the potential of the microchip or the silicon revolution. Look how he spends his time: forty-three species of parrots! Nipples for men!

      Robert: Slugs.

      Evil Genius: Slugs! He created slugs! They can't hear, they can't speak, they can't operate machinery. If I were creating the world, I wouldn't mess about with butterflies and daffodils. I would've started with lasers, eight o'clock, day one.

    29. Re:The Prostate by kcbrown · · Score: 1

      All you know is what "feels bad" to you; and you are not perfect, so you don't really know what IS bad, just what seems bad to you.

      What "feels bad" to me is sufficient, because said omnipotent, omniscient being could have arranged the universe such that neither I, nor anyone else, would feel such things. And would have, if said omnipotent being cared about those of us who have felt that way (which is almost all of us, in the end, since almost all of us have experienced pain and suffering where we know we did nothing to deserve it).

      The point isn't whether or not some objective definition of evil happens in the world. All that matters is that creatures in the world experience pain and suffering for no other reason but that the universe is set up in such a way as to not only make it possible, but to also make it necessary for the survival of other creatures in the world. And the only logical conclusion to draw from that is that if the universe was created by an omnipotent and omniscient being, then said being doesn't give a damn about the living creatures within it. Because if that being did, then those creatures wouldn't experience the pain and suffering that they do experience. By definition.

      Hell, the fact that it's possible to experience pain and suffering is sufficient support of my argument. To an omnipotent, omniscient being, all options in the creation of the universe are independent of each other, so said being could just as easily have chosen to create a universe in which living beings didn't experience pain and suffering without having an effect on anything else.

      If something exists in the world, by definition it means that said omnipotent, omniscient being explicitly wants it to exist, assuming said being exists. Let me put it another way: if an omnipotent, omniscient being created the universe, that being is solely responsible for the pain and suffering in it, because that being had the option of creating the universe such that pain and suffering were simply not possible and explicitly decided against that option.

      To claim that such a being wants its living creations to experience pain and suffering (and wants some of them to experience it continuously for their entire lives) while simultaneously claiming that said being "loves" its living creations is exactly the same as claiming that you "love" your spouse while at the same time beating said spouse to a pulp. They are logical contradictions, and no sane person would make such a claim.

      --
      Use 'slashdot stuff' in the subject line in any email you send me if you want to get past the spam filter.
    30. Re:The Prostate by Anonymous Coward · · Score: 0

      there is a loop hole in the sleep cycle. if you learn to exploit that loop hole you will find the answer to that question which will reveal that a) there is an intellgent designer(s) and that b) the theory of evolution is in fact perfectly correct. it's not something you believe; it's something you do. go see for yourself :)

    31. Re:The Prostate by kcbrown · · Score: 1

      You are trying to dictate a utopia/paradise as being the only situation where the monotheist God would be plausible, and in doing so have ignored pretty much the entirety of monotheist theology concerning purpose. There are far more convincing arguments on the atheist side. This one - the question of why the human universe isn't perfect - will be dismissed by the monotheists via the concept that it is not meant to be. An everlasting afterlife provides overwhelming justice for the issues that trouble you so much.

      Dictate? No. If you choose to believe in an omnipotent, omniscient creator, you must accept the logical consequences of that choice, namely that the universe and everything in it is by definition exactly the way that said creator wishes it to be. You're simply ignoring the argument I'm putting forth.

      There is no reason for an afterlife. There is no reason living beings must die. That, too, was an option to said creator. The afterlife is simply an attempt by theologians to add justice to the equation after the fact because they cannot in any other way resolve the contradiction between the injustice, pain, and suffering they see in the world every day and their belief that the creator they believe in actually "loves" the living beings in the world.

      No, sorry, that doesn't fly, either. An eternal afterlife of bliss, even if it exists, does not negate the fact that pain and suffering in the real world is unnecessary in the face of an omnipotent, omniscient creator, and that if said creator exists, then that creator explicitly chose to create the world as a place where misery is both possible and necessary for survival. Worst of all, there's no physical evidence of this afterlife, so there's no way to know that it exists. The pain and suffering, on the other hand, are readily observable and easily verifiable. Only an idiot would claim that it doesn't exist or doesn't matter.

      So: you can choose to believe in an omnipotent, omniscient creator that "loves" its living creations. But if so, you choose to believe in a logical contradiction, in the same way you would if you chose to believe a wife-beater when he says he loves his wife -- the amount of responsibility for suffering is the same in both cases.

      --
      Use 'slashdot stuff' in the subject line in any email you send me if you want to get past the spam filter.
    32. Re:The Prostate by JeanPaulBob · · Score: 3, Funny

      He said intelligent designer.

    33. Re:The Prostate by bky1701 · · Score: 1

      Just 100 years ago there wasn't any reason to be up at night. Still it's not something life and death and unlikely to improve/reduce reproduction.

      When people can no long have any type of life without being awake 24/7, THEN we will see a change.

    34. Re:The Prostate by Khaed · · Score: 1

      I know, I just hate needing sleep.

      Especially since getting broadband.

      and, uh, discovering all kinds of... uh... interesting forums. yeah, forums.

    35. Re:The Prostate by Anonymous Coward · · Score: 0

      "Since you don't know the "End state" of the creation, or its purpose, you have no way to judge that. You are using your own arbitrary guidelines for all of these things, and since you are neither omniscient nor omnipotent you have no logical grounds with which to judge such a being... to even presume you have the barest idea of what such a creature would do and why, and whether that means it "cares" about its creation or you or not is totally irrational."

      Your argument boils down to "the ends justify the means." This is not valid excuse for human behavior, so we're to hold god(s) to a lower moral standard than we hold ourselves?

    36. Re:The Prostate by moosesocks · · Score: 1

      I know I'm beginning to drift dangerously offtopic, but people need to realize that the Meadowlands and the Turnpike are the two absolute worst parts of the state. Newark and Camden are both victims of sprawl from NYC and Philly. Unfortunately, these are also the areas of the state that get seen most often by visitors.

      Once you get away from these areas, New Jersey is really quite nice.

      --
      -- If you try to fail and succeed, which have you done? - Uli's moose
    37. Re:The Prostate by tbetz · · Score: 1

      What kind of "intelligent" designer puts a recreational facility next to a waste disposal site?
      You've obviously never visited Riverbank State Park in NY City:

      The only state park in Manhattan, Riverbank State Park makes great use of an otherwise useless area. It's the first park in the Western hemisphere to be built on top of a residential wastewater treatment facility and its elevated address--69 feet above the Hudson River--offers its two and a half million annual visitors fabulous views from any vantage point.
      It smells as bad as it sounds.
    38. Re:The Prostate by kcbrown · · Score: 1

      to even presume you have the barest idea of what such a creature would do and why, and whether that means it "cares" about its creation or you or not is totally irrational.

      I disagree. It's completely rational. The argument I put forth has no flaws in it, no logical way out. The conclusions I draw are the direct result of the definitions of the terms being used. I don't make the claim that an omnipotent, omniscient being created the universe we live in. Others do. I'm simply showing the logical consequences of that claim.

      You're therefore limited to either claiming that said creator cannot be logically analyzed (irrelevant: I'm analyzing the belief system itself, and the analysis of the creator in that belief system is only in the context of the combination of that belief system and the observable world, and only to the extent necessary to show the belief system for what it is) or that the meanings of "love" and "caring" here are somehow different than what we use for normal conversation. If you (the proverbial "you", not you personally) choose the latter, then the claims you might make about the intentions of said creator also suddenly have a very different, and likely more sinister, meaning (because the only way to change those definitions so that they are consistent with the rest of the belief system is to change them to match the kind of "love" and "caring" a wife beater has towards his wife).

      Can people still choose to believe that way? Sure. Nothing stops them from believing in a logical contradiction. But it is a logical contradiction, and that's ultimately my point.

      --
      Use 'slashdot stuff' in the subject line in any email you send me if you want to get past the spam filter.
    39. Re:The Prostate by WaZiX · · Score: 1

      Man made New Jersey with the recreational facility next to the waste disposal site.
      God made man with the recreational facility next to the waste disposal site.

      Proof that man made God in his image!

    40. Re:The Prostate by Micah · · Score: 2, Insightful

      > What kind of "intelligent" designer puts a recreational facility next to a waste disposal site?

      *Sigh*. I'll bite, and hope I'm not modded through the floor. Even though the designer did it that way (note that I'm not arguing for or against evolution here ... but I do believe in God's involvement, however he did it) he seemed to figure out how to make it work. I am copying a message I recently read on some web forums dedicated to discussing sexuality from a Christian perspective. The context is oral sex:

      ********
      One of the really cool things about God's design of the male body is this: When sexual arousal begins, two very important things for OS begin to take place. First, the opening to the bladder is squeezed shut, making it difficult for urine to pass through (which is why it's difficult for guys to urinate while they have an erection). Second, the Cowper's glands, which are located close to the prostate, secrete a substance that neutralizes any remaining urine in the urethra.

      So, when your FW performs OS on you, rest assured that she will not be getting any urine in her mouth!

      Just another cool thing God did to bless the marriage bed, I figure! :)
      ******* [end message copy] *********

    41. Re:The Prostate by John+Newman · · Score: 3, Interesting

      One of the really cool things about God's design of the male body is this: When sexual arousal begins, two very important things for OS begin to take place. First, the opening to the bladder is squeezed shut, making it difficult for urine to pass through (which is why it's difficult for guys to urinate while they have an erection). Second, the Cowper's glands, which are located close to the prostate, secrete a substance that neutralizes any remaining urine in the urethra.

      So, when your FW performs OS on you, rest assured that she will not be getting any urine in her mouth!
      I really do appreciate the thought that God is looking out for blowjobs, but a more straightforward explanation is that urine is bad for sperm. Sperm don't tolerate the acidity of urine well (ejaculate is alkaline in order to neutralize the acidic vaginal environment); the nitrogen waste compounds reduce motility; and the volume dilutes out the nutrients sperm need to maintain their activity. Any male anatomy that mixed sperm and urine would be very unlikely to be passed on to future males. Few aspects of biology illustrate the effects of reproductive selection more clearly than the mechanics of reproduction itself.
    42. Re:The Prostate by Anonymous Coward · · Score: 0

      but that implies a connection between God and New Jersey that makes me uncomfortable.

    43. Re:The Prostate by iapetus · · Score: 1

      You've clearly never worked in software engineering, have you?

      --
      ++ Say to Elrond "Hello.".
      Elrond says "No.". Elrond gives you some lunch.
    44. Re:The Prostate by Antique+Geekmeister · · Score: 1

      You haven't read many mid-term papers by students studying Perl, have you?

    45. Re:The Prostate by Anonymous Coward · · Score: 0

      Are you kidding me? The rest of it sucks too.

    46. Re:The Prostate by Dirtside · · Score: 1

      as a devil's advocate

      I think, technically, you're playing God's advocate on this one ;)

      To address your advocate's position, though: The very attributes of omnipotence and omniscience automatically preclude needing to ever create anything. Regardless of whether we puny humans could understand God's purpose in making Creation, purpose itself is something no omnipotent, omniscient being would ever have. Purpose implies the intent to cause change to some effect, no matter what the reason, and if you're omniscient, you already have all possible information that any change could bring about, so the change is redundant and pointless -- and if you're omnipotent AND omniscient, you're always where you want to be, and change is contraindicated. If God existed as Christianity claims, Creation would not.

      The other half of it is that every single time I've ever had someone tell me that God's purpose is unknowable and we puny humans can't understand a thing about him, they in every case have either already said, or proceed to say, that they know what God wants (for us to love him and be happy), even though they just told me God's will is unknowable. It really pisses me off. (I don't think you're one of those people, I just wanted to shoehorn that in here.)
      --
      "Destroy science and religion. Science would re-emerge exactly the same; but not religion." - Penn Jillette, paraphrased
    47. Re:The Prostate by Khomar · · Score: 1

      I disagree. It's completely rational. The argument I put forth has no flaws in it, no logical way out.

      I would be careful about making such bold proclamations as this. Next you will be saying that you never make mistakes. And I know that that is not true. We were all children at one point after all.

      The point the parent was so logically trying to make is that we cannot possibly know the purpose of omnipotent, omniscient God. Until you can see the "big picture", how can you possibly judge a creature that is infinitely greater than yourself. I cannot claim even remotely to understand the purposes of God, but perhaps a few examples can be given for how love and pain can co-exist. Consider discipline. Parents often cause "pain" on the part of their children to re-inforce a behavioral standard. This does not need to constitute spanking, because even a "time-out" can be considered very "painful" to a young child. However, you would not consider a parent who is trying to guide their child toward adulthood as not loving their child. Rather, the parent who never disciplines their child and never re-directs their immaturity is the one who hates their child because they do not want them to grow up to be well-adjusted adults who are mentally prepared to face the world.

      Also, great learning often comes from pain. Some of the most compassionate and loving people in the world are those who have experienced the most pain. People who have suffered from poverty or disease or torture or depression. If you have gone through painful processes, you know that often you come through much wiser and you care more for those you see around you who are suffering. If you talk to parents of highly disabled children, you almost always hear them talk about how their child is so loving and caring - a sweet, beautiful person.

      You will probably quickly dismiss what I have said so far as "illogical", but how can you hope to discuss logic as a finite, mortal being with limited knowledge, experience, understanding and wisdom with an immortal, all-powerful, all-knowing being whose very existence transcends time? Who are you to tell God that His way is the wrong way or that He is not loving? Can we even be totally sure that we completely understand what love really is?

      By the way, Biblical scholars have debated this very issue many times over the centuries. If you are truly curious how more logical thinkers than myself have handled these issues, I encourage you to read some of their books. You might start with "The Problem of Pain" by C.S. Lewis.

      --

      I believe in de-evolution. God made the world perfect, man fell, and its been going downhill ever since!

    48. Re:The Prostate by truckaxle · · Score: 1

      First prostate trouble typically happen in late midlife after the period where a male can have and raise children.

      Second evolution, just like a large software development program, has to make do with a bad decision made early in the formative design process.

    49. Re:The Prostate by kcbrown · · Score: 1

      The point the parent was so logically trying to make is that we cannot possibly know the purpose of omnipotent, omniscient God. Until you can see the "big picture", how can you possibly judge a creature that is infinitely greater than yourself.

      It's not necessary to know the "purpose" of said God. Nor is it necessary to see any "big picture". The definitions of the words involved do not leave enough ambiguity to counter my argument.

      I don't seem to be making making my point very well here, do I?

      Let me go through this step by step. One point I should make before I do: the "universe" I refer to in the below includes everything: the currently visible universe, the afterlife, everything.

      1. An omniscient being knows all. That means that an omniscient being always knows exactly what will happen as a result of any action it takes. Do you disagree with this? I hope not, because that's pretty much the definition of "omniscient".
      2. An omnipotent being is capable of doing basically anything, especially when it comes to setting up the rules of a universe. In short, the omnipotent being can define the rules of the universe arbitrarily. Do you disagree with this? I hope not, because that's basically the definition of "omnipotent".
      3. The above two when combined together and when applied to the creation of a universe mean that the universe the being winds up with is exactly what the being intends it to be, no more and no less. If this is not so then one of the above two attributes must not apply to the being in question, because this follows directly from the two definitions involved.
      4. Pain and suffering exist in the universe. Do you disagree with this? If so, check yourself into the local insane asylum, because it means that you're not willing to acknowledge even your own pain and suffering, much less that of others.
      5. The above two, combined, mean that pain and suffering exist in this universe because the omnipotent, omniscient being wants it to exist. That means that the being in question wants the living beings in this universe to go through the pain and suffering that the universe forces them to endure.
      6. By the very definitions of the words "love" and "caring", no sentient being would intentionally allow someone/something it loved and cared about to needlessly suffer. Hence, if said sentient being had it within its power to prevent someone/something it cared about from needlessly suffering, it would do so. Do you disagree with this?
      7. From the previous points, an omnipotent and omniscient being defines what is needless. Therefore, from the point of view of an omnipotent and omniscient being, all suffering is needless suffering, because the being in question can simply redefine the universe to remove the need for suffering. Do you disagree with this? If so, then you must disagree with one or both of the first two assertions.
      8. Therefore, if an omnipotent, omniscient being created the universe, the only way it can also love and care about us in the way we normally mean when we say "love" and "care" is for it to be clinically insane, like the person who beats his spouse while simultaneously claiming to love his spouse.
      9. Therefore, a belief system which asserts that a sane omniscient, omnipotent being which "loves" us happened to also create the very circumstances in which we are forced to endure pain and suffering is an internally contradictory belief system.

      Now, which of the above points do you disagree with? The logic itself gives you no place to go. The definitions involved give you no place to go. The only way out of the above for someone who actually has the belief system in question is for them to redefine one or more of the terms involved, which is not allowed. If you want to redefine a term, choose a different word instead.

      It's not my fault some people have chosen to hold to an internally contra

      --
      Use 'slashdot stuff' in the subject line in any email you send me if you want to get past the spam filter.
    50. Re:The Prostate by rburgess3 · · Score: 1

      Actually, the problem with this line of reasoning is that in the Judeo-Christian-Muslim theology, God is omni-potent and omni-benevolent (also omniscient, but that's a whole 'nother ball of impossibilities), and hence has a positive responsibility to affect good within the world. The existence of evil and harm in the world doesn't disprove the existence of God per-se, but it does disprove his omni-benevolence.

      Basically, it boils down to: If you have the ability to do good, failure to do so is evil. And that is a perfectly reasonable judgment because as God is characterized as omni-potent then it is impossible to give credence to the idea that 'this person had to come to harm so God's plan could work out.'

    51. Re:The Prostate by Anonymous Coward · · Score: 0

      Clearly, Intelligent Design proponents have experienced the joy of truly mind-blowing anal sex.

    52. Re:The Prostate by quickgold192 · · Score: 1

      because our brains still have to recover from all the damage incurred by free radicals throughout the day.if you can think of a better way, go mutate.

    53. Re:The Prostate by brian0918 · · Score: 1

      "What kind of "intelligent" designer puts a recreational facility next to a waste disposal site?"

      Unless you're Neil deGrasse Tyson, you should probably credit him as the source of that hilarious quote, instead of passing it off as your own.

    54. Re:The Prostate by Dr.+Zowie · · Score: 1

      Kcbrown, the weak point in your argument is point (6), which is what Khomar is attacking. He seems to be asserting (and other scholars, such as C.S. Lewis [to whom Khomar referred], have asserted) that there must be a higher purpose to the suffering in the world. Khomar alluded to a possibility that pain may be here to teach us. One who subscribes to that belief would compare God more to a parent who spanks his child, than to a husband who beats his wife.

      Personally, I think it's a bunch of hooey. If we were designed by an Engineer, He sure sucked at it. Anyone who's looked at the "design" of mammals knows something's up. I find it hard to believe in an omniscient, omnipotent (or even quasi-omniscient, quasi-omnipotent), caring deity without also assuming that He spends most of His time high on crack.

    55. Re:The Prostate by Anonymous Coward · · Score: 0

      Yeah, and it's a great recommendation for survival of the fittest too. Well, actually not. You could easily consider it a reason why human males are "unfit" and not worthy of survival.

    56. Re:The Prostate by Khaed · · Score: 1

      I know all of Jersey doesn't look like a crackwhore infested slum. I dated a girl who grew up in Jersey, and it always annoyed her when I made cracks about it, but then, it annoyed me when she opened her mouth, so we were even. It's just one of those jokes, like the French being cheese eating surrender monkeys.

      wait, that one is true.

      Like New Yorkers being assholes. ...shit.

      Well, you get the point.

    57. Re:The Prostate by TheoMurpse · · Score: 1

      I've always thought that a good argument could be had via mathematics when considering "Daddy, if God exists, why did mommy die when she was 35?" That argument is (granted, a five year old doesn't understand this argument ;)

      1. God exists forever.
      2. Man exists for finite time.
      3. Therefore, from God's timeline, to exist for finite time is functionally equivalent to existing for zero time.
      4. Therefore, from God's timeline, dying is equivalent to having never been born/conceived/created.
      5. Therefore, Mommy dying was no more cruel on God's part than she and I were by deciding not to have another baby.

    58. Re:The Prostate by kcbrown · · Score: 1

      He seems to be asserting (and other scholars, such as C.S. Lewis [to whom Khomar referred], have asserted) that there must be a higher purpose to the suffering in the world. Khomar alluded to a possibility that pain may be here to teach us.

      Of course, since the knowledge in question can simply be downloaded into our brains or placed there to begin with (take your pick), this argument is nonsense. In short, the suffering is unnecessary to achieve the goal, and if it is, it's only because this omnipotent + omniscient being wants it to be necessary.

      If this God wants us to know something, then we will know it, and if it wants us to not suffer to achieve that knowledge, then we won't. The suffering is completely independent of the knowledge. That's what omnipotence + omniscience implies. For an omnipotent + omniscient being, there is no such thing as cause and effect, no such thing as constraints, no such thing as a necessarily indirect way of achieving a goal. Whatever such a being wants, it gets directly and automatically.

      If such a being doesn't want us to suffer, then we won't. That we do means that it must want us to (or that it's clinically insane, or that it simply doesn't care). The definitions of the words involved leave no other alternatives on the table.

      --
      Use 'slashdot stuff' in the subject line in any email you send me if you want to get past the spam filter.
    59. Re:The Prostate by asninn · · Score: 1

      Hey, at least we don't have a cloaca. Imagine how much fun life would be if our genitalia and waste disposal facilities were not just next to each other but in fact ONE AND THE SAME! :)

      --
      butter the donkey
    60. Re:The Prostate by Alsee · · Score: 1

      So, when your FW performs OS on you

      Ok, "OS" is clearly Oral Sex. But I sat here for a long time trying to figure out WTF "FW" stands for and coming up blank. Eventually I did think of one possible meaning for it and I guess it maybe fits in there... maybe it stands for "Future Wife"... which carries the amusing implication that it is specifically the FW performing OS... in contrast to the W who does not. Heh.

      Personally I think it should have been written as "So, when your SO performs OS on you"... where SO is (?obviously?) Signifigant Other. I think SO / OS is a catchy way to put it.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    61. Re:The Prostate by Polly_Morf · · Score: 0

      (which is why it's difficult for guys to urinate while they have an erection)

      Oh, please! This is a conscious move. It's not like anyone would actually want to piss themselves in the face...

    62. Re:The Prostate by The+One+and+Only · · Score: 1

      The bottom line is that if you believe in an omnipotent, omniscient creator, then you believe in an evil, sadistic being, by definition, and one need only look at the world to see it. No being that cared about what it creates would intentionally set up the universe such that pain and suffering were possible, much less undeserved pain and suffering, and certainly not one in which pain and suffering were necessary for survival (i.e., hunters and prey).

      What makes you presume that God takes pleasure in our petty suffering, or should even care how we feel? You can't apply human morality on God.

      --
      In Repressive Burma, it's not just your connection that dies. slashdot.org/comments.pl?sid=314547&cid=20819199
    63. Re:The Prostate by OriginalArlen · · Score: 1

      "Think of the human body as being like a car. Now, you may ask, why is the exhaust so close to the ignition?" -- Barry Cryer

      --

      Everything I needed to know about life, I learnt from Blake's Seven
    64. Re:The Prostate by Micah · · Score: 1

      > maybe it stands for "Future Wife"

      Correct. Keep in mind that this is coming from some Christian forums, where sex is believed to need to wait for marriage. The context is the question of an engaged guy worried about his future wife, after marriage, during OS.

    65. Re:The Prostate by Phyvo · · Score: 1

      Are you saying that God needed a purpose to create the world?

      As I understand it, according to the Bible, he created it because he wanted to, not because he needed to.

    66. Re:The Prostate by dylan_- · · Score: 1

      why in hell haven't we evolved past needing sleep yet?!
      Evolution is all about who gets to have sex. It's no coincidence that we refer to having sex as sleeping with someone. Presumably if you don't sleep you don't spend the social time going to sleep that encourages sex. Just a wild guess, I have no evidence for this theory, but I haven't heard a better one (feel free to contribute!)
      --
      Igor Presnyakov stole my hat
    67. Re:The Prostate by Anonymous Coward · · Score: 0

      And why aren't the balls on the *inside*? I mean, it would save alot of trouble. If I was to redesign humans I would certainly do it *alot* different (how about breathing underwater along with retractable fins as well as wings for flying! and frickin laser beams!).

    68. Re:The Prostate by N3wsByt3 · · Score: 1

      "The bottom line is that if you believe in an omnipotent, omniscient creator, then you believe in an evil, sadistic being, by definition[]"

      Indeed, this is the only logical deduction one can make. If you accept it as a given that God is omnipotent, omniscient and cares and loves about us, humans, then there is a clear contradictio in terminis.

      I'll respond to some critics of your post below. ;-)

      --
      --- "To pee or not to pee, that is the question." ---
    69. Re:The Prostate by j+h+woodyatt · · Score: 1

      I could think of much more efficient ways to keep brain size under control...

      --
      jhw
    70. Re:The Prostate by ipsender · · Score: 1

      ...but not as a result of natural selection... the parsimony inherent is that no other genetic changes need to take place. Anyway the only important natural selector ATM is global warming - may the smarter, more heat and aridity-adapted ethnic group win :-) - tongue-in-cheek of course, we know that man's capacity for altruism extends beyond race creed and colour - not. Pelvic outlet measurement won't matter a damn.

    71. Re:The Prostate by j+h+woodyatt · · Score: 1

      Point conceded. Damn biologists are the most depressing people on the goddamn planet.

      --
      jhw
    72. Re:The Prostate by Khomar · · Score: 1

      Consider this: God created a world with pain and suffering with the full knowledge that He Himself would enter that world as a man, endure that same suffering we do and die one of the most painful deaths man would ever invent so that we would turn back to him. The universe was created to demonstrate God's glory. Pain and suffering were created so that He could demonstrate His love.

      --

      I believe in de-evolution. God made the world perfect, man fell, and its been going downhill ever since!

  10. And? by Kingrames · · Score: 4, Funny

    99.9% of humans have more than the average number of arms.
    So why does this statistic matter?

    So long as the people in charge are smarter than that, we should be okay.

    *ulp*

    --
    If you can read this, I forgot to post anonymously.
    1. Re:And? by lurker412 · · Score: 1

      Unfortunately, many of the people in charge are elected by these morons. It matters.

    2. Re:And? by Bo'Bob'O · · Score: 1

      So long as the people in charge are smarter than that, we should be okay.

      You must be new here. Welcome to the Untied States, I'm sure learnig how the government works for the first time must be exciting.

    3. Re:And? by Anonymous Coward · · Score: 0

      Sorry, I just totally don't get this. More than the average number of arms? Could you explain it for those of us who think that 2 == 2???

    4. Re:And? by PontifexPrimus · · Score: 1

      If you count the arms of a thousand people, it's possible that there will be an amputee among them; thus the mathematical average (1999 arms divided by 1000 people, for instance) will come to a number slightly smaller than two. If you try to calculate the average number of arms from the total population of the world, you'll get a number also lower than two, since amputees or people born without arms will outnumber genetic defects where people are born with more than two. Therefore, most people have more than the "average" number of arms, since 2 > 1.99999...
      It's a classical example of showing why in statistics other measures are used than just the mathematical average; there is, for instance, the median which will give you the value that shows up most often in a given sample. The median number of arms of humans is, indeed, two.

      --
      -- Language is a virus from outer space.
    5. Re:And? by Bill+Walker · · Score: 1
      t's a classical example of showing why in statistics other measures are used than just the mathematical average; there is, for instance, the median which will give you the value that shows up most often in a given sample. The median number of arms of humans is, indeed, two.

      Actually, the mode is the value that shows up most often. The median is the 50th percentile, i.e. the value in the middle of an ordered list of all observed values. In this particular case, both the median and the mode are 2, however, so your point still stands.

      --
      Please, for the love of God, no more car analogies.
    6. Re:And? by Anonymous Coward · · Score: 0

      You must be new here. Welcome to Earth, I'm sure learning how sarcasm works for the first time must be exciting.

      (note the *ulp* at the end of the post you quoted)

  11. Glass half full? by Anonymous Coward · · Score: 4, Interesting

    It wasn't that long ago that we were having evolution trials, witch burning and with most of the world's states controlled by various churches.

    Even with the rise of the evangelistic movement and the ties many have to the anti-evolution movement, they still pull only 48%.

    Sounds not half bad to me.

    1. Re:Glass half full? by catbutt · · Score: 1

      Um, I think we are still having evolution trials.

    2. Re:Glass half full? by posterlogo · · Score: 1

      That's actually a pretty neat way of looking at it. I'm just sad the % of people who don't believe in evolution is the highest in the US as compared to every other developed nation (and most developing nations). For me in California, sometimes I lose sight of how big this country is -- I don't know many people who doubt evolution, but I guess there's the large central region full of hillbillies.

    3. Re:Glass half full? by glwtta · · Score: 1

      That could have been a comforting way to look at it, but we are not comparing these numbers to pre-Enlightenment thinking, we are comparing them to other "developed" countries.

      --
      sic transit gloria mundi
    4. Re:Glass half full? by Anonymous Coward · · Score: 0

      And G.W Bush pulled less than half of the votes, but look what happened.

    5. Re:Glass half full? by maxume · · Score: 1

      As a hillbilly, I have to say, I don't know anybody who doubts evolution, or more accurately, I don't know that anybody I know doubts evolution. I don't really talk to people about it though.

      Given that California tried to sue companies for selling them cars, I wouldn't be so quick to draw that line.

      --
      Nerd rage is the funniest rage.
    6. Re:Glass half full? by adrianmonk · · Score: 1

      Even with the rise of the evangelistic movement

      I think you mean evangelical movement.

    7. Re:Glass half full? by nwbvt · · Score: 1

      Actually, if the question was "Is evolution well-supported by evidence and widely accepted within the scientific community?", then answering "no" isn't the same as "rejecting evolution". With any subject as complex as the origin and the development of life, there is going to be a lot of people who are simply uncertain. I imagine a lot of those people do not believe believe creationism over evolution, they are just undecided (hell a lot of them probably just don't care, as much as most /.ers love science, a lot of the population doesn't). Those people don't belong to the creationist movement, they are simply in the middle ground.

      And then there are the fringe theories like that our ancestors flew here from an alien planet. They also don't belong to either side.

      --
      Mathematics is made of 50 percent formulas, 50 percent proofs, and 50 percent imagination.
  12. Fact vs. Faith, so sad that it's a conflict. by Anonymous Coward · · Score: 2, Funny

    Thank goodness that most of those surveyed are not in the scientific community!

    A: 'We need a new therapy to help people with Disease X.'

    B: 'Here try this.'

    A: 'Did you test it? Is there any reason to think it works?

    B: 'None of that matters! I believe it works.'

    1. Re:Fact vs. Faith, so sad that it's a conflict. by lavid · · Score: 2, Insightful

      Yeah, they're just in charge of the executive branch....

      I'm pretty sure that this is just as bad since we see these people putting words in the mouths of and censoring federally funded scientists.

      --
      If Bush wants to kill the terrorists, he should jump off a cliff.
  13. Boolean AND in a poll.. by Anonymous Coward · · Score: 0

    I haven't RTFA, but it seems putting boolean logic in a poll question is a bad move.
    I mean, can we be sure the 48% actually think evolution isn't accepted in the scientific community, or were they responding mostly to the first condition?

    I suspect most people took the AND to be an OR so to speak.

  14. The mindset by dsanfte · · Score: 2

    The mindset is simply this: Any agenda, promoted by anyone, that contradicts something said in the bible, is an attack on its literal truth and thus, an attack on fundamentalist Christianity.

    That's all you really need to know.

    --
    occultae nullus est respectus musicae - originally a Greek proverb
    1. Re:The mindset by Anonymous Coward · · Score: 0

      >The mindset is simply this: Any agenda, promoted by anyone, that contradicts something said in the bible, is an attack on its literal truth and thus, an attack on fundamentalist Christianity.

      It is this, how can I get support to be elected. I can pretend to care about this evolution thing and make it to be a big deal and then do whatever else I want on other issues. I'll have free reign in everything in most areas except for say evolution and abortion. As long as I support these issues I'll have a mob of people who think I am a fantastic person to be elected. Me and my other friends, we try to make it so the only ideals that are important in a candidate are stuff we really don't care about.

    2. Re:The mindset by dsanfte · · Score: 1

      Well yes, that's true that many politicians take that stance, but it only works because people are hating on evolution, etc, due to the reason I gave above.

      --
      occultae nullus est respectus musicae - originally a Greek proverb
  15. How many non-religious don't believe in evolution by NonViviDaSola · · Score: 0

    I am curious as to how many non-religious individuals do not believe in evolution. That might indicate how many people are not familiar with the theory.

  16. Loaded Post by Jalwin · · Score: 1

    This post is so loaded it's laughable.

  17. Redundant flamebait by isaacklinger · · Score: 1

    Is there a decline in the belief in Evolution? Isn't 48% on par with the rest of the world? Should this be discussed every time large poll is conducted? Do we really need a 600-post discussion criticizing the US education system and society?

    1. Re:Redundant flamebait by drapeau06 · · Score: 1

      Do we need to frequently re-hash debate? Well, if it helps at all to drag the US away from ignorance and toward an enlightened future, I say 'yes'.

    2. Re:Redundant flamebait by erkokite · · Score: 1

      No, not really, especially among western nations. We have a higher percentage of belief in creationism than pretty much everyone but Turkey.

    3. Re:Redundant flamebait by Anonymous Coward · · Score: 0

      "The only country where acceptance of evolution was lower than in the United States was Turkey (25%)."

    4. Re:Redundant flamebait by Freexe · · Score: 2, Informative
      According to your own source - no

      International


      A study published in Science, compared attitudes about evolution from the United States, 32 European countries (including Turkey) and Japan. The only country where acceptance of evolution was lower than in the United States was Turkey (25%). Public acceptance of evolution is most prevalent in Iceland, Denmark and Sweden at 80% of the population.

      http://www.livescience.com/php/multimedia/imagedis play/img_display.php?pic=060810_evo_rank_02.jpg&ca p=A+chart+showing+public+acceptance+of+evolution+i n+34+countries.+The+United+States+ranked+near+the+ bottom%2C+beat+only+by+Turkey.+Credit%3A+Science
      --
      "In a time of universal deceit - telling the truth is a revolutionary act." - George Orwell
    5. Re:Redundant flamebait by oceanstream · · Score: 1

      Yes we do. Education is the key to solving so many of the world's problems, and one of the few single nations with enough power/influence to actually SOLVE some of these issues has an abysmal education system. Does it need to be discussed again? Yes, louder and louder every time, and in more and more public places until those with the power to rectify the situation listen. Slashdot is one avenue to get that message out, hopefully the people who create a 600-post discussion about it are as passionate about the subject offline as they are online.

    6. Re:Redundant flamebait by Vexorian · · Score: 1

      Do we really need a 600-post discussion criticizing the US education system and society?
      Hell yeah. How else do you think it would improve?
      --

      Copyright infringement is "piracy" in the same way DRM is "consumer rape"
    7. Re:Redundant flamebait by G1975a · · Score: 1

      Do we really need a 600-post discussion criticizing the US education system and society? Hell yeah. How else do you think it would improve?
      Yes, why bother? Current students won't be able to read it anyway.
  18. April Fools by pseudosero · · Score: 2, Insightful

    That's clever, April fools joke the day before April. It has to be. Please.

    --
    sometimes, nothing.
    1. Re:April Fools by Marbleless · · Score: 2, Funny

      God, I hope so .... oops! ;)

      --
      --I thought I was wrong once, but I was mistaken.
  19. Thank God!! by spmallick · · Score: 2

    Science is not done by consensus. If it were, the world would be flat with the sun revolving around it.

    1. Re:Thank God!! by Mawginty · · Score: 1

      I'm confused. Is that a joke? I thought science WAS done by consensus. Maybe you're referring to the fact that science is done by a consensus exclusive to the scientific community?

      If it's a joke, you're funny. It is ironic that a consensual process can end up changing minds. Ironic and also very validating of the scientific method.

    2. Re:Thank God!! by Scrameustache · · Score: 1

      Science is not done by consensus. If it were, the world would be flat with the sun revolving around it. Yeah, bring up Gallileo and the church's denial of his proof. THAT will help discredit the current heretic scientists!
      --

      You can't take the sky from me...

    3. Re:Thank God!! by Farmer+Tim · · Score: 1

      Science is not done by consensus. If it were, the world would be flat with the sun revolving around it.

      And Mythbusters would be really, really boring.

      "Confirmed...confirmed...confirmed...confirmed..."

      --
      Blank until /. makes another boneheaded UI decision.
  20. We should prove it! by BillX · · Score: 1

    We should kill these people, so they don't reproduce.

    --
    Caveat Emptor is not a business model.
    1. Re:We should prove it! by Anonymous Coward · · Score: 0

      That's my concern with evolutionists like you...you have no moral compass because you believe your existence is accidental.

    2. Re:We should prove it! by Anonymous Coward · · Score: 0

      I find it funny that someone like yourself is defending evolution, yet you don't seem to understand it in the least. Beliefs are not hereditary, sorry to burst your bubble.

    3. Re:We should prove it! by Anonymous Coward · · Score: 0

      You fail at understanding evolution. By the theory of evolution, ones existence at this moment is anything but accidental.

      Also, good job with that whole moral compass thing during all those centuries when you slaughtered men, women and children who didn't think like you.

    4. Re:We should prove it! by resonte · · Score: 1

      I believe in evolution and that my existence is just accidental. However, I also believe that displaying compassion to others and yourself is the only way to escape the suffering you experience from life. As being selfish means you are still controlled by your evolutionary desires and attachments. Evolution (or your primitive desires) doesn't have your own happiness in mind. It may be self gratifying for a while (lusting/sexing someone), but quickly turns into despair (attachment to appearance and therefor loss of self esteem) . (note: I'm a Buddhist/Athiest)

      --
      \(^o^)/
    5. Re:We should prove it! by BillX · · Score: 1

      *woosh*

      --
      Caveat Emptor is not a business model.
  21. Qaeda by j35ter · · Score: 1

    Why do you fight OBL and his Qaeda comrades anyway? After all you almost share the same belief...

    Oh, marketshare competition I guess :)

    --
    Delta-Mike November Bravo Tango
  22. Re:Loaded Post by drapeau06 · · Score: 1

    I'll laugh harder when (if?) this widespread popular ignorance ceases to be a barrier to progress.

  23. So much for the claim of unchecked liberalism by Pyrrhic+Diarrhea · · Score: 1

    one-third (34 percent) of college graduates say they accept the Biblical account of creation as fact.

    If that is true then what happened to all of those God-hating effete liberal carpet-munching college profs? Surely this 34% would have never made it through four or more years of constant haranguing by the Godless elites.

    In a related note, perhaps this is an indictment against some diploma mill universities not stressing analytical thinking, much less science?
  24. I know why by geek · · Score: 5, Insightful

    Most Americans (people over the age of 35ish) were never taught evolution in school and those who were have been taught poorly. I didn't realize the piss poor job my teachers did in junior high and high school until I took an anthropology class in college. People still like to quip that we evolved from monkeys but don't realize we evolved seperate from monkeys and share a common ancestor.

    The ignorance to evolution is amazing in this country. It's no surprise at all people haven't embraced it here like they have overseas in Europe.

    1. Re:I know why by antiMStroll · · Score: 1

      Cause? Or symptom? Perhaps the reason you weren't taught evolution is the same forces comprising the 48% also had a hand in designing your school curriculum. BTW, not just overseas. Canadians are, or at least were when I attended, taught evolution well before post-secondary education.

    2. Re:I know why by geek · · Score: 1

      I would argue cause. It's the cycle of "hand me down" belief systems. This country, though it may not seem like it to some, still clings heavily to it's puritan heritage. It's very difficult in this country to break tradition.

    3. Re:I know why by misanthrope101 · · Score: 1

      The ignorance to evolution is amazing in this country. It's no surprise at all people haven't embraced it here like they have overseas in Europe.
      The problem isn't just the lack of education, but the outright disinformation we get from our entertainment. Yes, I know it's entertainment, but Americans at least seem to conflate the two. Think of what lessons about evolution we draw from movies like The X-Men, or that movie actually called Evolution, with that X-Files guy in it. How many movies have you seen where the monster "evolves" new capabilities? It's fairly horrible. With "understanding" like that, I'm not sure what value it is when a person on the street says they do believe in evolution. I'd rather ask them to explain it, even at a basic level.
    4. Re:I know why by Seule · · Score: 1

      I'm afraid of Americans. This just helps to illustrate why.

    5. Re:I know why by TheoMurpse · · Score: 1
      Note: I know Venezuela isn't in Europe.

      The ignorance to evolution is amazing in this country. It's no surprise at all people haven't embraced it here like they have overseas in Europe.
      My girlfriend is from Venezuela, a very Catholic nation. However, no one over there has a problem with evolution, she says, because when taught in school, no teacher is like MAN CAME FROM MONKEYS!!!one!11! Instead, they just teach the process, and the students are never confronted with having to decide if they like the fact that monkeys and humans share a common ancestor.

      In the US, it just seems that we've always made a religious argument out of the man-monkey combination, and that's what this all comes from. If this wasn't the CENTRAL TENET of evolution as taught in secondary schools in the US, we wouldn't have this problem.
  25. The Thirty-Percenters by ewhac · · Score: 4, Insightful
    ...And 33% of people polled still think Bush is doing a good job in Iraq.

    People wonder why this country lost its lead in manufacturing and, most recently, technological development. Why is a fairy tale -- and an expurgated, badly translated fairy tale at that -- so much more compelling than the tools and concepts that allow you to take control of your own life and environment?

    Schwab

    1. Re:The Thirty-Percenters by QuasiEvil · · Score: 1

      Why is a fairy tale -- and an expurgated, badly translated fairy tale at that -- so much more compelling than the tools and concepts that allow you to take control of your own life and environment? Simple (at least IMHO) - people don't want that kind of power or responsibility. It's so much less mentally exhausting to just say "God runs my life" than to try to face up to the fact that you're all alone, and that your decisions influence what happens to you. It's the same lazy-ass phenomenon that's lead to our litigious society (because it's *never* my fault I'm a dumbfuck) and the desire for a nanny-state government (because government knows best, and you should only be able to use your liberties to make "good" choices). Facing up to reality often sucks - people claim they want full control and full knowledge, but I think when it comes down to it, most of them would rather live in blissful ignorance because it's easier.

    2. Re:The Thirty-Percenters by c6gunner · · Score: 1

      Good point. I don't know what's wrong with the other 67%, but I'm guessing it can be attributed to drugs and television.

    3. Re:The Thirty-Percenters by Anonymous Coward · · Score: 0

      "People wonder why this country lost its lead in manufacturing and, most recently, technological development."

      Wow, how prejudiced can you get? Unless, of course, you were being self referential in that statement, which I doubt. You sould like an anti-semite conspiracy theorist. And at least 3 dimwits modded you up. Hooray for bigotry!

      What you lament is not attributable to religious belief. It is due to many factors, but that would be the last of them. Saying that it is proves you are part of the problem and are incapable of helping to fix it.

      And, if "the tools and concepts that allow you to take control of your own life and environment" are so powerful, how come those who do follow this golden path have let the country fall so far? Surely the weakminded and innefective religious nutjobs couldn't stop an enlightened member of whatever erudite and superior group you self-selected yourself to, could they?

      Come on man, you sound like just another hate monger wrapping yourself in the cloak of superior intellectualism.

    4. Re:The Thirty-Percenters by Scrameustache · · Score: 2, Interesting

      People wonder why this country lost its lead in manufacturing Education is not conductive to cheap labour. The uneducated staff the manufacture jobs, not the biologists.
      --

      You can't take the sky from me...

    5. Re:The Thirty-Percenters by r_newman · · Score: 1

      ...And 33% of people polled still think Bush is doing a good job in Iraq.


      You'll probably find that the real figure is a lot lower than that. One of the major problems in the US at the moment is that the Conservatives have been pushing the bullshit idea that it's unpatriotic to criticise the war effort in any country currently under attack by the US, and that it also unsupportive of "our boys and girls in uniform".

      As regards evolution, we here know that there is plenty of scientific evidence that the universe was not created 10,000 or 6,000 or 4,000 years (or whatever figure they've decided on this week) ago, however many of those who believe in evolution do not know of this evidence because it is not spoonfed to them in small easily-digestible chunks. These are people who watch soap-operas, and American Idol and other "reality tv" junk and they will believe whatever is made easiest for them to understand.

      Of course the religious extremists are also a factor, because they shout long and loud enough to be heard by the aforementioned reality tv junkies. There is nothing wrong with being religious of course, but those who believe that either they are better, or that their opinions are somehow more valid because of their religious beliefs are fanatics, and I make no apology for labeling them as such.

      Goodnight.

      --
      Bzzzzzt..."AAAAaaaaarrrgh!!!" Thud.
    6. Re:The Thirty-Percenters by HellYeahAutomaton · · Score: 1

      There's a bigger logic flaw here...How many logical people waste their time with Newsweek polls? I, for one, safely conclude that Newsweek is chock full of readers that are religious zealots. Can I get a recount?

    7. Re:The Thirty-Percenters by Selfbain · · Score: 1

      Good then maybe the US will see a manufacturing boom.

      --
      Well, it has never been successfully tested.
    8. Re:The Thirty-Percenters by Anonymous Coward · · Score: 0

      People being so poorly educated that they don't understand basic science isn't part of the problem?

  26. Even Jesus talked in parables by sycomonkey · · Score: 1, Insightful

    If God had physically come down to earth, found a man living in one of the first civilizations, and tried to explain to him the Big Bang, stellar evolution, how the Solar System developed, and biological evolution, the man would be totally confused. It takes years in a modern school system to even parse these concepts. If other Christians can take Revelations and half of Jesus's stories figuratively, if they can understand that it didn't actually (or won't actually) happen exactly like that, WHY can't they understand this about Genesis? Is it so hard? I'm confused. It seems obvious to me. It actually follows the scientific evidence vaguely well, ex. "The earth was without form and void" meaning Earth hadn't coalesced from the nebulous cloud of material orbiting the new Sun.

    --
    --The universe will not be altered by forum threads, even those which are very wry. --Tycho Brahe (Penny Arcade)
    1. Re:Even Jesus talked in parables by geek · · Score: 5, Interesting

      There are actually two versions of Genesis, the old Hebrew one where God is not a single being but Ilohim (which is plural and I may have spelled it wrong). Then there is the Christian version which has God as singular and omnipotent, all knowing and all seeing. The problem comes from Calvinism and it's strong (to this very day) influence on Christianity. If Genesis isn't literal to these people the foundation of Christianity falls apart. Evolution directly contradicts the Bible. You can not logically combine the two and have the same religion. Hell the Bible contradicts itself enough as it is, bu when you add evolution, all the theology goes right out the window.

      Check out Calvinism and Arminianism on Wikipedia sometime. Use it as background for reading Miltons paradise lost and you'll begin to understand the history of the debate that still rages on today.

    2. Re:Even Jesus talked in parables by maggiemerc · · Score: 1

      Your comment on the versions of the Bible is true (over the years we've lost a LOT of the Bible's original meaning due to poor translations). However I'm pretty sure you don't mean Calvinism. First Calvinism is a philosophy churches associate with, second Calvinism is all about hard work getting you to heaven. It doesn't call for a literal interpretation of the Bible. Look at the presbys, they are as close to hard line Calvinists as we'll get in this day and age, and they assuredly do NOT interpret the Bible so literally. Same with Arminianism. It is a religious philosophy that serves as a foundation for churches, but it is the churches that actually preach fundamentalism (fundies are they folks that believe in a literal interpretation). And you find fundies in all denominations, not just Protestant. Even the Episcopalians/Anglicans (assuredly NOT Protestant) have an offshoot fundie branch (American Reformed Episcopalian).

    3. Re:Even Jesus talked in parables by Bones3D_mac · · Score: 1

      If God had physically come down to earth, found a man living in one of the first civilizations, and tried to explain to him the Big Bang, stellar evolution, how the Solar System developed, and biological evolution, the man would be totally confused.

      Unlikely.

      Since God in this case apparently made the man in question, I would assume he has everything needed to directly upload that knowlege into the man's brain using the proper RFCs. (Unless, of course, man was invented by something other than God, and God is only monkeying around with a technology he lacks the proper understanding of.)

      --


      8==8 Bones 8==8
    4. Re:Even Jesus talked in parables by geek · · Score: 1

      You are correct. I was merely using it as a type of background into the mentality of the people debating this topic. Calvinism is interesting in that way as it's more than just a philosophy, it's a complete state of mind and it's impact on the world was larger than anyone today can truly understand. That impact continues today and it's that state of mind we're trying to convince. It's a very difficult prospect and not surprising that people are still such hardliners.

    5. Re:Even Jesus talked in parables by Anonymous Coward · · Score: 0

      Try reading _Institutes_ some time, not modern Calvinism, and you might find just how much reading the Bible alone is called for...

    6. Re:Even Jesus talked in parables by Ztream · · Score: 1

      If God had physically come down to earth, found a man living in one of the first civilizations, and tried to explain to him the Big Bang, stellar evolution, how the Solar System developed, and biological evolution, the man would be totally confused.

      Wait, isn't God supposed to be omnipotent?

    7. Re:Even Jesus talked in parables by maggiemerc · · Score: 1

      Hm, I'm not sure it's Calvinism as much as Arminianism, and even then it's a bastardized version set up by the megachurches to make people feel better about themselves. And I'm still not clear on why Calvinism (or Arminianism) is coloring the fundamentalists' views on evolution. Those are both philosophies that call for salvation through proper living and abiding by God's tenets. Neither specifically calls on evangelism to find Heaven. (Evangelism and fundamentalism being the chief reasons people reject evolution.)

    8. Re:Even Jesus talked in parables by geek · · Score: 1

      Neither Calvinism nor Arminianism call for salvation of any kind. They both claim God picks and chooses at random who will be saved through his mercy and with no tangible reason. Calvin stated we had no choice in our salvation and no free will of any kind. We were merely puppets on a string doing as we were intended. Arminianism states the same thing with a caveat saying we can choose only not to obey God but even then, God being all knowing and all seeing planned ahead of time for our disobediences.

      I would suggest looking into them before commenting further as you don't seem to understand the basics of either. I don't mean to be rude but if you don't understand even this (which happens to be the building block and foundation of both ideologies) then you will never be able to connect the dots on what I'm getting at.

    9. Re:Even Jesus talked in parables by Anonymous Coward · · Score: 0

      i believe you are mistaken

      god in the christian sense is not a SINGLe omnipotent being

      but rather 3 separate entities in the form of one

      the holy trinity, the father, the son and the holy spirit

    10. Re:Even Jesus talked in parables by Anonymous Coward · · Score: 0

      Just to clear things up a bit, Calvinism is not at all about hard work getting you to heaven; Jean Calvin was the great popularizer of double (or symmetrical) predestination, the theory that God both knows who will be saved (the elect) and actually causes their election. Calvin's doctrine, then, is that human agency has no significance in determining one's ultimate election or reprobation. Calvin further posited that no one could know whether he or she were saved or not while still alive. It's worth noting, however, that you are correct to believe that Calvin himself was not necessarily a literalist when it came to interpreting Bible (he was when it made his point, and was not when the Bible disagreed with the Augustinian theology with which he worked).

      You may perhaps be confusing Calvinism with Puritanism, which was only ever Calvinist in theory and in practice a whole different animal. Puritans, disregarding Calvin's insistence that no one could ever know her or his own ultimate fate during life, sought to demonstrate their own election to themselves by achieving a good quality of life which, they reasoned, was possible only because God had willed it for them and so, it followed, God would clearly favor them in the afterlife as well.

      Modern Presbyterian (especially PCUSA) theology is similar to Calvinism only insofar as it leans on Calvin's patterns of thought, but disagrees with many of his presuppositions and most of his conclusions. The closest thing to hardline Calvinists we have today in the United States are, in fact, conservative Baptist denominations, who do interpret the Bible much as Calvin did, literally when at all possible and figuratively only when it would undermine their positions.

    11. Re:Even Jesus talked in parables by Anonymous Coward · · Score: 1, Interesting
      Actually, there are even two contradictory creation stories in Genesis itself (chapters one and two):

      Genesis 1:25-27
      (Humans were created after the other animals.)

      And God made the beast of the earth after his kind, and cattle after their kind, and every thing that creepeth upon the earth after his kind: and God saw that it was good. And God said, Let us make man in our image.... So God created man in his own image.

      Genesis 2:18-19
      (Humans were created before the other animals.)

      And the LORD God said, It is not good that the man should be alone; I will make him an help meet for him. And out of the ground the LORD God formed every beast of the field, and every fowl of the air; and brought them unto Adam to see what he would call them: and whatsoever Adam called every living creature, that was the name thereof.


      and also:

      Genesis 1:27
      (The first man and woman were created simultaneously.)

      So God created man in his own image, in the image of God created he him; male and female created he them.

      Genesis 2:18-22
      (The man was created first, then the animals, then the woman from the man's rib.)

      And the LORD God said, It is not good that the man should be alone; I will make him an help meet for him. And out of the ground the LORD God formed every beast of the field, and every fowl of the air; and brought them unto Adam to see what he would call them.... And the LORD God caused a deep sleep to fall upon Adam, and he slept: and he took one of his ribs, and closed up the flesh instead thereof; And the rib, which the LORD God had taken from man, made he a woman, and brought her unto the man.


      http://www.skepticsannotatedbible.com/contra/accou nts.html
    12. Re:Even Jesus talked in parables by maggiemerc · · Score: 1

      No clearly you missed out on "Perseverance of the saints." Once a person has been "chosen" (the believe in Jesus and attend Church and all that good stuff) then they must continue doing good otherwise clearly they weren't really chosen in the first place. Perhaps salvation wasn't the proper word. But it is only living as God intended (because he CHOSE you) you can be saved. If you don't do as God wanted you won't reach salvation in Heaven because God didn't really choose you to begin with. There I spelled it out. I mean I could say your extremely BROAD definition of Calvinism sounds like something picked up off a pamphlet, but I actually want to see how you tie basic Calvinism to modern fundamentalism. And for the record...I'm not even a Calvinist. And yeah, Arminianism says you don't have to be good to go to Heaven (because God planned on you being a dumbass) however it also says you must maintain FAITH to be saved. Salvation is a basic tenet of ALL facets of Christianity and although downplayed in some, it is never non existent (quite unlike fundamentalism which is not always found in Christianity). So yeah, please draw those lines for me. My feeble mine CRAVES your wisdom.

    13. Re:Even Jesus talked in parables by maggiemerc · · Score: 1

      Yeah. I have a tendency to confuse my various Christian philosophies. However I am still very curious as to how modern fundamentalism is so heavily influenced by Calvinism. I how does "damned if you do damned if you don't" equate "Darwin is a fucktard?" That's the main point the first fellow posted and it's the one I'd really like him to explain to me. Because I really do not see it. And naturally he'll go into how I completely misunderstood Calvinism in my above posts...but I think you cleared me up just nicely....so I really do hope he explains his post.

    14. Re:Even Jesus talked in parables by glwtta · · Score: 2, Informative

      There are actually two versions of Genesis, the old Hebrew one where God is not a single being but Ilohim (which is plural and I may have spelled it wrong).

      "A little knowledge is a dangerous thing..." and all that.

      There is no such thing as a Christian version of Genesis, both of the traditions you refer to are in the Hebrew Bible (and they are by no means the only ones, just the most prominent in that part). The word "Elohim" is morphologically plural, but most of the time is used as a singular (ie takes singular verbs and adjectives) for God; sometimes it is used in a plural sense as a general word for "gods" (note the lower case) - eg, "You will have no other gods beside me." It's true that the "Elohist" and "Jahvist" authors/redactors have fairly different conceptions of God (one is more anthropomorphic, for example), but both do talk about a single God. There are some remnants of the earlier Near Eastern concept of a "Divine Council" or "Celestial Host" headed by the supreme god El in the Elohist, and the religion of the time was certainly not monotheistic in our understanding, but the subordinate gods/celestial beings are completely irrelevant in Genesis.

      Those who try to take the Bible literally do have an extremely difficult time of it, not the least of the reasons is the question of what exactly is "the Bible". As an example, when the Masoretic Text and the Septuagint disagree, which do you trust? The much earlier Greek translation or the Jewish tradition which was largely oral for a long period of time? Especially when many of the differences are almost certainly deliberate edits, which happen to be inline with the exegesis of one group, or the other.

      --
      sic transit gloria mundi
    15. Re:Even Jesus talked in parables by sycomonkey · · Score: 1

      Yeh, but I was making the assumption that God was constraining himself to using a human language... That part of my comment didn't come out too clearly, though. stupid languages.

      --
      --The universe will not be altered by forum threads, even those which are very wry. --Tycho Brahe (Penny Arcade)
    16. Re:Even Jesus talked in parables by glwtta · · Score: 1

      but rather 3 separate entities in the form of one

      Actually, I believe it's the other way around: a single omnipotent being in the form of three entities; if that makes any sense.

      I think Muslims, especially, like to take Christians to task for this seemingly polytheistic proposition, but I think to them it's one of those things that, when taken on faith without resort to reason, makes them feel like they've achieved a deeper understanding of their theology. We ask, how can God be both one and three? But they know it to be true. Ergo, we are confused, but they have the light of God with them.

      It has nothing to do with logic, and it's what religions thrive on.

      --
      sic transit gloria mundi
    17. Re:Even Jesus talked in parables by Panzergheist · · Score: 1

      Actually, I wouldn't trust Wikipedia for unbiased, factual information.

      It would make for an interesting read. However, I doubt your knowledge would be greatly increased if you happened to be researching on the day that some wise guy decided to make Calvin receive a visitation from the Flying Spaghetti Monster.

      Humorous? Most certainly. Enlightening? Not so much.

    18. Re:Even Jesus talked in parables by Anonymous Coward · · Score: 0

      Talking of a little knowledge being a dangerous thing, you should probably mention that the documentary hypothesis you're quoting is unfalsifiable, and is just logical conjecture based on scriptural analysis, rather than solid fact.

      I love it too.

    19. Re:Even Jesus talked in parables by Anonymous Coward · · Score: 0
      "8==8 Bones 8==8"

      8==D Boners 8==D

    20. Re:Even Jesus talked in parables by Anonymous Coward · · Score: 0

      > the old Hebrew one where God is not a single being but Ilohim (which is plural and I may have spelled it wrong).

      The Elohim may be taken as meaning 'the family of El'. El was the leader of the Canaanite panthean and had many offspring including Jehovah and 'Baalim'. Baalim is most likely 'the family of Baal' and includes the several Baal gods such as Baal Zebub (Baelzebub).

      It is most likely that El was a real person, a warlord or god-king, and his offspring, such as Jehovah and the various Baals, ran outlying territories that they expanded into. Jehovah had the good fortune to have the Hebrew wander over and reinforce his population.

      While other groups moved on and took new leaders and deified them leaving the old religions behind, the Jews needed to keep their covenant between the warlord Jehovah and Moses because that is the founding of their culture, their tribes and their claim to lands. If Jehovah 'died' so would the contract that gave them their 'promised land', so they claim he is eternal.

      The Rastafarians did much the same with Ras Tafari. They claim he is sitting on top of Mt Sinai or somesuch waiting to become emperor of all the earth.

      Then there are the Preslians who claim that Elvis is still alive sitting at the left of god and can 'prove' it from the lyrics of his songs.

    21. Re:Even Jesus talked in parables by glwtta · · Score: 1

      Talking of a little knowledge being a dangerous thing, you should probably mention that the documentary hypothesis you're quoting is unfalsifiable, and is just logical conjecture based on scriptural analysis, rather than solid fact.

      Well of course, but this is textual analysis of an ancient document, not physics; I'm not sure you can apply the concept of falsifiability outside the hard sciences.

      By the way, I wasn't actually trying to advocate the documentary hypothesis (or any specific versions of it), just the most general proposition that Genesis (in this case) comprises several distinct narratives and some of them have a few identifiable links with the history of the surrounding region (Jahvist and Elohist are just labels for identifiably different portions of text). Still just a "conjecture" of course, but the preponderance of evidence seems to be on its side; and I've yet to see any convincing argument against this interpretation that's not based in theology.

      Anyway, most of what I was trying to say refers to the translation of the text, the authorship is actually quite irrelevant.

      --
      sic transit gloria mundi
    22. Re:Even Jesus talked in parables by Anonymous Coward · · Score: 0

      If an authority I trust links to a static history page of wikipedia, I will trust that page of wikipedia.

    23. Re:Even Jesus talked in parables by hedrick · · Score: 1

      Calvin was an admirer of science. In his time the issue was the new astronomy, which he supported. He held the concept of "accomodation", that in the Bible God accomodated himself to our ability to understand, in some cases describing things as they appeared rather than giving full scientific explanations. While conservative Calvinists today will argue, from his discussion of Genesis I think it's pretty clear that he would have endorsed evolution.

      Calvin also did not endorse the idea that hard work results in salvation. That's almost 180 degrees from the actual Reformation view, which emphasizes God's grace.

      Calvin also did not treat God's approach to those who are saved and those who are damned symmetrically. While both are part of God's plan, God is with the elect, working in them to regenerate them. This is not true of the damned. Calvin is not entirely consistent in how he describes double predestination. But his treatment of key Biblical passages suggests that he believed in "compatibilism", the idea that on one level God is responsible for everything that happens, but that on another level people make reponsible choices. This is probably not the place to describe that in detail.

    24. Re:Even Jesus talked in parables by Anonymous Coward · · Score: 0

      You know absolutely nothing about Calvinism - Check it out sometime..If you seriously think it has anything to do with good works, you've got a messed up head. Check out TULIP sometime

    25. Re:Even Jesus talked in parables by Micah · · Score: 1

      There's actually quite a bit in the Bible that seems to support the Big Bang. The two biggest aspects of the BB are 1) it all came into existence from nothing a finite period of time ago and 2) continuous cosmic expansion.

      Of course Genesis 1:1 supports the first point. Hebrews 11:3 says that what we can see was created from what is invisible. Titus 1:2 implies that time itself has a beginning -- something cosmologists discovered in the last few decades.

      As for the second point, there are ten verses in the old testament, mostly in the prophets, that describe God as stretching out the heavens. Isaiah 42:5 says "the Lord, who created the heavens and stretched them out" -- note the two aspects of the BB combined in a single phrase. Jeremiah 10:12 and 51:15 say that God "stretched out the heavens by his understanding." Tis is pretty consistent with the fine-tuning of the universe that we see. Psalm 104:2 says that God stretches out the heavens "like a tent." Not too bad if you add an extra dimension. Just like a tent surface is a 2D covering of a 3D space, the universe is sort of like the 3D surface of 4D space.

      I think many "fundie" Christians are doing the faith a huge disservice by trying to argue against the big bang!

    26. Re:Even Jesus talked in parables by Anonymous Coward · · Score: 0

      "Let there be light!"

      BANG!!

    27. Re:Even Jesus talked in parables by Phroggy · · Score: 1

      There's a slight difference between translations of Genesis 2:19. The NIV says:

      "Now the LORD God had formed out of the ground all the beasts of the field" ...as in, God had already formed them. However, the KJV and NASB aren't as clear. I'm not a scholar of ancient Hebrew, so I can't say which translation is more accurate to the original text, but if the NIV is accurate, it certainly makes sense.

      Genesis 1:27 briefly summarizes what is described in more detail in chapter 2. No contradiction there.

      --
      $x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
      $x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
    28. Re:Even Jesus talked in parables by swillden · · Score: 1

      the old Hebrew one where God is not a single being but Ilohim (which is plural and I may have spelled it wrong)

      It's spelled "Elohim", and it's the plural form of "Eloah". Another poster covered this fairly well, so I won't bother.

      If Genesis isn't literal to these people the foundation of Christianity falls apart.

      The foundation of some segments of Christianity falls apart, anyway.

      Within the Christian world, there are a few different viewpoints on where authoritative doctrine comes from. Catholics believe that doctrine comes from the Bible, from church history and tradition and from the Pope. Thus, they have little difficulty with apparent problems in the Bible, since there are other sources that can clarify the nature of the truth. The Pope, in particular has the notion of Papal Inerrancy supporting him, enabling him to actually correct the Bible, if needed.

      When most of the protestant faiths broke from the Catholic church, however, they did it based on disagreements between Catholic doctrine and their reading of the Bible. Thus, it became critically important to them that the Bible be considered to be perfect, since they've basically rejected any notion of ongoing revelation that might clarify or overrule the Bible. In their view, since God is Omniscient and loving, he would have taken care to present his Word to us in its perfect form. Now, that view doesn't of necessity require that the Bible also be perfectly literal, but it pushes people in that direction, and some of the protestant faiths have gone very far indeed in that direction.

      A few more modern protestant faiths (19th-century forward) take a different approach. They essentially rejected the idea that a God who once spoke to humanity via revelation would stop, and therefore believe that revelation continues, either through prophets or through individual revelation (or both). These faiths again have relatively little problem with the idea that some parts of the Bible are figurative, not literal, since they see a source of divine guidance to address any loose ends.

      --
      Note to ACs: I usually delete AC replies without reading them. If you want to talk to me, log in.
    29. Re:Even Jesus talked in parables by Chacham · · Score: 1

      the old Hebrew one where God is not a single being but Ilohim (which is plural and I may have spelled it wrong)

      Actually, if it meant many gods it would be elohos, the "im" ending pluralizes the "el" part which refers to strength. So, He is a singular god of many strengths, which is how the word is used.

    30. Re:Even Jesus talked in parables by Chacham · · Score: 1

      . I'm not a scholar of ancient Hebrew, so I can't say which translation is more accurate to the original text, but if the NIV is accurate, it certainly makes sense.

      It is past tense, as are all the creation verses. The first word (vayitzer) can be exactly translated as "and He formed". (The "He" is left out in translations because the subject (G-d) is mentioned in the next two words.)

    31. Re:Even Jesus talked in parables by Eli+Gottlieb · · Score: 1

      You spelled it wrong. The God in Genesis is called Elohim. Please spell it correctly, or people will think you're an anti-Semitic nutjob out to slander the Jewish religion (because such nutjobs' transliterations from Hebrew are often miserably wrong).

    32. Re:Even Jesus talked in parables by houghi · · Score: 1

      Theologians can pursuade themselves of anything. Anyone who can worship a trinity and insists that his religion is a monotheism can believe anything -- just give him time to rationalize it.
                                                            Robert A. Heinlein, JOB: A Comedy of Justice

      --
      Don't fight for your country, if your country does not fight for you.
    33. Re:Even Jesus talked in parables by MaXimillion · · Score: 1

      Evolution directly contradicts the Bible.
      Could you point out how exactly do they contradict each other?
    34. Re:Even Jesus talked in parables by Phroggy · · Score: 1

      It is past tense, as are all the creation verses. The first word (vayitzer) can be exactly translated as "and He formed". (The "He" is left out in translations because the subject (G-d) is mentioned in the next two words.) So what's your opinion of the NIV's "had formed"? Does Hebrew have that tense and it wasn't used here? Does saying "and He formed" imply that this forming happened after what had just been described, or is it common for these things to be listed out of order?
      --
      $x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
      $x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
    35. Re:Even Jesus talked in parables by Chacham · · Score: 1

      So what's your opinion of the NIV's "had formed"?

      The word "Now", mentioned earlier, was an addition. "had formed" would be a more correct translation.

      Does Hebrew have that tense and it wasn't used here?

      I think it is more factual then historical. So, personally, i'd remove the word "had", but i would not call it incorrect, because it is indeed factual as all animals were created before man.

      Does saying "and He formed" imply that this forming happened after what had just been described, or is it common for these things to be listed out of order?

      I'll preface my reply with the Talmudical statement "ain mukdum oo'm'uchar b'kra", there is no earlier and later in the Bible. The Bible is not meant to be historical, and it is explicitly historical were important. Here it is not explicit.

      The meaning of this verse is for a couple of reasons. I'll say them quickly, but can expand a bit if you'd like. Fish were created from water, mammals from land, and fowl from both. This can be seen in the verses, and only fowl are mentioned twice, once for earth and once for water. The second reason is in relation to Man, so this comment mentioning earth is mentioned here to introduce the subject.

  27. Re:Loaded Post by Jalwin · · Score: 1

    Just because someone doesn't believe in evolution or big bang doesn't mean they are an idiot. Growing up, I was taught tolerance and understanding of other beliefs, not arrogance and talking down to others. BTW I believe in both God (but don't subscribe to any Christian denomination) and evolution/big bang.

  28. In other news... by Anonymous Coward · · Score: 0

    In other news, 90% of people who are willing to answer polls are found to be idiots. "Induhviduals" as Scott Adams would say. The smart people don't spend time on stupid polls.

  29. The good news by Morky · · Score: 1

    Well, at least the people in this 48% lack the intelligence to reach positions of power and influence. Oh, wait a minute....

  30. Yeah by aquabat · · Score: 1

    Yes, and with each generation, it becomes more and more apparent.

    --
    A republic cannot succeed till it contains a certain body of men imbued with the principles of justice and honour.
  31. Alarming? Consider this... by dvdrsmth · · Score: 0, Flamebait

    "An alarmingly high number of individuals responded that they believe the earth is only 10,000 years old, and that a deity created our species in its present form at the start of that period." What's ironic is if you step back from the micro and consider life (and all that surrounds us) at a more macro level, it takes far more faith to believe that a "deity" did not create human life. Reminds me of a quote from a philosophy class in college, "To believe that God does not exist, is to believe that a stiff wind could blow through a junk yard a create a 747."

  32. This makes sense by Marko+DeBeeste · · Score: 1

    "Everyone that needs to believe in evolution already does." Penn Jillete

    --
    Faith: n. -- That human impulse that drives them to steal appliances when the power goes out
    1. Re:This makes sense by Anonymous Coward · · Score: 0

      A good point. People can believe two things at once; I do it all the time. I doubt that 48% put down "because God said so" on their highschool bio tests. Even our educational system doesn't allow you to graduate without at least a cursory understanding of evolution; you can't really understand taxonomy without it. I can use metric at school, and standard when renovating my house; they're both fine, depending on the context.

  33. I was going to say.. by Anonymous Coward · · Score: 1, Funny

    chickens..

  34. another statistic by xerxesVII · · Score: 1

    100% of the people sitting in this chair reject that 48%.

    --
    "We shall grapple with the ineffable, and see if we may not eff it after all." - Douglas Adams
  35. Fortunately, It Doesn't Matter What You "Believe" by ewhac · · Score: 4, Insightful
    Facts -- like gravity, and the sphereoid shape of the planet -- exist whether or not people "believe" in them. A leaf doesn't have to believe in photosynthesis to turn green.

    Schwab

  36. A challenge for science and tech in our society by PrvtBurrito · · Score: 4, Insightful

    My take on this issue is that people who do not have extensive scientific educations are being asked to 'believe' in science in a manner similar to how they 'believe' in religion. Science is fundamentally based on observations and the progression of the scientific method. That said, for most of us, we never see the evidence, nor do we see the details of each hypothesis test. This is further complicated because the body of scientific literature is massive and for every scientific field you can find crap science. Peer review is fallible.

    I think we are requiring people to 'believe' in science, simply because science has become too complicated to cover adequately with a standard, non technical education. This creates a conundrum. These people are being required to choose religion -- remember they have been in church since birth -- or science. For them, this must be very difficult. When we listen to a scientist, we hope we are hearing testimony based on evidence, when we hear a preacher we hope we are hearing testimony based on belief.

    That said, as a scientist familiar with evolutionary theory, I am troubled by the level with which we understand the mechanisms of evolution and that 48% of people don't even understand the most basic of concepts within it. Should we require people to swallow science without evidence? Should we follow *anything* without evidence? I know I don't, ironically, science doesn't allow me to.

    --
    Laboratree - Scientific collaboration based on OpenSocial.
    1. Re:A challenge for science and tech in our society by geek · · Score: 1

      I see your point but disagree. People's beliefs are actually arbitrary most of the time, based on parentage and schooling. There is no singular "belief" in Christianity, there are Protestants, Catholics, Mormons and so on. All very different and requiring a whole different set of arbitrary characteristics.

      Understanding science is similar, there are different categories, subcategories, fields of study and so on. It's not that people refuse to accept them, they may very well do exactly that when exposed to them. The problem is they are rarely exposed, often by choice. Why would the average joe research physics? It probably has nothing to do with his day to day life and his current religious beliefs probably work just fine.

      I could go on but I think that's the gist of it. Until you break the cycle of "hand me down" belief systems, this will be the end result.

    2. Re:A challenge for science and tech in our society by TheoMurpse · · Score: 1

      Should we follow *anything* without evidence? I know I don't, ironically, science doesn't allow me to.
      First of all, the evidence is that scientists uniformly believe, based on what they allege to be scientific evidence, in evolution COMBINED with the fact that the vast majority of these scientists are trustworthy individuals.

      On a related note, since you don't follow anything without evidence, do you use any computer programs at all that you have not reviewed every line of source code and compiled yourself? If you do, you apparently lack the same evidence that you accuse others of believing without.

      We all believe in things through faith rather than hard proof, simply because no one has time to verify everything they do with independent research in a field of study they have built singlehandedly from the ground up.
    3. Re:A challenge for science and tech in our society by asninn · · Score: 1

      This is further complicated because the body of scientific literature is massive and for every scientific field you can find crap science. Peer review is fallible.

      I think that's a false dichotomy. Peer review isn't infallible, of course (what is?), but that doesn't mean it's totally worthless.

      These people are being required to choose religion -- remember they have been in church since birth -- or science.

      That, too, is a false dichotomy; you can certainly be religious without believing in all the bull that certain people are spouting and while still accepting science. What's more, this is a false dichotomy created by those who want to discredit science, and we should be pointing out that it is, indeed, a *false* dichotomy, not validate their propaganda.

      --
      butter the donkey
    4. Re:A challenge for science and tech in our society by OriginalArlen · · Score: 1

      Yes. This is another way of saying that the education system in the US, compared to that in Europe (where the results of a poll like this would be much, much less depressing), is shit.

      --

      Everything I needed to know about life, I learnt from Blake's Seven
  37. Re:Loaded Post by drapeau06 · · Score: 1

    Quite right, ignorance is different from idiocy. I'm sure you noticed that I didn't call anyone an idiot.

  38. Don't assume it's all about religion by DumbSwede · · Score: 1

    Much as everybody assumes this is all about fundamentalist Christianity, I have talked to many non-Christians around the world, even non-deists, and many find evolution hard to swallow.

    I believe in Evolution, but for some it is a very disquieting concept. Many people generally want to believe in the transcendence of man and distance from animals. Christians just have more dogma to lean on to support this prejudice. People don't disbelieve out of ignorance, they disbelieve because they don't want to believe. Similarly many people believe in many strange and incredulous things because the do want to believe.

    This said, just teaching people to set aside there natural biases when evaluating evidence in general would do a world of good in both science and politics. Evolution would take care of itself if we were successful in this.

  39. Obviously... by bmo · · Score: 2, Insightful

    I am not surprised.

    Half of the US population has IQ's below 100.

    48 percent of people are stupid and believe that Genesis is the literal Word Of Gawd and that science is some sort of mental buggery? This is not news.

    The fact is that we're *this* close (holding thumb and forefinger a millimeter apart) to burning (well, hanging and pressing, actually) witches again in this country. The code words for "witches" these days are "terrorist," "paedophile," and "science teacher."

    --
    BMO

    1. Re:Obviously... by KokorHekkus · · Score: 1

      It's also a function of influences of the differing belief systems on the state. Here in Sweden the doubters of evolution (not equal to strict believers in creationism) has been polled at around 25%. But we do lack the number of evangelical people influencing policy that the US has. While in the US you even have Bush giving money to something called Faith Based and Community Initiatives. For me that doesn't bode well for the separation of church and state... shurely the proper way would be to evaluate each program based according to their individual effiency without putting the word "Faith" in there. Unless it is a support system for the faiths in question.

    2. Re:Obviously... by Sockatume · · Score: 1

      "Half of the US population has IQ's below 100."

      Half of every population's IQ is below 100! By definition, 100 is the average IQ score, with half the people taking the test scoring above 100 and the other half scoring below 100.

      --
      No kidding!!! What do you say at this point?
    3. Re:Obviously... by c6gunner · · Score: 1

      Before you get on your high-horse, think about how widespread the belief in Homeopathy is in Sweden. People in Sweden aren't much different than people in the US - they just believe in different types of nonsense.

    4. Re:Obviously... by antiMStroll · · Score: 1

      Hook, line and sinker. Nicely done. Unless of course you really are a pedophilic science-teaching Wiccan terrorist, in which case my apologies.

    5. Re:Obviously... by IHC+Navistar · · Score: 0, Troll

      I wouldn't mind publicly hanging terrorists and pedophiles.

      What's wrong with that?

      -----

      In a concurrent study, 48% of the United States was found to be idiots.

      I don't know why people can't get it through their heads.

      --
      Knowing Google's lust for data collection, the Soviet Union is still alive and well inside the psyche of Sergey Brin....
    6. Re:Obviously... by gardyloo · · Score: 2, Funny

      The fact is that we're *this* close (holding thumb and forefinger a millimeter apart) to burning (well, hanging and pressing, actually) witches again in this country. Could you translate that into cubits for me please?
    7. Re:Obviously... by asackett · · Score: 1

      It is not true that half of the population has IQs below 100. That would only be true of no one had an IQ of 100, a case in which half would be 99 and below and half would be 101 and above.

      --

      Warning: This signature may offend some viewers.

    8. Re:Obviously... by Anonymous Coward · · Score: 0

      jeez the thing that amazes me about the USA is any idiot can become president and this college system creates the best and the brightest ... and this is what the rest of world has to deal with close minded puritan idiots! can we run the same survey on NASA employees? even the ones in the deep south.

    9. Re:Obviously... by Bender0x7D1 · · Score: 1

      Half of the US population has IQ's below 100.

      Actually, that isn't quite right either. Now if you had used "less than or equal to" it would have worked. Of course, if you are going to insult the intelligence of half of a country you shouldn't make silly errors like that.

      Also, you are making a pretty big leap from people who kill others (actual terrorists) and people who assault and harm the weak and trusting (paedophiles), to science teachers. Do you know of any science teachers who were killed, sent to prison camps, beaten or otherwise mistreated like terrorists or paedophiles? Sure, some might get fired for some things which are bogus, but the same thing goes for a lot of people with bad managers.

      --
      Reading code is like reading the dictionary - you have to read half of it before you can go back and understand it.
    10. Re:Obviously... by ceejayoz · · Score: 1

      No, actually. IQ is calculated via a mean average, not a median average.

      As an example to show why your statement isn't true for that reason, consider the average net worth of a room filled with 99 homeless people and Bill Gates when he was worth a nice round $100 billion. The mean average net worth of the room is $1 billion per person. The median is zero.

      Standard deviation matters too - if 99% of people are within a couple IQ points it means something different than a huge range of likely numbers.

    11. Re:Obviously... by bmo · · Score: 1

      If you really want to nitpick, there are *no* people who have an actual 100 for IQ. That's because intelligence is a continuum, and doesn't increment or decrement in integer steps. Everyone resides on either side of the _theoretical_ line of 100, which has no width, as anyone with a background in grade school math knows.

      But that's not what I was aiming for in the original post.

      Bwahahahaha....

      --
      BMO

    12. Re:Obviously... by c6gunner · · Score: 1

      So you're saying sex with children is ok, killing civilians is ok, and science teachers are being treated the same as terrorists and paedophiles?

      Buddy, I think someone's been spiking your pot with LSD.

    13. Re:Obviously... by Ztream · · Score: 1

      At least no one ever fought a war over homeopathy.

    14. Re:Obviously... by bmo · · Score: 1

      "Actually, that isn't quite right either. Now if you had used "less than or equal to" it would have worked. Of course, if you are going to insult the intelligence of half of a country you shouldn't make silly errors like that."

      That sentence was a deliberate troll. I admit it.

      "Do you know of any science teachers who were killed, sent to prison camps, beaten or otherwise mistreated like terrorists or paedophiles?"

      A few of my coworkers are Cambodian. You're telling me it can't happen? Brother #1 was interviewed last month on the BBC. He still claims it's everyone else's fault.

      --
      BMO

    15. Re:Obviously... by bmo · · Score: 1

      /me bows.

      Thank you kind sir or madam. :-D

      --
      BMO

    16. Re:Obviously... by c6gunner · · Score: 1

      Give it some time :p

    17. Re:Obviously... by Sockatume · · Score: 1

      I know you don't use the median score to figure out the average. That's just common sense. However on top of this by definition the score distribution has to be a normal distribution. Therefore you get 50% scoring above the 100 mark, and 50% scoring below.

      --
      No kidding!!! What do you say at this point?
    18. Re:Obviously... by bmo · · Score: 1

      A friend just pointed this out to me on gaim:

      http://richarddawkins.net/theUgly#9

      Freakin' scary.

      --
      BMO

    19. Re:Obviously... by Sockatume · · Score: 1

      To elaborate, in essence an IQ score when combined with the standard distribution of the test tells you what percentile you've fallen into. Therefore the idea that anything but half of the population could fall into the 50th percentile is absurd by definition.

      --
      No kidding!!! What do you say at this point?
    20. Re:Obviously... by KokorHekkus · · Score: 1

      And exactly how has the belief in homeopathy influenced any governing body in Sweden? It's when you start allowing non-rational belief influencing the decision making process that you get problems. Homeopathics carry no weight what so ever in medical circles in Sweden. Why? They have been shown to have no effiacy. Because they have been, as I said pretty much ad verbatim, the programs have been evaluated according to their individual effiency without putting the word "Faith" in there.

      Any reasonable evaluation of any program uses reason. Like Sweden has done with the use of homeopathy when it comes to governemt support. In essence what you are bringing up is nothing but a strawman argument. And to compound matters you follow up matters with an ad hominem attack with refering to me as being on a "high-horse".

    21. Re:Obviously... by jabster · · Score: 1

      The fact is that we're *this* close (holding thumb and forefinger a millimeter apart) to burning (well, hanging and pressing, actually) witches again in this country. The code words for "witches" these days are "terrorist," "paedophile," and "science teacher."

      Personally, I am fully in favor of hanging terrorists and pedophiles.

      This would be a good thing: http://en.wikipedia.org/wiki/Jessica's_Law

      Based on your "code words" for witch, I am gathering that you are in the lower half of that IQ level? I mean, you forgot to add the obvious murderers and rapists to your list.

      Who the heck modded this "insightful"?

      -john

      --
      Slashdot: you'll not find a more wretched collection of villainy and disreputable types...
    22. Re:Obviously... by resonte · · Score: 1
      --
      \(^o^)/
    23. Re:Obviously... by asackett · · Score: 1

      The original definition: IQ = 100 * (mental age / chronological age).

      If the average score of all members of the population of a given age happens to land on an integer number, then many members of that class (persons of that age) are going to present test scores of that integer number and so be assigned IQ scores of exactly 100. It's only when that average score is a non-integer while the test scores are constrained to integers that exactly 100 is impossible. This does not preclude the average score of another class (people of a different chronological age) landing on an integer number.

      I'm not aware of any theory of intelligence that states categorically that no one can be perfectly average.

      I don't recall statistical analysis being a part of the curriculum at my grade school, so maybe I'm as disadvantaged as you suggest I am. Could be, could be... but outside of the classroom, my parents taught me not to be a rude prick, a bit of education that you seem to have missed.

      --

      Warning: This signature may offend some viewers.

    24. Re:Obviously... by bmo · · Score: 1

      "So you're saying sex with children is ok, killing civilians is ok, and science teachers are being treated the same as terrorists and paedophiles?"

      No, of course not, but in my snide way pointing out that science, in various parts of this country, is regarded as evil. As evil as terrorists and paedophiles, because science endangers your eternal soul, so if you are a thinking person, when you die, you will burn forever and ever in the Lake Of Fire(TM). The people behind that worldview take it seriously and would rather imprison/kill scientists than let them "corrupt" more souls. It's just that most of them are too chickenshit to do anything about it. Only when they get organized and have the power of the uneducated masses behind them do they have actual power. But once that happens, look out. The first aim of any decent dictatorship is to get kill off the smart people, because stupid people are never a threat to a dictator with Charaaaaasma. Just look at history. The fact is that 50 percent of the entire country (any country, btw) is comprised of mouth-breathers who will elect someone who will "Fix It All, Just Give Me The Power To Do So."

      And so the lumpen mob gets what it demands, to its eventual dismay. Then you have another Cambodia. Another Turkmenistan. Another Zimbabwe, which, btw, was the breadbasket of southern Africa, but now needs to import food.

      My original post was based upon reality. That's the recipe for an effective troll.

      "Every time man struggles and fails
      He makes up some kind of fairytales
      After all of the misery that he has caused
      He denies he's descended from the dinosaurs"

      -E. Costello

      --
      BMO

    25. Re:Obviously... by c6gunner · · Score: 1
      My mistake, it was the Norwegian prime minister that I was thinking of, not Swedish.

      Homoeopaths might carry no weight in Swedish medical circles, but neither do evolution-deniers hold any sway in American biology circles. I don't understand why you'd bring this up.

      I know there ARE several homoeopathic "schools" in Sweden, but I assume these are privately funded? I did also find this:

      Since July 1999, homeopathic doctors should be reimbursed fully (anamnesis and repertorization on time-based scale) by federal basic health insurance. Patients treated by NMQPës need an additional insurance for this. This is the decision of the national health authority. A clear statement of acknowledgment for Homeopathy. Homeopathic remedies prescribed by physicians are paid already by the official tariff.
      Which seems to run contrary to your assertion that Sweden has used "reason" when dealing with government support of homoeopathy. My research has been somewhat limited due to the fact that I cannot read your language, so please feel free to correct me if the info I have is incorrect.

      Also, I think you misunderstand the concept of a strawman attack, and you being on a high horse is not an ad-hom attack. I'm not creating an argument to debunk, nor am I dismissing your argument based on a character attack.
    26. Re:Obviously... by c6gunner · · Score: 1

      Gotcha. I agree to an extent, although you're overstating the point. Most people may be "mouth breathers", but they're certainly not convinced that science is evil. I'd say less than half a percent of the population would fall into that category, and half of those are probably the exact opposite of the stereotype you've provided. The ultra-environmentalists are just as opposed to science as the extreme-religious-fundies. However, even put together, their numbers are low enough to be immaterial.

      It's not these extremists that we need to worry about, it's the much larger portion of the population which is quite happy with science, but thinks God is more important. These are people who don't understand the principles of science, and are convinced that science is just another system of belief. They have nothing against science in general - they just don't want it interfering with their faith.

    27. Re:Obviously... by bmo · · Score: 1

      "I don't recall statistical analysis being a part of the curriculum at my grade school"

      I was taught set theory in elementary school. I didn't know it at the time. It allowed me to fly through a college course in Logic, especially when it came to symbolic logic. I am a victim of "New Math." Google it.

      You mean to tell me that nobody ever taught you what averages, means, modes, and medians are in grade school? How did your teachers ever explain your grades to you?

      "If the average score of all members of the population of a given age happens to land on an integer number, then many members of that class (persons of that age) are going to present test scores of that integer number and so be assigned IQ scores of exactly 100. It's only when that average score is a non-integer while the test scores are constrained to integers that exactly 100 is impossible. This does not preclude the average score of another class (people of a different chronological age) landing on an integer number."

      It all depends on how small you want to break down chronological and mental age. We have this convention, in the world, where age is measured by circuits of this lump of rock around a star as whole integers. We even celebrate them (well some of have stopped). But that doesn't mean that you can't further break age down into something as small as femtoseconds. Remember that intelligence is a continuum that stretches from the vegetative state all the way through to the Brocas and Einsteins of the world. Therefore mental age divided by chronological age _never_ yeilds an integer except for very special cases (I have proof for this but I can't fit it in the margin). Also, since a mean on a standard distribution is an infinitely thin line, I would say that the likelihood of anyone having the perfect mental/physical age ratio that hits 1.0000000000 (pure 100 on the IQ scale) is nil.

      " my parents taught me not to be a rude prick"

      I think they failed. If being precisely accurate is being a rude prick, I have to ask...are you a thinker or are you one of "them"?

      --
      BMO

    28. Re:Obviously... by bmo · · Score: 1

      "Gotcha. I agree to an extent, although you're overstating the point. Most people may be "mouth breathers", but they're certainly not convinced that science is evil. I'd say less than half a percent of the population would fall into that category, and half of those are probably the exact opposite of the stereotype you've provided. The ultra-environmentalists are just as opposed to science as the extreme-religious-fundies. However, even put together, their numbers are low enough to be immaterial."

      Sigh...no, what I meant that those who get the backing of the illiterate masses behind them are the dangerous ones (please re-read what I wrote). The masses may not care whether science rots your soul or not, but they can be willing to swallow the filth that spews from the various orifices of the religious nutjobs if it's vomited forth with the right amount of syntactic sugar. I agree with you about the ultra-environmentalists, too. I have met a few and some of them are just genocides waiting to happen (all people are evil, etc). A religion in itself, that. No reasoning. None.

      In this enlightened age you'd think that the battle between "how" the universe works and "why" it works would be over and that religious leaders would leave the mechanics of it to the scientists. But no, they don't. They see the explanation of the "how" as a threat to the "why" when "how" and "why" are two completely different questions.

      Evolution is a fact. It has no bearing whatsoever on whether Jesus came here to save our souls (if you believe or not...I have my doubts).

      The universe is as it is, and people would have a lot easier time dealing with it if they stopped trying to make it fit their preconceived notions.

      Digression follows:

      Actually, Jesus was a pretty cool dude at times from what I've read for myself, and being asked what I would do (by religious fundies) if he showed up on my doorstep, what I'd do.

      I'd invite him in and offer a beer.

      It's some of his followers that I'd have problems with.

      --
      BMO

    29. Re:Obviously... by bmo · · Score: 1

      YHBT. Another victim falls.

      Read my other posts.

      --
      BMO

    30. Re:Obviously... by asackett · · Score: 1

      You're playing silly, pointless games with numbers whose precision is many orders of magnitude greater than their accuracy and holding them out as proof of your superior education and intellect? That, sir, qualifies you as an intolerable prick and one who can lay claim to superiority in neither education nor intellect.

      Have a happy day, but please do it somewhere else because you're annoying the grown ups.

      --

      Warning: This signature may offend some viewers.

    31. Re:Obviously... by bmo · · Score: 1

      You Fail It. I have gone on a roundabout way of describing something that you should have grokked much earlier in life, like, by the time you hit High School. The mean on a standard distribution is an infinitely thin line. It has zero width. Just because people do rounding to give people integer scores makes no difference.

      What part of "infinitely thin" do you not understand?

      Half of everyone is above 100. The other half are below.

      Good. Day. Sir.

      --
      BMO

    32. Re:Obviously... by KokorHekkus · · Score: 1

      Homoeopaths might carry no weight in Swedish medical circles, but neither do evolution-deniers hold any sway in American biology circles. I don't understand why you'd bring this up.
      Because you brought up homeopathy in Sweden as a response about my argument faith-based entities are influencing decision-making processes in the US. I claimed that homeopathy isn't in any way influencal in Sweden. And right now I cant think of any other faith-based groups having any influence.

      know there ARE several homoeopathic "schools" in Sweden, but I assume these are privately funded?
      I'd assume so because all this is requiered to call oneself a homeopath in Sweden is to say so. Any park-bench alcoholic may title themselves as an homeopath since there is no legal defintion for that title. It's a free-for-all. They are not funded by the state and you cannot get state funded student loans to attend them (excluded educations include homeopathy, aromeatherapy, healing etc).[1]

      I did also find this:Since July 1999, homeopathic doctors should be reimbursed fully (anamnesis and repertorization on time-based scale) by federal basic health insurance. Patients treated by NMQPës need an additional insurance for this. This is the decision of the national health authority. A clear statement of acknowledgment for Homeopathy. Homeopathic remedies prescribed by physicians are paid already by the official tariff.
      The quote given refers to SWITZERLAND and not SWEDEN. Switzerland isn't even part of the EU.

      Furthermore, to sell a homepathic remedy in Sweden it must be registered with the national Medical Product Agency (Läkemedelsverket) and a remedy can have no stated therapeutical effect (because otherwise it has to go through normal medical testing) and must be diluted to at least 1/10000 of the original mix or 1/100 of any prescribed drug. [2]

      So to sum things up: Sweden probably has homeopathic educations... these are not state funded and you cannot even get state funded student loans to attend them. Sweden does not include homeopathy in its universal healthcare and you cannot get homeopathic remedies witin that universal insurance (Sweden is not Switzerland ;). Anyone can call title themselves as a homeopath. To sell homeopathic remedies these have to be registered and to be shown according to certain standards to be harmless.

      Sorry about the strawman reference (only excuse I have is that english is my third language ;). As for the ad hominem that's a personal reflection that I still feel is apropriate since started of with a character description that is quite clear in its meaning (being on a high horse - according to Merriam-Webster "having an arrogant and unyielding mood or attitude" - I sure didn't get that one wrong). That has nothing in it about inquiring the correctness of my statements... it's actually stating that I'm an arrogant/unyielding person and that therefor most people would assume (at least on a cursory reading) that I was wrong if they trusted you more... regardless of the actual facts. You will need to consult someone knowing swedish to read these references (including them for full reference):

      [1]http://csn.se/Avdelningar/Vidareinformator/Re gelinformation/ReglerOchPraxis/Studiemedel(PDF)/21 35A.pdf?MenyIdnr=7&

      [2]http://www.lakemedelsverket.se/upload/lvfs/LVFS _2003-2.pdf
    33. Re:Obviously... by c6gunner · · Score: 1

      lol. dammit. I'm going to blame the Switzerland/Sweden mixup on my lack of sleep. And after a mistake like that I'm not going to push my luck by trying to debate you any more. My main point was that, in my experience, people in the EU in general tend to believe in things like homoeopathy, aura healing, and psychics, a lot more than people in North America. It's something I've noticed while living in the EU, and I've seen some statistics to back up that impression, but I don't remember where. So my main point was that people all over the world tend to believe in dumb things - they just differ on what exactly they believe in. Anyway, kudos, and thanks for correcting some of my misconceptions.

    34. Re:Obviously... by joto · · Score: 1

      That assumes that the net worth of any homeless person i 0. Which is incorrect. A homeless person typically owns the clothes he uses, his wallet, with money he got from some form of legal or illegal work (i.e. begging or stealing). And a number of other items, such as a sleeping bag, etc. While most of those items would have zero monetary value to you, doesn't mean that their monetary value is actually zero.

    35. Re:Obviously... by Sockatume · · Score: 1

      Well, I don't know what to say. I've always been presented with IQ tests as normal distributions. I'm not sure how you go from that (and a bunch of tests with various different standard deviations) and get a non-100 average IQ for each country.

      --
      No kidding!!! What do you say at this point?
    36. Re:Obviously... by resonte · · Score: 1
      Yes, I realised my error right after I posted it. I meant to say that not every country has the same average IQ when compared to the global average.

      So the population of Country X with IQ below 100 may be higher than the population of Country Y with IQ below 100. (If considering global IQ average rather than country IQ average).

      Excuse my stupidity.

      --
      \(^o^)/
    37. Re:Obviously... by ceejayoz · · Score: 1

      When we're talking about mean net worth of a billion dollars, the net worth of a homeless person is effectively zero. You can re-do the calculations for the homeless people having net worths of a couple hundred bucks if you like, but it's not going to change the point the slightest bit.

    38. Re:Obviously... by Sockatume · · Score: 1

      That goes without saying, of course. Basically I'm on a mission here because it looks like a variation of the equally tiresome "half of Americans have below average intelligence" urban myth. Frankly I'm not sure either version is actually true.

      --
      No kidding!!! What do you say at this point?
  40. Re:How many non-religious don't believe in evoluti by Teun · · Score: 1

    An interesting approach.

    But probably flawed as the non-believers do not 'suffer' peer pressure to discard the theory of Evolution
    At the same time the educated among them are exposed to peer pressure against Creationism...

    --
    "The likes of Facebook and WhatsApp are free to those whose privacy is of zero value."
  41. Re:Loaded Post by maxume · · Score: 1

    It might not make somebody an idiot, but it is two strikes out of three.

    --
    Nerd rage is the funniest rage.
  42. Constructing Polls on Hot Topics is Hard by igb · · Score: 3, Insightful
    Constructing a poll on a topic as politicised as this is incredibly hard. As another /.er points out, it's a proxy for `are you a godless liberal or a True American', and unless the poll is taken in secret any area in which morons with a belief in creationism are prevalent will over report a belief in creationism. Once the opinion is taken in secret, the game changes, as those anti-abortion politicians in whichever state it was with the proposed law found out: people may support you when their neighbours can hear, but not when they're in private. Moreover, knowledge of how accepted an idea is in scientific discourse is hard to judge for anyone who doesn't follow the topic reasonably closely: as I suspect the vast majority of the world goes about their daily business without worrying about the current status of punctuated equilibrium versus gradualism, why would they care?

    Anyway, enough of this. I want someone to help me evolve the long, thin, incredibly strong fingers I'm going to need to open up ther case of the Mac Mini to my right and slot in the replacement disk drive.

    New Doctor Who was great tonight, by the way. Rose was great, but you're all going to love Martha Jones. Except for the creationists, of course, who are going to hate The Doctor kissing (whisper it) a black woman.

    1. Re:Constructing Polls on Hot Topics is Hard by Alsee · · Score: 1

      knowledge of how accepted an idea is in scientific discourse is hard to judge for anyone who doesn't follow the topic reasonably closely

      I would say the main problem here is the media presentation. They all too often try to be "fair and balanced" on any subject by grabbing one person from each side and presenting the two sides as if they were equal when that is patently untrue and wildly misleading. "Today's topic: Is the earth flat? On one side of the debate we have Wally, the president of the Flat Earth Society. Representing the other side we have some random scientist. At the end of our show viewers can text message in their vote on who they believe won the debate. A standard text message rate of 99 cents per call will apply for each vote you cast. Vote early and vote often."

      As a semi-humorous solution, I propose a law requiring that presentation of each side be in actual proportion to the relationship between the sides. So according to my semi-humorous proposed law, a newspaper with 3 words from an evolution opponent saying "evolution is wrong" would have to have 2055 words representing the pro-evolution side. A TV new show with a two second clip from an evolution opponent saying "evolution is wrong" would have to have 22 minutes and 50 seconds of video representing the pro-evolution side. Any media panel or government hearing with one evolution critic would have to have 685 pro-evolution scientists present.

      Because according to Newsweek magazine figures, there are approximately 480,000 credentialed earth and life scientists in the US on the evolution side and approximately 700 on the anti-evolution side. A ratio of about 685 to 1.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    2. Re:Constructing Polls on Hot Topics is Hard by Harin_Teb · · Score: 1

      Because, you know, all creationists are racist... Wait. Thats not funny. or Intelligent.

  43. Numbers game? by Rank_Tyro · · Score: 1

    How big of a sample was used? Where was the study held?

    Were the people being polled from a small isolated town in the bible belt or were they from one of the coastal areas?

    In a country with 300 million people in it, if you ask 2000 people in an isolated area a question, that wouldn't really reflect the majority of the population, but I bet it would make great headlines......

    --
    Today's show is brought to you by the number 09 F9 11 02 9D 74 E3 5B D8 41 56 C5 63 56 88 C0: 25
  44. Pot, kettle, black by GuyMannDude · · Score: 5, Insightful

    Let people be ignorant. It's not like bringing people of below average intelligence or fundamentalist mindset into the scientific fold is going to make them valuable contributors. It'll just be a new type of ignorance to deal with.

    First you call them ignorant (which is true). Then you call them stupid. Then you call them religious fundamentalists. Then back to ignorant. These are all very separate categories, which you would understand if you had the above-average intelligence that you probably believe you possess. Given the large percentage of the population that is being cited, I think it's unlikely they are all below-average in intelligence. I didn't RTFA so I don't know about their religious beliefs. I submit to you that these are probably people of average intelligence who are ignorant. That means that we as scientists are not getting the word out in a manner that most people find compelling. The problem is not with them, it is with us.

    Perhaps you should check out the film Flock of Dodos before you start pointing fingers at who is to blame. (Hint: the dodos are not the intelligent design folks, it's the scientists who are in danger of becoming extinct because they can't communicate simple facts to the mainstream audience.) Elitist attitudes like yours ("hey, if they can't keep up, fuck 'em!") is partially what drives the mainstream to give ID folks a listen.

    GMD

    1. Re:Pot, kettle, black by heinousjay · · Score: 1

      You misconstrued my point. I certainly painted with a broad brush, so that's understandable, and I'll try to explain further since yours is the first response that's in a reasonable tone.

      Ignorance and stupidity are not in any way exclusive. Nor are ignorance and a fundamentalist mindset. I didn't go from one to the other. I lumped all three categories together, because they share common features. I understand they are separate, but at the same time, they overlap in a very common case. I don't consider myself to be better or worse than people I deem ignorant. I simply believe I understand things better. This doesn't give me the right to put myself over them, which interestingly is the attitude I glean from your post.

      Getting the word out in a compelling manner seems like it would be a good answer, but that strategy has to fight apathy and indoctrination, both of which are much stronger. For better or worse, there is no way to replicate the techniques of what I'll call the dark side (for lack of a desire to think of a better phrase) without walking the dark path. The acceptance of ignorance I advocate is the answer I've chosen because ultimately, knowledge must win on its own merits. Knowledge doesn't penetrate ignorance, stupidity, or fundamentalism. It is, for all practical purposes, a lost cause. By accepting this, the propagation of knowledge becomes much less stressful. The message becomes less shrill and far more compelling. The opposition is further marginalized by their emotional reactions to reason. It's sort of like the difference between learning from a teacher who is constantly negative about your chances and a teacher who is basically neutral. (There is no positive in this situation because the core of the message is 'you are wrong.')

      The unfortunate upshot to all of this is that these attitudes are something we'll have to deal with for a very long time. The shining light is that these attitudes have been changing throughout the years and this will continue. It's just no something that will respond well to a call to arms.

      I'm sorry if this is a bit rambling, I'm in a hurry right now and I just wanted to get this out before I left. If I wasn't clear or you want to hash out some points, I'm happy to discuss this further.

      --
      Slashdot - where whining about luck is the new way to make the world you want.
    2. Re:Pot, kettle, black by Anonymous Coward · · Score: 0

      First you call them ignorant (which is true). Then you call them stupid. Then you call them religious fundamentalists. Then back to ignorant.

      It was actually YOU who brought up religion. The OP didn't say "religious fundamentalists," you did. Are you trying to see persecution where there isn't any? Be careful, you'll blow your cover and everyone will discover you're a wacked out religious nut pretending to be reasonable.

      Second, if you believe that it is unlikely that 48% of the population is of below average intelligence, I would recommend a statistics class or two.

      Third, it is not the job of scientists to "get the word out." That is a purely religious concept. Mechanics don't need to get the word out about how automobiles function, nor do scientists need to get the word out about how nature functions. If people choose to be ignorant of science, they can suffer the consequences of their ill-informed behavior.

    3. Re:Pot, kettle, black by cyberwench · · Score: 1

      The problem is that they alone will not be suffering the consequences of their ignorance. If scientists do not get the word out, their ability to perform their duties will be severely curtailed. This isn't the time to say "not my job!"

      --
      ~ Leilah
    4. Re:Pot, kettle, black by Jacer · · Score: 2, Interesting

      I hate to nit-pick, but being as it was 48% of the population, it would seem entirely possible that everyone one of them has below average intelligence. That is if we assume that there is a correlation between their disbelief and intelligence....

      --
      --fetch daddy's blue fright wig, i must be handsome when i release my rage
    5. Re:Pot, kettle, black by The+Other+White+Meat · · Score: 1

      Given the large percentage of the population that is being cited, I think it's unlikely they are all below-average in intelligence.

      Actually, approximately 49.9% of the population has "below average" intelligence. That is more or less the very definition of below average; either side of 50%. Given that 48% believe in religious fairy tales, it would appear to show that fundamentalism fits solidly on the lower end of the Bell Curve...

      --

      --- Generation X: The first generation to have SIG lines inferior to their parents... ---
    6. Re:Pot, kettle, black by evilviper · · Score: 1

      I hate to nit-pick, but being as it was 48% of the population, it would seem entirely possible that everyone one of them has below average intelligence.

      I hate to nit-pick, but he certainly never said it was impossible...

      As he said, it is quite unlikely.
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
    7. Re:Pot, kettle, black by The+One+and+Only · · Score: 1

      Hint: the dodos are not the intelligent design folks, it's the scientists who are in danger of becoming extinct because they can't communicate simple facts to the mainstream audience.

      Science moved past simple facts decades ago, and you can't communicate to someone who refuses to listen. Trying to fix an anti-intellectual culture might be necessary for scientists to survive, but measuring polar ice caps or bird migration patterns, or curing cancer, or digging up dinosaurs, or trying to synthesize element 132 is what scientists do for a living, and society interferes with that work at their ultimate peril.

      --
      In Repressive Burma, it's not just your connection that dies. slashdot.org/comments.pl?sid=314547&cid=20819199
    8. Re:Pot, kettle, black by OriginalArlen · · Score: 1

      First you call them ignorant (which is true). Then you call them stupid. Then you call them religious fundamentalists. Then back to ignorant. These are all very separate categories Different sets, but union (intersection (a, b, c) ) seems to return an awfully large fraction of set (c) -- religious people...
      --

      Everything I needed to know about life, I learnt from Blake's Seven
  45. Our president is one of those people by porkThreeWays · · Score: 2, Insightful

    That's what is scary. People making life changing decisions for you believe things with little/no scientific backing. That's why the country is the way it is. That's why we lost the edge we once had. There's a rebirth of celebrating ignorance and we are in the middle of it. Hell, we are basically as a culture in a dark age right now. Once knowledge is acquired it's like our culture as a whole has to check the bible to see if it's credible. Would you want people with the ability to kill you at any moment completely impermeable to reason?

    --
    If an officer ever threatens to taze you, say you have a pacemaker.
  46. Evo by Anonymous Coward · · Score: 0

    48% of all americans have never been part of the evolution.

  47. In other news, I am looking for work... by Shihar · · Score: 1

    ...I come with a BS in Chemical Engineering, and I would have voted yes on that poll.

    More stupid Americans means less competition for me.

  48. Re:Off Topic by zappepcs · · Score: 1

    I sort of agree with you. This story should be labeled as politics and the discussion should be about separation of church and state. The only link that has to news for nerds is how it might affect the scientific community at large.

    Thankfully, no fundamentalist has declared MP3s the work of the devil!... yet

  49. Re:How many non-religious don't believe in evoluti by smchris · · Score: 2, Interesting

    Speaking scientifically on the need for control groups and cross variable analysus I think it would be a pretty good idea to get some stats on that.

  50. Re:Loaded Post by Anonymous Coward · · Score: 0

    One should be careful one's mind is not so open that the brains fall out. Seriously, some beliefs really are just better than others.

  51. In unrelated posts... by Anonymous Coward · · Score: 0

    "But that couldn't possibly be related to poor science education, could it?"

    I wasn't aware that a "poor science education" consisted only of evolution.

    "America continues to worry about losing its edge in the high-tech industry."

    And atheists are continuely worried about losing their edge. Why is it any of your business what people believe? This is a free country and if people want to believe in creationism then they damn well have the right to do so without someone coming along and making hints that it's all the creationists fault that the world isn't some atheistic utopia.

    1. Re:In unrelated posts... by grasshoppa · · Score: 1

      This is a free country and if people want to believe in creationism then they damn well have the right to do so without someone coming along and making hints that it's all the creationists fault that the world isn't some atheistic utopia.

      Absolutely. If people wish to hamstring themselves in such a way that "magic" becomes a valid explanation of things ( even divine magic ), by all means we should let them.

      However, those same people lose the right to complain that we are losing our technological edge in the world. If you want to be part of the problem, you are welcome to do so. You don't get to complain about said problem at the same time, however.

      --
      Mod me down with all of your hatred and your journey towards the dark side will be complete!
  52. flamebait by Khashishi · · Score: 1

    How the hell did this story get past the editors? We already know what kind of worthless discussion will take place as a result. There's no point in discussing all the copious evidence for evolution. Anyone who would listen to such a thing already believes evolution. Fundies only accept one kind of argument, and logic isn't it.

  53. Infrequently used refutation of 10,000 year theory by hackwrench · · Score: 0, Redundant

    When someone brings up the 10,000 year theory, even though I've heard various long age of the universe statements in refutation, I rarely hear mention of the fact that there is evidence of human culture before 10,000 years ago. Maybe it should be brought up more?

    Wikipedia: 6th millennium BC

  54. On Topic by Teun · · Score: 1

    This story does not belong on Slashdot. This is not "news for nerds", and never will be.
    I feel a subject like the one at hand perfectly matches the other half of Slashdot's subtitle:
    Stuff that matters.
    --
    "The likes of Facebook and WhatsApp are free to those whose privacy is of zero value."
    1. Re:On Topic by Anonymous Coward · · Score: 0

      I feel a subject like the one at hand perfectly matches the other half of Slashdot's subtitle: Stuff that matters.

      I feel a subject like this one doesn't matter at all. This is just a religion vs science popularity contest. Why is it important that people belive in evolution? It seems to me science is a big topic and there are more useful ideas worth teaching.

      Two other highly politicized issues that are actually relevant are stem cell research and climate change. If 48% of people said global warming is prophesized in revelations and we should be looking forward to it then I would be worried.

  55. Beyond Belief by nih · · Score: 5, Interesting
    --
    I'm a rabbit startled by the headlights of life :(
    1. Re:Beyond Belief by EnsilZah · · Score: 1

      Or you could point to their website which has all the sessions for that matter:

      http://beyondbelief2006.org/

    2. Re:Beyond Belief by HoboMonkey · · Score: 1

      Great link. It made sifting through the comments worth it. Thanks.

    3. Re:Beyond Belief by Alsee · · Score: 1

      I found it hysterical when that guy Neil Tyson talked about winding up working in/for the Bush administration. What a hoot. He must have been hired by the same guy that hired Steven Colbert for the Correspondent's Dinner.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
  56. Stop calling them sheeple by GuyMannDude · · Score: 1

    For many reasons, we--the scientist and scientifically minded--kind of gave up on trying to explain our understanding and objectives to the "layman" and now the rift between us just keeps growing...

    First of all, speak for yourself. Lisa Randall is currently on tour giving lectures on cosmology. Stephen Hawking always has a sell-out crowd. You may personally have given up trying to explain science to laymen, but not everyone has. Some are actually taking time out of their very busy research schedules to present the material to the public because they feel it is sufficiently important.

    ...this is bad because sheeple they may be, but they elect those who set the rules and decide where funding goes (think stem cell research, etc.).

    "Sheeple" is such an offensive word, no wonder the public gives the ID folks a listen. You don't see them openly referring to the common man as "sheeple". The public is ignorant, yes, but describing them as some kind of sub-human species is way out of line. You make it sound like understanding science is simply not possible for them. If the material was presented in an interesting and persuasive manner (e.g., we stop referring to the audience as "sheeple"), I think you'd be surprised at how much they'd grasp and appreciate.

    GMD

    1. Re:Stop calling them sheeple by miskatonic+alumnus · · Score: 1

      If the shoe fits...

      Let me give you an example: It has long been known that the ratio of the circumference of a circle to its diameter is between 3.1415 and 3.1416. Yet, the biblical value is 3. I put the question to a student of mine -- do you believe the mathematicians and the evidence of your own eyes? Or do you believe GOD? The sheeple responded, under her breath, "god."

      I rest my case.

    2. Re:Stop calling them sheeple by Anonymous Coward · · Score: 0

      You don't see them openly referring to the common man as "sheeple".

      No; they just come right out and use the term "sheep."

      Look up the etymology of the word pastor. Count the number of times a Christian cleric refers to his "flock."

    3. Re:Stop calling them sheeple by The+One+and+Only · · Score: 1

      The public is ignorant, yes, but describing them as some kind of sub-human species is way out of line. You make it sound like understanding science is simply not possible for them.

      Maybe it isn't. One of the most difficult things for intelligent people is to comprehend just how dumb people can be and still manage to survive.

      --
      In Repressive Burma, it's not just your connection that dies. slashdot.org/comments.pl?sid=314547&cid=20819199
  57. You, sir, are an idiot. by Anonymous Coward · · Score: 0

    Imagine millions of junkyards, representing any given population. Now imagine a group of welders, who walk carefully through each junkyard, twisting this, bending that, attaching two pieces of junk here, cutting something apart there. They do it randomly and make only a limited number of small changes. Sometimes they don't change anything. This is a far more accurate representation of how genes mutate within an organism. It's not a single cataclysmic tornado.

    Now comes the natural selection. Let's test every piece of junk in every junkyard. Does anything work better? Does anything work worse? With millions of changes in millions of junkyards, it's inevitable that there will be some improvements somewhere. Part of natural selection is the eventual removal from the population of any organisms that are less well adapted, so to simulate this, we're going to eliminate all the junkyards where the junk was worse after the welders made their mutations. This leaves only junkyards that are stable, or that are improved. To simulate the next generation of the species, we replicate all of our current improved gene pool of junkyards, and again send in the welders. They make a few random changes in each, or no changes at all.

    Each time this entire process happens, the population of junkyards improves. But this doesn't happen just a few times. It happens millions or billions of times. The changes made by the welders are countless. The vast majority of changes are either useless or make things even junkier. Since natural selection automatically filters out the poorly adapted junkyards and rewards those rare improved junkyards with additional procreation, our population of junkyards gets better and better. Things start to take shape in the junkyards. Useful things. Stronger things. Things with abilities that nobody could have predicted. Any given piece of junk that improves is replicated in many junkyards, and reappears in millions of slightly altered forms each time. Pick the best version from each generation, and you can literally watch the same piece of junk evolve into a better, stronger, more useful, and better adapted machine with more capabilities. This is evolution.

  58. Wait what colleges did they check?? by NekoXP · · Score: 1

    Near me in San Antonio there are a couple of Universities, state funded and private. One of them is most definitely a Catholic university. Another is private. UTSA everyone else goes to. The add the colleges into the mix.

    If you go poll the Catholic university, and ask them if Creation was fact or if Evolution is a better concept, aren't you going to get skewed results, like one third of them towing the line from scripture?

    I'd really like to see the data rather than a news story, basically.

    As for the >90% believe in God thing, that's not too surprising, however, WHICH God? Did they just interview white Christians, or did they pull out Muslims, Jews, (arguably the same God but.. different concepts of it) pick another religion if you need to.

    In a country like the UK where I am from, a LOT of people believe in God. However a LOT of people also don't go to church every Sunday. In fact very few people do. That doesn't mean they are not Christian and don't believe in God. It means we have less wild-eyed evangelists, and keep it to ourselves, maybe. I think any poll of any country would throw a 90% value of some degree.

    Me, I don't give a shit. I think the universe was created when a couple of superdimensional membranes collided and the probability of some waveform occurring hit a certain level. Whether that is God, or it's a white dude with a white beard, I dunno. Believing the Earth was created 10,000 years ago is a bit silly, but then the Bible is nothing more than allegory in this sense; the idea is that it was a long time ago, longer than anyone alive can possibly remember and possibly imagine. Does it matter that they beleive 10,000 rather than 4 billion? Isn't that just math? Okay.. now I am thinking about when they tried to redefine Pi..

  59. Yea another poll is in the news as well.. by Anonymous Coward · · Score: 0

    90% of Americans believe there is a God. Does believing in a God, but accepting evolution a contradictory statement? On the surface it is yes. But I do not think we have a full grasp of humanity and how long we have been around.
     
    The possibilities of many civilizations over a long period of time before 6000 years ago is fully possible. If 90% of people believe there is a God, would not their God control time as well? Could not God create and destory man as many times as he wanted? Our history with God as we know it only goes back 6000 years or so. But this is just "as we know it".
     
    Man at the beginning of time was not concerned of logging his events in history. Mainly because it was the least of his concerns (food and survival were far more important) Also i've questioned, does genetic code mean we actually evolved from somthing? Think about it, genetics is just tiny bits and pieces to a whole puzzle. if you use some of the same puzzle to make somthing else, it does not mean it has "evolved". Look at the chimera goats with human kidneys growing in them. These goats did not 'evolve' but now will have partial human genetics from our intervention. Just some thoughts..

    1. Re:Yea another poll is in the news as well.. by remahl · · Score: 1

      No, it is not a contradictory statement. Not on the surface, not in any way.

  60. Quick, call in the "I'm better than you" Squad. by Anonymous Coward · · Score: 0

    "Come on, who cares? Let people be ignorant. It's not like bringing people of below average intelligence or fundamentalist mindset into the scientific fold is going to make them valuable contributors. It'll just be a new type of ignorance to deal with. Let them be."

    Rearranging the predjudice chairs I see. I have news for you. A lot of scientists are religious as well. You can believe that being religious and being scientific are incompatiable, but history both past and present shows otherwise. So the only ignorance on display is in this close-minded forum.

  61. Re:Alarming? Consider this... by Anonymous Coward · · Score: 0

    Reminds me of a quote from a philosophy class in college, "To believe that God does not exist, is to believe that a stiff wind could blow through a junk yard a create a 747." Which reminds me of a saying which goes something like, "Arguing with a religious person is like playing chess with a pidgeon. First the pidgeon knocks down all the pieces, shits on the board and then flies to his buddies to tell them how he totally destroyed hes opponent."

    P.S. For the grammar-nazis i'm not a native english speaker so I take no guarantee of the grammar correctness of the previous block of text.
  62. Not a surprise by joxeanpiti · · Score: 1

    When an high percent of they (US citizens) thinks that spain is in Mexico and almost all the american history previous to the european colonization doesn't exists.

    1. Re:Not a surprise by Anonymous Coward · · Score: 0

      When an high percent of they (US citizens) thinks that spain is in Mexico and almost all the american history previous to the european colonization doesn't exists.
      You're a fucking moron. Care to present any supporting evidence, asswipe?
  63. Sturgeon's Law by solios · · Score: 1

    The religion numbers alone are a solid proof of Sturgeon's Law (loosely pararphrased as "90% of everything is crap").

    Americans are idiots?

    Where's the surprise?!

  64. Science is NOT a religion by theendlessnow · · Score: 1, Insightful

    You have to understand that a Christian CAN be a scientist. There actually is quite a bit of evidence for a young earth. I don't think that a true scientist can say that evolution is fact. There are just too many contradictions. And in fact, more recent scientific discoveries tend to suggest that evolution is the religious dogma of blind zealots. Rather than accepting evolution as blind fact, scientists should be doing experimentation to support the idea of evolution... however, many of the experiments are done with faulty reasoning and make assumptions (of things that are not even good theory). Evolution is a hypothesis at best. The world has truly forgotten what the scientific method is. Now... we accept things as theories based on the popularity of the scientist. Which is sad. So... what will the future hold. Today's science is founded more and more on popularity. It has become more and more like science fiction. Science (those that do not believe in God) want to make sure that God does not exist... so, as evolution continues to fall apart (because humans DO like to learn and explore... so TRUE scientists will exist), the scientific community WILL undoubtably have to come up with another Godless answer to the creation of humanity. Personally, given our infatuation with science fiction, I believe that the next big popular "theory" will be the space seed theory. While it does not answer original creation, it will help satisfy the evidence of a young earth and a history that only goes back 4,000 years.

    1. Re:Science is NOT a religion by Hemogoblin · · Score: 1

      While your post is somewhat confusing, you make a couple of good points.
      1) Never accept things blindly
      2) Don't accept a theory simply because the scientist is popular.

      However, I don't understand what you are arguing for in the rest of your post. What is your point?

      Also, I did a fairly quick google search to find some articles providing evidence of a young earth, but I didn't find ANYTHING convincing. The only decent article I found has been thoroughly discredited by another scientist. Heres the link.

      What is this evidence of a young earth?

    2. Re:Science is NOT a religion by dbIII · · Score: 1

      There actually is quite a bit of evidence for a young earth.

      I think geology trumps a misinterpretaion of the bible any day. People should step back and realise that the argument is really about relatively new radical offshoots of Christianity trying to prove their supremacy by going after anyone that questions their simplified assumptions. It's even more unusual that these radical groups like to call themselves "Conservative" - even such a group as the Mormons that added an entire new book. It's a politically motivated argument and science is certainly not a religeon.

    3. Re:Science is NOT a religion by misanthrope101 · · Score: 1
      You seem to be citing almost the entire catalog of common creationist claims. Fortunately, they've all been addressed before.

      I believe that the next big popular "theory" will be the space seed theory.
      What's funny about your contemptuous reference here to Panspermia is that Fred Hoyle, who is the source of the "evolution is as likely as a tornado sweeping through a junkyard and assembling a 747" quote so often cited by creationists, believed in Panspermia. Thanks for making me smile at the irony.
    4. Re:Science is NOT a religion by Wildclaw · · Score: 1

      "You have to understand that a Christian CAN be a scientist."

      Statistically the better a scientist you are, the less likely it is that you believe in god. Doesn't contradict your statement, but is worth considering.

      "There actually is quite a bit of evidence for a young earth."

      This is incorrect. No such evidence exists.

      "I don't think that a true scientist can say that evolution is fact"

      Actually, evolution is an observable fact. The theory of evolution is not fact, but it is based on lots and lots of observations, including observable evolution in nature, fossils, breeding, genetics, and lots more.

      "Rather than accepting evolution as blind fact, scientists should be doing experimentation to support the idea of evolution... however, many of the experiments are done with faulty reasoning and make assumptions (of things that are not even good theory)."

      Such as experimentation with fruitflies? Or computer simulation with genetic algorithms? Or comparing genetics from different species? Or expanding our fossile record?

      "Evolution is a hypothesis at best."

      The theory of evolution is better supported than the the theories concerning gravity. We have no idea of the reason why gravity works as it does. We only have models that describe how it works. For evolution however we have a very nice mathematical algorithm that that we know for a fact works, and why it works. The algorithm even has practical applications outside of biology, mainly in computer science.

      The remaining text represents my personal opinion, and may seem harsh/trollish to many.... I firmly believe that anyone who can consider that the earth is 6000 years old, despite all the evidence contradicting it, must suffer from serious brain damage. That brain damage comes from repeated mental abuse during childhood where the individual is indoctrinated with faith, completly destroying that individuals ability to reason. Unfortunally the abusers are completly free to go about their business and are even protected by law.

    5. Re:Science is NOT a religion by Anonymous Coward · · Score: 0

      There actually is quite a bit of evidence for a young earth

      There are just too many contradictions
      Really? Please give some examples. How do you account for the vast amounts of evidence to the contrary from other disiplins?

      I don't think that a true scientist can say that evolution is fact
      Top of the class! Very little in science can be proven absolutely, so scientists would say that the evidence for evolution is so compelling that it can be treated as fact.

      Today's science is founded more and more on popularity
      Um, the article shows just how unpopular evolution is, so how can this be?

      as evolution continues to fall apart (because humans DO like to learn and explore... so TRUE scientists will exist), the scientific community WILL undoubtably have to come up with another Godless answer to the creation of humanity
      History has shown that well established scientific theory can be replaced by a newer theory (Newtonian physics was replaced by general relativity). However, the new theory must be able to account for all the evidence for the original theory. Creationism/ID fails to do this completely.
    6. Re:Science is NOT a religion by Hemogoblin · · Score: 1

      Poor form to reply to myself but whatever.

      I've been reading the TalkOrigins site and its actually quite excellent. Check it out if you're interested in evolution/creationism.

      http://www.talkorigins.org/faqs/faq-age-of-earth.h tml

  65. What we need... by Bones3D_mac · · Score: 1

    ... is someone (other than Al Gore) who can play the "fear" card about the potential consequences of the United States falling too far behind the other world super-powers (China, etc...) in the science and technology sector, as convincingly as these mega-church preachers do with the "eternal hellfire and brimstone" gimmick.

    These people need to stop drinking the religion kool-aid for a minute and start looking at the bigger picture here. That moral high ground they pride themselves on now isn't going to be around much longer once one of these other nations with the man-power, brute-force and morale to take us down actually does it. Our military power is rooted heavily in science, technology and playing the statistics, rather than raw firepower combined with large numbers of soldiers. Once we lose that science and technology edge we have now, not even God will be able to protect us.

    Anyone who still believes the concept of Mutually Assured Destruction keeps us safe in this day and age is a fool. Our enemies today don't care if they survive or not, so long as they take us out with them.

    If the statistics presented in this poll really are an accurate assessment of the U.S. population, then it sounds like Y2K boogie-man has most of the religious folk convinced that this is "end times", and that their death/rapture is coming, making them apathetic toward taking control of their destiny. In short, they "want" to die, but they want God (or someone else) to pull the trigger for them. People like this need to realize that their deaths will solely be a pointless product of man, rather than an act of God.

    I will never understand the reasoning behind one's willingness to die a pointless death as a matter of pride/spiritual closure...

    --


    8==8 Bones 8==8
    1. Re:What we need... by MikeBabcock · · Score: 1

      I've yet to figure out how anything you complain about has anything to do with belief in creation vs. evolution. The fact that many educated people believe in a created young world (which is not disprovable of course) does not mean they are implicitly stupid and/or will follow some self-destructive path. Many of the leaders who made the USA what it is today believed the same things and if its so bad, then you're a product of it.

      Honestly, believing that evolution is how we as a species came to exist at all is not required to study evolution itself. Belief in a young earth does not result in 90% of people having any different behaviour on 90% of subjects (unless perhaps they're a geologist I suppose).

      Get over it. A whole bunch of people on the planet who are taking your jobs happen to believe in reincarnation. Get over it.

      --
      - Michael T. Babcock (Yes, I blog)
    2. Re:What we need... by maxume · · Score: 1

      People are resoundingly average. 'We' simply can't maintain the 'science and technology edge' when China has 4 times 'our' population. The good news is that for the most part, they are interested in the same things as we are, which is generally anyway, making their lives better.

      --
      Nerd rage is the funniest rage.
  66. Religion and evolution by fireweaver · · Score: 4, Insightful

    The next time a jesus chrispie gets in your face about this, ask him this: "OK, so the bible says god this, that, and the next thing. Does it say anywhere HOW he did it? And if it doesn't, did you ever wonder why? Did it ever occur to you that if god is POWERFUL enough to make a universe and populate it with life, then he might also be SMART enough to make it run AUTOMATICALLY according to certain laws, such as gravitation and evolution, that don't require constant meddling and micromanagement? And that these laws are simple enough that us mere humans can actually learn and understand them?"

    I.e. "In the beginning, god created heaven and earth. For further details, consult a science book".

    1. Re:Religion and evolution by Anonymous Coward · · Score: 0
      > The next time a jesus chrispie gets in your face about this, ask him this: "OK, so the bible says god this, that, and the next thing. Does it say anywhere HOW he did it? And if it doesn't, did you ever wonder why? Did it ever occur to you that if god is POWERFUL enough to make a universe and populate it with life, then he might also be SMART enough to make it run AUTOMATICALLY according to certain laws, such as gravitation and evolution, that don't require constant meddling and micromanagement? And that these laws are simple enough that us mere humans can actually learn and understand them?"

      A better way to phrase the argument.

      Make the argument as you've phrased it. Then say "God, if He exists, created Man in His own image. Why are you (fundies) so insistent to return the favor? What's so bad about a God who's not only smarter than we do imagine, but who's smarter than we can imagine? I don't know about your God, but my God's bigger than any box I can build for Him."

      You gotta speak to the fundies in their own language. (You don't even need to believe in a God. Just make the fundie think you're open to the possibility, and you'll have its ear. Make it clear that you're waiting for a really big God, and you'll really have its interest. "OK, your best effort at a God can slap together a bunch of fake evidence for a 13-billion-year-old universe, mine invents the laws of physics and slacks off for 13 billion years for beings to evolve that can apprecate Him. If this God character's so omnipotent, why should I believe in your comparitively puny one?")

    2. Re:Religion and evolution by Dhalka226 · · Score: 1

      he might also be SMART enough to make it run AUTOMATICALLY according to certain laws, such as gravitation and evolution, that don't require constant meddling and micromanagement?

      That argument will not help. I am not aware of any Christians who overtly have any problem with the theory of gravity; the "it's just a theory!" thing about evolution is a knee-jerk response people make when you're questioning their faith.

      The Bible doesn't say anything about gravity. The reason so many people reject evolution is because it DOES say things about man and some sort of timeline for how things happened. (Seven days? Obviously some believe that is literal and some do not, but there is a timeline of some sort.) It makes no mention of fish crawling out of the sea to become man; it says god made man in his image.

      The bottom line is, you really can't debate people into giving up their faith. Faith is exactly that; it is belief in something we can't and don't know. It doesn't matter how many fantastic logical arguments you may make, because their belief is based on faith and not logic. I'm sure some religious folks will flame me for saying their belief is illogical, but that's the way it is.

      Live and let live is my philosophy. Don't force your religious views on me and I won't thrust my atheism/agnosticism (depending on how you define the terms) on you.

    3. Re:Religion and evolution by Anonymous Coward · · Score: 0

      Believe it or not, that's what some of us DO believe.

    4. Re:Religion and evolution by Phroggy · · Score: 1

      "OK, so the bible says god this, that, and the next thing. Does it say anywhere HOW he did it? And if it doesn't, did you ever wonder why? Did it ever occur to you that if god is POWERFUL enough to make a universe and populate it with life, then he might also be SMART enough to make it run AUTOMATICALLY according to certain laws, such as gravitation and evolution, that don't require constant meddling and micromanagement? And that these laws are simple enough that us mere humans can actually learn and understand them?" I absolutely agree with this line of reasoning. The problem is that although the Bible doesn't say HOW God did it, it does give an indication as to WHEN.

      The first chapter of Genesis says the Earth and everything on it was created in a week, and we can extrapolate from genealogies that this was roughly 6,000 years ago. Some people have suggested that a "day" wasn't really a day, but there is absolutely no indication in the text that the six days of Creation were meant to be taken as anything other than literal days.

      Although the word "death" often refers to spiritual separation from God rather than physical death, many people believe that there was also no physical death before the Fall of Man in Genesis 3. Evolution over millions of years would obviously have required physical death.

      Finally, Genesis 2 is fairly clear that man was created separately from the animals, differently than the animals, in God's image. Woman was also created separately, "taken out of man." This really doesn't make much sense within the context of evolution.

      I'm totally with you on other miracles such as Noah's Flood happening automatically through natural processes, though.
      --
      $x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
      $x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
    5. Re:Religion and evolution by blakmac · · Score: 0

      The next time a jesus chrispie gets in your face about this, ask him this: "OK, so the bible says god this, that, and the next thing. Does it say anywhere HOW he did it? And if it doesn't, did you ever wonder why? Did it ever occur to you that if god is POWERFUL enough to make a universe and populate it with life, then he might also be SMART enough to make it run AUTOMATICALLY according to certain laws, such as gravitation and evolution, that don't require constant meddling and micromanagement? And that these laws are simple enough that us mere humans can actually learn and understand them?"


      Sure does. It says God spoke the earth into existance. Wow, you just basically confirmed the words of the scripture. Or do you think that, based on your logic, God isn't smart enough to do that? You don't think that God is powerful enough to do something like that? His word created earth, and in doing so set forth certain laws that we could figure out? Wow. Nice logic! Who were you arguing with again?
      --
      http://wstewart.php0h.com - the sugarbuzz project blog
    6. Re:Religion and evolution by Harin_Teb · · Score: 1

      out of curiosity (and I could be wrong about this), isn't that one of the main tenants of ID?

  67. Re:Fortunately, It Doesn't Matter What You "Believ by m0nkyman · · Score: 1

    No, but the method of discovering the facts gets wonky when established facts are ignored when you go forward...

    --
    ~ a low user id is no indication I have a clue what I'm talking about.
  68. Fundamentalists distort bible by cjsm · · Score: 2, Informative

    The fundamentalists distort the bible to come up with their 5000 year theory. For starters, in Peter's Epistle, 3:8 it says to God a thousand years is but a day and a days is a thousand years. That indicates the days in Genisis for the creation are metaphorical, and are at least a thousand years. But Peter was just giving an example, and he could have easily have said to God a million years is but a day, or a billion years is but a day. You can't put human perceptions on God's perception of time.

    Furthmore, the Bible is full of parables, symbology, and methaphor. Jesus himself often used parables to describe even realtivley simple things, because the people of the time were unable to grasp much of his teachings. Since Jesus used parables to decribe realively simple things, it is likely the case, in fact certain that God used parables to describe the creation. Do you think primitive tribesmen would have been able to grasp something as complicated as the creation? No, they couldn't, therefore God used parables. When Jesus used parables, he was giving us a lesson on understanding the word of God.

    It might also be said that time, in prophecy, is frequently given in symbolic terms. That is, expressed in unconvential means because the time itself is meant symbolically. In Daniel 8, 2,300 evenings and mornings is given as time until the time of the end; seventy sevens is given in Daniel 9 to mean the same thing. A time, times, and half a time is an expression used for the length of time of the reign of the Beast. Jesus's forty days in the desert is linked to the Jews forty years wandering in the desert under Moses. Since time is used symbolically so frequently in the Bible, it is plausible that the days for creation in Genisis are sybmolic.

    When it comes to interpeting the Bible, fundmentalists can't see the forest for the trees.

    --
    This ad space for rent.
  69. Re:Alarming? Consider this... by allacds · · Score: 1

    "To believe that God does not exist, is to believe that a stiff wind could blow through a junk yard a create a 747."

    What about a near-infinite number of stiff winds, or a near-infinite number of junk yards blowing continuously for an infinite amout of time?

    http://en.wikipedia.org/wiki/Infinite_monkey_theor em

  70. action based on ignorance is dangerous by Anonymous Coward · · Score: 0

    Let people be ignorant.

    Ignorant people vote people like W. into office. Ignorant people support unjust wars, and happily tolerate any abuse of governmental power which does not directly impact them (as far as they can tell). Ignorant people oppress one another's freedoms in the name of their limited viewpoints (E.G. preventing people from choosing who they want to marry (homosexuals in particular), preventing people from making their own medical decisions (abortion, birth control methods, etc.), preventing people from making their own entertainment decisions (prohibition of alcohol, marijuana, and so on).

    Should gambling be illegal in some areas? Perhaps, but should it be made illegal because of its economic impact or because it is sinful? Is it right to deny erotic entertainers their livelihood just because a religion (which they may not share) says they are immoral?

    Freedom is the distance between politics and religion. Ignorance works wonders in closing that gap.

  71. Paleontology Major - Earth is 10,000 Years Old by sarahbau · · Score: 1

    For a few months in college, I had a room mate who was a paleontology major. He didn't believe that they lives millions of years ago. He also didn't think humans and dinosaurs lived at the same time. He thought that God put the fossils there.

  72. Hell in a Handbasket by Brandybuck · · Score: 3, Insightful

    Why is it that we insist on freedom of thought, unless it's thought we don't want people thinking? Am I the only one who sees the inherent hypocrisy of orthodox free thought?

    You're not going to Hell for not having a literalist interpretation of Genesis. But... neither is society going to hell in a handbasket because not enough people believe in evolution. It's okay if your auto mechanic believes something different from you. Your software isn't any better or worse because an evolutionist|creationist wrote it.

    Really, it's no big deal. Take a deep breath and relax. You'll find you'll live longer for it.

    --
    Don't blame me, I didn't vote for either of them!
    1. Re:Hell in a Handbasket by geek · · Score: 1

      It's because the creationists are actively lobbying to remove evolution from public education and have managed to do exactly that on several occasions.

    2. Re:Hell in a Handbasket by Seumas · · Score: 1

      The ignorant among us have the same voting weight as the rest of us do. When they make up a huge percent of our society, that means our entire future - including funding sciences and prohibiting sciences - are largely on the shoulders of people who believe lesbians caused 9/11 and Katrina, that people can rise from the dead, that someone can be pregnant without insemination, that burning bushes talk to them and that you're going to hell if you don't obey your mom and dad or wear mixed textiles yet find theories with significant scientific evidence - like evolution - to be impossibly absurd and ridiculous.

      They can think whatever they want, but when it comes down to it I don't want society eventually dictating that my only option to cure cancer is for me to pray super hard for it and that if I die anyway, it's because I'm a non-believing heathen who deserved to die.

    3. Re:Hell in a Handbasket by crashfrog · · Score: 1

      But... neither is society going to hell in a handbasket because not enough people believe in evolution. It's okay if your auto mechanic believes something different from you. Your software isn't any better or worse because an evolutionist|creationist wrote it.

      No. But it is the case that my car isn't going to get repaired by a mechanic who believes that the engine is just a hampster on a wheel; and my software isn't going to compile when it's written by the guy who thinks it's possible to write a general halting program. And it's really gonna be a cold day in hell before I allow a doctor near me who rejects the biological origin of the human body.

      I don't buy maps from people who believe in a flat Earth, either. These aren't just wacky beliefs we're talking about; we're talking about a lot of people who are basing their professional conclusions on things that just aren't true.

      --
      I never have frustrations, the reason is, to wit:
      If at first I don't succeed, I quit!
    4. Re:Hell in a Handbasket by rthille · · Score: 1


      The trouble I have with people "thinking" that evolution is wrong and that "god" created everything is that it's not thinking.

      It is just believing.

      Thinking involves examining your initial axioms for the likelyhood they are true and then using logical reasoning to reach a conclusion. These people are _not_ thinking!

      --
      Awesome furniture, accessories and cabinetry in Santa Rosa, CA: http://humanity-home.com/
    5. Re:Hell in a Handbasket by Brandybuck · · Score: 1

      Maybe the problem is "public education". Why should a federal administrator three thousand miles away know what's better for a child than the parents themselves? Government should not be everyone's nanny.

      While the abolition of government schools is not remotely feasible, there are a few things we can do to remove our children's education from the control of Bush/Pelosi. Put control back in the hands of the local counties. Legalize home schooling in all states. And provide a full tax credit (not voucher) for parents who opt out of the public school system by choosing private schools or homeschooling.

      --
      Don't blame me, I didn't vote for either of them!
    6. Re:Hell in a Handbasket by Brandybuck · · Score: 1

      Most people who hold to evolution aren't thinking either. They're just believing what others have told them. The number of people who have examined their initial axioms and then used logical reasoning to reach the conclusion that evolution is probable is a very small number.

      --
      Don't blame me, I didn't vote for either of them!
    7. Re:Hell in a Handbasket by Brandybuck · · Score: 1

      Yet we have no problem with the economically ignorant voting. The vast majority of voters don't know the first thing about economics, but they're still voting for things like wage and price controls, income redistribution, trade restrictions, etc. Most people, probably including yourself, believe all sorts of impossible things. Like how tarrifs protects jobs, how taxes aren't a drain on the economy, how minimum wages don't reduce employment, etc.

      People who know economics may still vote for these things, but at least they will be able to rationally weigh the costs against the benefits. Economics is far more central to our lives than evolution, yet its a subject that's nearly absent in public schools.

      --
      Don't blame me, I didn't vote for either of them!
    8. Re:Hell in a Handbasket by Anonymous Coward · · Score: 0

      But... neither is society going to hell in a handbasket because not enough people believe in evolution.

      I love these false dichotomies. Either it doesn't matter at all, or society is doomed. It couldn't possibly be something inbetween, right?

      In this particular case, though, I would argue that society is really going to hell in a handbasket. You have to be blindingly ignorant (yes, that's an insult) to not see the problems we're having with this. These people have actually been successful in removing evolution from the school curriculum in large parts of the US. Do you understand what that means? And such problems are just the direct, obvious ones, but it doesn't take a genius to figure out that if people choose to actively disbelief proven, empirical facts, that is going to have some secondary effects on their views on lots of issues. And they will make their beliefs manifest in the way they vote. Maybe, in a worst case scenario, that could result in a fundamentalist Christian coming to power in the US, and wrecking havoc not only on his own country, but the whole goddamn world. If you hadn't been sleeping under a rock during the last half-decade, you might have noticed that this actually happened.

      Really, it's no big deal.

      You're an idiot. Sorry, but there's no succincter way of putting it.

  73. The problem is... by Wilson_6500 · · Score: 1

    That most of _those_ people are selling herbs, homeopathic 'drugs,' and supplements--which people are buying. Folks just don't realize the value of science these days.

  74. An interesting idea doesn't equal fact by onlyfacts · · Score: 1

    Keep it simple - post facts related to evolution and I will listen and debate. So far only conjectures and ideas about the origin of man have been created by clever people and all the evolutionists just say "if enough of us smart people say evolution is true then it must be true". Hogwash and very narrow minded. So far no facts, just a bunch of BS. Post the facts or shut up.

    1. Re:An interesting idea doesn't equal fact by Anonymous Coward · · Score: 0

      Post the facts or shut up.

      You first, Bible-thumper.

      Got any evidence at all that supports claims like the Earth is only 5000 years old? Yeah, didn't think so.

    2. Re:An interesting idea doesn't equal fact by SEMW · · Score: 1

      If you really want to read up on the facts of evolution, and aren't just trolling, there are many resources available to you. http://en.wikipedia.org/wiki/Evolution comes to mind. Http://www.google.com does as well. I see little point in copying and pasting large swathes of evolutionary theory into a Slashdot post for you until you find something you want to argue with.

      --
      What's purple and commutes? An Abelian grape.
    3. Re:An interesting idea doesn't equal fact by onlyfacts · · Score: 1

      There you go ago - more broad stroke stuff. Just need one tidy fact where they have confirmed through scientific observation and unbroken chain of evidence where one species has evolved into another species - you won't find that fact anywhere on any google. You will find large gaps of "insert imagination here" and micro evolution within a species -- just give me one fact not another "it's everywhere if you can just imagine".

    4. Re:An interesting idea doesn't equal fact by SEMW · · Score: 1

      Just need one tidy fact where they have confirmed through scientific observation and unbroken chain of evidence where one species has evolved into another species - you won't find that fact anywhere on any google. Well, obviously. Evolution is comprised of many, many small changes, taking place over a very long time. The time it takes for enough changes to accumulate in order to reasonably call something a new species is of the order of millions of years; hardly something that takes plae in a lab.

      Also, Natural selection is a continuous process, and the dividing line between different species if fairly arbitary (http://en.wikipedia.org/wiki/Species_Problem). If an organism is, through natural selection, gradually changing, when do you decide it's a new species? If many small changes in an organism accumulate over millions of years, enough for it to be generally agreed to be a different species to what it was when it began, when do you pinpoint where it "became" a new species?

      You will find large gaps of "insert imagination here" and micro evolution within a species I would question the way you're seperating microevolution and macroevolution, as if they were somehow different processes. Fairly obviously, lots of small changes (what you're calling microevolution), over a very, very long timescale, add up to big changes. Exactly what gaps of "insert imagination here" do you think are needed?

      just give me one fact not another "it's everywhere if you can just imagine". I'm rather puzzled by your demand for "one fact". If you're looking for an explanation of evolution and a summary of the evidence for it I believe I already posted the Wikipedia link; otherwise, what sort of fact? More precisely: what part of evolution are you disputing?
      --
      What's purple and commutes? An Abelian grape.
    5. Re:An interesting idea doesn't equal fact by onlyfacts · · Score: 1

      If evolution is so dominant, we should easily find a fossil record that clearly shows the process of evolution. This simply does not exist, not even close. So, you would think that with billions of years and trillions upon trillions of reproduced species, we could find one simple case of a species evolving into another - you won't find it anywhere - this is the true test of evolution, the fossil record or a lab experiment which observes information being added to DNA naturally to produce a higher order species or another species - again, has never happend. I consider this the true test of evolution and evolutionsts have given up on this aspect - they created Punctuated equilibrium to fill in the gaps - wiki that .

    6. Re:An interesting idea doesn't equal fact by SEMW · · Score: 1

      If evolution is so dominant, we should easily find a fossil record that clearly shows the process of evolution. This simply does not exist, not even close... you won't find it anywhere - this is the true test of evolution, the fossil record http://en.wikipedia.org/wiki/Evolution_of_the_hors e

      Quick googling brought up the above. It seems to fulfil all your criteria pretty well -- very complete fossile record, including full sequence of transitional fossils, etc. Regarding punctuated equilibrium; if I may quote from Wikipedia:

      The theory of punctuated equilibrium developed by Stephen Jay Gould and Niles Eldredge is often mistakenly drawn into the discussion of transitional fossils. This theory, however, pertains only to well-documented transitions within taxa or between closely related taxa over a geologically short period of time. These transitions, usually traceable in the same geological outcrop, often show small jumps in morphology between periods of morphological stability.
      --
      What's purple and commutes? An Abelian grape.
    7. Re:An interesting idea doesn't equal fact by onlyfacts · · Score: 1
      Nice try, the evolving horse thing has been around for awhile, too bad wiki doesn't point out the alternative discussions on it. A good one is http://www.answersingenesis.org/creation/v21/i3/ho rse.asp and another is http://www.answersingenesis.org/creation/v17/i4/ho rse.asp

      At the end of the day, even if one were to ignore all the flaws in this horse evolution (there are many), you still have a horse! I need to see that next step down where the horse evolved from a different species altogether like a fish. There should easily be a fossil record showing the process - doesn't exist.

      This horse evolution "fact" and many others are not vetted properly, if they were, they would never be allowed in print. Instead many unethical scientists have "created" their own facts and/or not fully explained how they derived their information - such as the case with the horse evolution - a lot of information was left out about how the fossils were gathered and how they are (not) related.

      As to PE, it is still an insane idea, even if Gould tries to lend it credibility by limiting its scope to within a taxa. All he has to do is string enough of these "poofs" together to skip over a lot of unexplained gaps.

    8. Re:An interesting idea doesn't equal fact by SEMW · · Score: 1

      I need to see that next step down where the horse evolved from a different species altogether like a fish. There should easily be a fossil record showing the process - doesn't exist. You seem to be confused as to what a species is. The Wikipedia horse evolution page encompassed a good 12 different species changes over 60 million years. If you are challenging me to find proof that horses evolved from fish, then you're right, it doesn't exist. Possibly this could be because evolution is wrong. Possibly also it could be because horses didn't evolve directly from fish.

      many unethical scientists have "created" their own facts... I find this almost unbelivable. You are are accusing the editors of several refereed, peer-reviewed scientific journals, including Nature, of publishing a large number of articles which "creating their own facts" -- on the basis of claims of a Minister with no scientific qualifications writing in a website called "Answers in Genesis"?! Much as I hate to bring out the Argument from Authority, fallacious though it is when used to support a claim, if this is going to come to a your-word-against-theirs with you accusing anyone who brings evidence in support of evolution of fabricating the evidence, I'm afraid I'll have to side with the refereed scientific journals, thanks.
      --
      What's purple and commutes? An Abelian grape.
    9. Re:An interesting idea doesn't equal fact by onlyfacts · · Score: 1

      I at least I read your article you suggested, you clearly didn't read the one I sent. So why proceed with this discussion if you aren't going to read alternatives and try to debate the facts? Are you interested in facts and truth or just defending your position at all costs?

      Scientists not ethical? Don't get me started. Ernst Haeckel is one of the more infamous scientists who admitted to creating evidence with his embryo charts trying to show the evolutionary relationships between species. He forged his evidence!

      Let's see the most recent being the Korean scientist last year who fabricated his own results for genetic research -- hmm, sounds like scientists can lie and cheat with the best. The pressure to "publish or perish" is intense and evolutionary dudes today have no less temptation to try and win the battle. Today they don't have to fabricate evidence, they just call everyone else stupid and then wave their hands about how complex it is even though it has huge gaps of logic and evidence.

      Macro-Evolutionary predictions for future species. Really? I haven't heard of any, just give me one. Micro-evolution is NOT macro-evolution and in fact essentially would be counter-productive to suggest they are related or based on one another.

  75. US No longer technology king by Anonymous Coward · · Score: 1, Funny

    http://slashdot.org/article.pl?sid=07/03/28/204224

      I guess we must not be praying hard enough.

  76. Stupid vs. Smart by tim620 · · Score: 1

    I find it interesting that people on Slashdot (and elsewhere) follow the belief that if you believe in creationism and intelligent design that you are "stupid" and if you believe in evolution you are "smart". I know a number of highly educated people that believe in creationism. Evolution is a theory, not necessarily a fact. The same is also true for creationism. Being a Christian, I believe in intelligent design. I believe we were created by God. But, I don't really care how He did it. I don't really care if He used evolution or the creationism theory. I don't really care if the earth is 5000 years old or 5 billion years old. Either could be true, but in the long run, it doesn't matter. Believing in evolution or not, does not matter when my grandpa is dying or my friend gets divorced or my neighbor's house burns down, etc. It doesn't affect my day to day life.

    1. Re:Stupid vs. Smart by Anonymous Coward · · Score: 0

      "Evolution is a theory, not fact."

      You know, this is absolutely true. But from an actual scientific point of view, it's also a totally meaningless thing to say. Theories are not "proven" in natural sciences as they are in mathematics. Basically everything, including for example the theory of relativity, are just that, theories. They are judged by the accuracy by which they describe and predict the relevant natural phenomena, at which evolution excels as do other widely accepted scientific theories.

      Logically, Creationists should also try to ban Newtonian mechanics and even Relativity from Physics class, even more so actually since we already know they are "false". Newtonian mechanics fails at velocities near the speed of light, and Relativity fails when quantum level phenomena is relevant. However, given these restrictions even Newtonian mechanics is remarkably accurate and useful theory (and a lot easier than Relativity) so no-one in their right mind is trying to prevent it from being taught.

      Labeling evolution as "just a theory" does not disparage it in any way even though that's the intention of the Creationist double talk. Furthermore evolution is a scientific theory; it meets certain criteria such as being based on scientific principles. Intelligent Design fails spectacularly at this, though I guess you could call it "just a theory" as well. Just one that isn't based on any established principles and without any explanatory power.

    2. Re:Stupid vs. Smart by tim620 · · Score: 1
      You are correct in your description of theory and scientific theory and I fully agree with your analysis.

      I realize that Intelligent Design is also a theory. However, for me it is a matter of belief. It is a matter of taking a "leap of faith" and believing that God exists and created the universe. I have no scientific proof of His existence and I never will. The only principles I have are the Bible and the experiences of what He has done in my life and the lives of others.

      As far as the creationism vs. evolution debate, if either one was proven to be false, it would not change my faith in the creator God.

  77. Bias? by Zonekeeper · · Score: 1, Interesting

    An alarmingly high number of individuals...


    This blatant bias is why most of Slashdot, outside of the circle of regular posters, will always be regarded by the rest of us as a nest of total losers. You may have your opinions about any number of ideas, and people such as myself (which despite what your opinions are, are 98% of the time WAY more informed than this inner circle) may often agree with many of the things posed here (and in regards to the subject at hand, I too think that there was way more than some magic wand waving around to the creation of the earth/universe/etc.). That said, when you start posting straight off that anyone who has a different opinion especially when it involves deep seeded spiritual beliefs must be somehow stupid, uneducated, or just a moron, then you have already lost the argument. Does the phrase, "catch more bees with honey than with vinegar" mean anything to you? Probably not. I'm sure you justify this with "oh they're too stupid to waste my time on". Hey, I feel the same way a lot of the time. But if you have any delusions that you're accomplishing anything more than one big circle-jerk, any thoughts towards influencing others to your way of thinking, then you have approached it from the perfectly, exact wrong direction. Attitudes like that don't win anyone over, it makes them turn around and go listen to someone else, anyone else, who doesn't come across as a sanctimonious asshole, such as is often the case here. And please, none of this "religion is the biggest bunch of arrogant people there is!" crap either. The belief in science as the total master of everything to the point of sterilizing any kind of faith or hope from any and all subjects, has become a far more powerful religion than most traditional religions could have ever hoped to be. And its a religion completely devoid of anything inherently "human".
  78. Re:Alarming? Consider this... by ahodgson · · Score: 1

    Please, try and educate yourself before speaking in public. Evolution (as in natural selection) is the only theory that adequately explains the complexity of life. The "747" didn't appear from nothing, it evolved from very simple parts over at least 3 billion years that were subject to ongoing selective pressure. Natural selection can use random mutations to evolve complexity in a remarkably short period of time.

    If you require God to explain the existence of complexity, then please also explain where God came from. It's a circular argument; adding God to the equation doesn't answer anything. If God must exist to create complex beings, then something equally or more complex must have pre-existed to create God. Ad infinitum.

  79. A holiday in Cambodia by Anonymous Coward · · Score: 0

    I believe Pol Pot liked burning science teachers...

    1. Re:A holiday in Cambodia by bmo · · Score: 1

      Someone mod parent up, please.

      You shouldn't have posted anon.

      --
      BMO

  80. Don't read TFA in this case! by Anonymous Coward · · Score: 0

    Read the source poll instead:
      http://www.msnbc.msn.com/id/17875540/site/newsweek /

    The article is inaccurate: it's only 39% of americans who reject evolution and 48% accept it. Still, the poll shows clearly how these things cannot be polled reliably over a quick phone conversation: people need to think before they answer. According to the poll, 40% of ATHEISTS say they believe either that God created us in our current form, or that God guided our evolution process over millions of years. I repeat: 40% of ATHEISTS say that God helped in our creation.

  81. Re:Fortunately, It Doesn't Matter What You "Believ by antiMStroll · · Score: 1

    Unfortunately it matters to society. Unfounded beliefs of all sorts - religious, economic, racial, and nationalist - have caused incalculable harm and the deaths of uncounted millions throughout history. It may have no effect on physical processes but it has a very real effect on people.

  82. "Message to religious people..." by Anonymous Coward · · Score: 0

    Found this treasure on YouTube.com which just about sums up how I view religious people...

    http://www.youtube.com/watch?v=-fY8nD236xw

    Man of Faith? No.
    Man of Science? Yes. :)

  83. 48% of Americans Reject Evolution...So? by MSTCrow5429 · · Score: 1, Interesting

    How does this matter? Whether people believe in evolution or not is irrelevant. People are not going to stop inventing, trading and banking simply because they disagree with someone else about a purely abstract idea. The world will not end. This is just elitist preening.

    --
    Slashdot: Playing Favorites Since 1997
    1. Re:48% of Americans Reject Evolution...So? by SEMW · · Score: 1

      People are not going to stop inventing, trading and banking simply because they disagree with someone else about a purely abstract idea. "Purely abstract"? I can see an argument for some pure mathematics to be described as "purely abstract"; but evolutionary biology "purely abstract"? Hardly!

      Regarding your main point, we sadly live in a democracy, which means these people can vote; and more specifically, vote for the people who get to decide whether to fund scientific research or "faith-based" initiatives. Ah, Democracy -- The Worst System Of Government (apart from all the others).
      --
      What's purple and commutes? An Abelian grape.
    2. Re:48% of Americans Reject Evolution...So? by MSTCrow5429 · · Score: 1

      Technically (or in theory) we live in a republic, not a democracy. The problem with a democracy is when you bestow upon 51% of the voters the ability to pick the pockets of the other 49% for their own pet causes, you end up with monolithic groupthink, no competition, and therefore no innovation. There should not be a choice between "scientific" research and faith-based initiatives on the government dole. The free-market, while imperfect, is a far better allocator of scarce resources among a cornucopia of options beyond the binary options of government administrations. I'd rather convince 10% of the population that my idea is correct and thereby gain funding through voluntary means than convince 51% of the population that my idea is correct, and then proceed to plunder the entirety of the productive citizenry for my own pleasure.

      --
      Slashdot: Playing Favorites Since 1997
    3. Re:48% of Americans Reject Evolution...So? by SEMW · · Score: 1

      The free-market, while imperfect, is a far better allocator of scarce resources among a cornucopia of options beyond the binary options of government administrations. I'd rather convince 10% of the population that my idea is correct and thereby gain funding through voluntary means than convince 51% of the population that my idea is correct, and then proceed to plunder the entirety of the productive citizenry for my own pleasure. Well, sure, if you're happy with a drastic cut in the amount of blue-sky research. The number of companies willing to fund such research are very few, since by nature it has a very low chance of producing much revenue for the comany in the near future, so is not good value to the shareholders. Sure, it may improve scientific understanding of the universe, possibly decades later, but what do companies care about that? The majority of blue-sky research is carried out by universities, which heavily rely on government grants and are, of course, non-profit organizations.

      Cast your mind back and ponder exactly how many of the major breakthroughs in scientific understanding were made at universities with publically funded research grants, and how many were made at private companies. If after that you're happy with no research other than that which someone can convince a company will make a good profit for them, go right ahead.
      --
      What's purple and commutes? An Abelian grape.
    4. Re:48% of Americans Reject Evolution...So? by MSTCrow5429 · · Score: 1

      Xerox PARC, IBM Research, Intel and AMD research ventures, etc. etc. Major breakthroughs, whether utilized by their creators or not, have most certainly come out of private industry. I do not dispute that some breakthroughs have resulted from "public" funding of research ventures, but the amount of dollars invested for results, both practical and theoretical, must be vastly increased over that of the civil sector for an equal number of breakthroughs. I am not a vulgar scientist, and I do not have an amoral view of life, in which the only motivating factors are how much I can get from whatever possible source, regardless of the method of extraction. I am equally concerned with whether the funds allocated for my own use are through voluntary cooperation, or through coercive (i.e. violent or under the threat thereof) methods. To do good, one must first do no harm. Taking a million dollars in tainted funds, even if it would save two million lives, is not morally justifiable.

      --
      Slashdot: Playing Favorites Since 1997
    5. Re:48% of Americans Reject Evolution...So? by SEMW · · Score: 1

      Major breakthroughs, whether utilized by their creators or not, have most certainly come out of private industry. Sure -- very specific, applied research, in their fields. But flip through a theoretical Physics journal. How many papers in there are from private companies? And Mathematics, even more so -- if you can same a single private company that's doing research into *pure* mathematics, I'll be very impressed. This is because it simple takes so long for new discoveries in pure mathemaics to filter down; to find applications in applied mathematics, then theoretical Physics, then actual applications. It always happens eventually, but the timescale is too long for companies to bother with it; not enough return on investment. Doesn't change its usefulness, nor the huge loss to society were funding for it to be withdrawn.

      I do not dispute that some breakthroughs have resulted from "public" funding of research ventures I like your use of "some". Ask someone else to list the biggest Scientific breakthroughs in our understanding of the universe. Things like the theory of Gravity, the laws of Thermodynamics, Relativity, etc. Count how many were made at universities and how many were made by private companies. No, I'm afraid Einstein's job at the patent office at the same time as he was studying at the University of Zurich doesn't count.

      but the amount of dollars invested for results, both practical and theoretical, must be vastly increased over that of the civil sector for an equal number of breakthroughs. Breakthroughs in different fields. Industry is never going to invest in pure maths research. Few industries are willing to invest in blue sky research. Certainly private research is good, but it must come alongside independent, collaborative, blue-sky research at Universities, not instead of it. After all, it's not as if the research done by private companies will in any way be reduced if the government funds public research -- in fact, quite the opposite; research invigorates research, new understanding in theoretical maths/physics from Uni research will lead to more applications coming as a result of private research. They complement each other!
      --
      What's purple and commutes? An Abelian grape.
  84. Evolution is just another religion by Anonymous Coward · · Score: 0

    The reason why people don't accept the belief of evolution anymore is that after a couple hundred years of searching all over creation, not a single piece of evidence has ever been discovered to support it. Evolution is fundamentally equivalent to Scientology. It's just so far out there that I just hear people preaching evolution and calling everyone else ignorant zealots, and I can't help but laugh. For most people, it's more logical that there is a supreme being that created everything in the universe than that hundreds of millions of random anomalies resulted in everything that exists. If Darwin was so sure of his theory of evolution, he would have used more than negative proof to explain it. The reason why the U.S. is falling behind the scientific curve is that scientists waste most of their time trying to prove evolution than investing in something that can actually be done, say a cure for diseases, etc. The only true way to KNOW how everything came to exist would be to build a time machine and keep going back until the beginning of time, and even time travel is more probable than evolution. Stop calling those who believe in evolution ignorant and closed minded when you are guilty of the same thing.

  85. Re:Alarming? Consider this... by Anonymous Coward · · Score: 0

    And that is less likely than an omniscient, omnipotent being popping up out of nowhere, creating the universe, Earth, people and gay sex, and then sending people to hell for participating in gay sex? Riiight.

  86. Quick, call in the "/.-sided" Squad by Anonymous Coward · · Score: 0

    "We care, because these people are also making our laws, electing our politicians and teaching our kids."

    And your side is not? So who's fault is that? Get out! Get a woman, and get a life!

    1. Re:Quick, call in the "/.-sided" Squad by Anonymous Coward · · Score: 0

      and what, try to out-procreate the young-earth fools with their faulty science?

  87. Forget the War on Drugs... by Phrogman · · Score: 1

    Time to start fighting the war on Ignorance and Stupidity...

    Oh wait, you president is probably amongst the 48% of immensely ignorant people isn't he? Nevermind, please carry on your slow slide into national collapse.

    --
    "The first time I got drunk, I got married. The second time I bought a chimpanzee, after that I stayed sober" Arian Seid
  88. More news...Americans aren't good at maths either by Roger+W+Moore · · Score: 1

    ...and a majority of Americans are christians.

    Apparently this problem extends to maths as well. Since when has 48% been a majority?

  89. Wow. by Anonymous Coward · · Score: 0

    An alarming 34% accept the bible.
    Ouch. I see how it's alarming but because more should accept it.
    Science clearly states that things move toward disorder. Creating the earth doesn't seem like disorder to me.

    1. Re:Wow. by loxosceles · · Score: 1

      Claims like that demonstrate the failure of scientists and the media to communicate science to the general public. Like so many others who think Earth (or life) represents an impossible increase in "order", you think you understand entropy but you don't.

      Learn what thermodynamics actually says. Google for "fermi thermodynamics site:amazon.com". Some (not much) calculus required.

  90. Re:Fortunately, It Doesn't Matter What You "Believ by lawpoop · · Score: 1

    Oh good, for a minute there I thought the heavens were going to crash into the Earth because people didn't understand exactly how they worked...

    Natural phenomena still continues in spite of the fact that people don't understand it or believe in the most accurate theory. So what? What is the value of pointing that out?

    "Reality is still reality despite what you believe" is an argument that works on *both* sides of the debate. It doesn't get us anywhere.

    --
    Computers are useless. They can only give you answers.
    -- Pablo Picasso
  91. 48% percent of the world by iminplaya · · Score: 1

    reject Americans

    --
    What?
  92. there's something wrong with the poll by c6gunner · · Score: 5, Insightful

    It's not in TFA, but the poll also reported the following statistics:

    27% of Agnostics and Atheists think God guided the process of evolution
    13% of Agnostics and Atheists think God created man in his present form.

    So a better title for the article might have been "40% of Atheists believe in God".

    When you're getting that kind of result, it might be a clue that there's something wrong with your methodology.

    1. Re:there's something wrong with the poll by Anonymous Coward · · Score: 0

      It is not impossible to be agnostic and to also believe in god. I admit there's some disagreement about what the terms actually mean, but to oversimplify agnosticism it's "I could be wrong"-ism, with the really hardcore ones possibly saying "I can't possibly know" or "I care not at all". But in general, it's the opposite of fundamentalism, on both atheist and theist camps. It is, essentially, skepticism -- at this time I think ________ but that could potentially change.

      Of course, agnosticism is almost as stigmatized as atheism so you won't get a lot of nominal agnostics copping to the fact. Also, again, there's disagreement as to exactly how the terms should apply, making for a descriptivist's nightmare.

    2. Re:there's something wrong with the poll by Coryoth · · Score: 1

      27% of Agnostics and Atheists think God guided the process of evolution
      13% of Agnostics and Atheists think God created man in his present form.

      So a better title for the article might have been "40% of Atheists believe in God". How you come to the conclusion you do baffles me. For starters it is not at all clear that "God guided the process of evolution" and "God created man in his present form" are mutually exclusive ideas - it would quite possible to believe both. Thus there is likely to be a high degree of intersection between the 27% who believe God guided evolution, and the 13% who believe God created man in his present form. As long as there is a non-empty intersection you can't just add the percentages together to get 40%.

      Secondly the article was talking about "Agnostics and Atheists" which you somehow convert into just "Atheists". Agnostics simply believe that the question of whether God exists or not cannot be answered. That doesn't preclude a belief in God. Thus you could have absolutely non of the Atheists believing in God, and a larger percentage of Agnostics believing that God guided the process of evolution.
    3. Re:there's something wrong with the poll by c6gunner · · Score: 1

      For starters it is not at all clear that "God guided the process of evolution" and "God created man in his present form" are mutually exclusive ideas - it would quite possible to believe both.
      Right, I should have specified: Both answers were part of the same set, therefore any one responder could chose only one answer. Adding them together is perfectly valid if we're simply looking for belief in God.

      Agnostics simply believe that the question of whether God exists or not cannot be answered. That doesn't preclude a belief in God.
      Nonsense. While you may be technically correct about the actual definition of the term "agnostic", you're RTFO about the rest of it. I know many, MANY agnostics, yet not a single one of them would say that they believe in God. Most people who describe themselves as Agnostic will state that they neither believe nor disbelieve.
    4. Re:there's something wrong with the poll by chill · · Score: 1

      Okay, they all flunked science but YOU flunked math.

      It is quite probable that those 13% are a subset of the 27%, so you don't add the numbers together. Thus, 27% of Atheists and Agnostics believe in God would be the alternate title. This is entirely probably if you're sample base includes 1 Atheist and a crapload of Agnostics.

      --
      Learning HOW to think is more important than learning WHAT to think.
    5. Re:there's something wrong with the poll by DarthSideous · · Score: 1

      I agree. The questions are poorly worded also, and bias the results.

    6. Re:there's something wrong with the poll by c6gunner · · Score: 1

      no, I just phrased it poorly. see here.

    7. Re:there's something wrong with the poll by alissy · · Score: 1

      Oh, good. I'm not the only one who noticed that.

    8. Re:there's something wrong with the poll by darkwhite · · Score: 1

      The definition of agnosticism is ridiculously overly broad in the American cultural establishment. Those figures are not surprising, since "agnostic" in American English means all the religious stances from "I'm religious but I don't want to offend any of the several religions I like, so I dither between them, so I'm agnostic" to "I'm not interested in defining my religious stance" to "all kinds of religion including atheism are equally absurd and intellectually weak, and so is this classification system, but if you want a pigeonhole, then call me agnostic".

      --

      [an error occurred while processing this directive]
    9. Re:there's something wrong with the poll by Uncle+Kadigan · · Score: 1
      all kinds of religion including atheism

      I'm aware there are plenty of religious fundamentalists that believe that atheism is a religion, but that does not make it so. You will have a very hard time trying to produce an actual atheist who considers atheism a religion. The lack of a god-belief does not require faith. Most people would not call the lack of belief in the Easter Bunny a religion, either.

    10. Re:there's something wrong with the poll by darkwhite · · Score: 1

      The lack of a god-belief does not require faith.

      This is the whole point that I'm trying to make. The classification as it is does not allow for a distinction between the lack of belief and a belief in the non-existence of a deity. As far as I can tell, at least in common usage, the current classification implies a belief in an atheist, and the lack of all belief to be a flavor of agnosticism.

      --

      [an error occurred while processing this directive]
  93. Two creation stories by Sigma+7 · · Score: 1

    Furthermore, 34% of college graduates said they accept the Biblical story of creation as fact.


    There is one further question: Which one?

    Genesis Chapter 1 has animals created before man. Genesis Chapter 2:19 implies that animals were created after man. As always, if you want to accept something as fact, you need to prepare to handle any contradictions that arise (or otherwise accept it as "best fit" or a theory.) The forceful application of religion as fact as resulted in problems, also known as witch-burning or equivalants thereof.

    A scientist that digs the mysteries of a universe can easily believe that his deity is more intelligent than what most people think, as it takes skill to make self-assembling life forms without micro-managing the design.

    As a final point, there's one religion that embraces the theory of evolution - which proves that science and religion are not incompatible.
  94. YOU HAVE LOST CONTROL OF YOUR SCHOOLS! by Anonymous Coward · · Score: 0

    Hey,

    If you're not an AmericanChristian you are in big effin trouble.

    No honestly, this is horrid, disgusting, you have lost control of your schools! This is not about politics, or controversy or retarded Americans, it is about the fact that what used to be one of the most civilized lands, a nation representing advancement in human developement has been lost.

    Fanatics control your schools, producing more fanatics, every day. If you don't see that your country is, not in trouble, or even great danger, but in 'end-stage-cancer' danger, then you are not seeing clearly.

    All the philosophies of history, all other religions, any other view of the world is wrong; except for a particular 'hyuck-hyuck' greed and violence form of state-sponsored do-as-I-tell-you old-testament numbsskullism?

    THEY CONTROL YOUR SCHOOLS! Fer fracks sake go watch 'Invasion of the Body Snatchers' again.

    One more time. The people teaching this stuff don't believe it. They teach it for reasons that have nothing to do with philosophy or religion, it is about social control.

  95. Fair enough, but... by GuyMannDude · · Score: 1

    You misconstrued my point.

    Ah, but see, the beauty is that this is exactly my point! I perceived hostility and elitism in your post and immediately stop listening and giving your point of view a fair evaluation. And guess what? That's what (almost) everyone does! I'm saying that we as scientists need to start paying as much attention to how we get out message across as what that message is. We like to believe that the truth will be so amazing that the public will accept it, no matter how terribly it's delivered. That's just not realistic.

    Getting the word out in a compelling manner seems like it would be a good answer, but that strategy has to fight apathy and indoctrination, both of which are much stronger. For better or worse, there is no way to replicate the techniques of what I'll call the dark side (for lack of a desire to think of a better phrase) without walking the dark path.

    I agree with your first sentence ("apathy and indoctrination are stronger") but disagree with your second. Yes, the onus is on us to take a complex subject and make it understandable to a public that lacks very basic scientific and mathematical knowledge and skills. It's a tough challenge. But if we're really so smart, we should be able to tackle this! Fuck, we can send someone to the moon using spacecraft equipped with computers that pale in comparison to modern cell phones, but we can't teach most people the basics of evolution? I don't believe that and this gets to your second sentence. The ID proponents probably aren't as truly, deeply intelligent as scientists are so they have to fall back on "dark side" techniques to make their case. It's quicker, easier, and more seductive. We are (supposedly) better so we ought to be able to make our case while still staying in the light. The dark side isn't more powerful, it's just easier. For those of you who think science has to be boring, I would encourage you to check out some of the graphs in Edward Tufte's books. Many of those are so well done that they communicate very powerful information in a manner that is intuitively understandable and aesthetically pleasing to the common man.

    We need to start paying attention to how we get the word out about evolution. What we're doing now isn't working. I'm not calling for scientists to use the techniques of the ID hooligans. But I am saying that we can't just throw the data out there and expect it to do the work for us.

    GMD

    1. Re:Fair enough, but... by alba7 · · Score: 1

      I'm saying that we as scientists need to start paying as much attention to how we get out message across as what that message is. We like to believe that the truth will be so amazing that the public will accept it, no matter how terribly it's delivered. That's just not realistic.

      The strange thing is that you are not the first people to have this kind of problem. Yet nobody seems to look for historic or foreign examples. So I'll have to agree that elitism of US scientists is a huge part of the problem.

      On the other hand Europeans stopped being regligious nuts only after a few centuries of wars. Only to become rabid nationalists, fighting even bigger wars. And probably only the lose-lose-situation of nuclear weapons avoided the next war. Anyway, today religious leaders in Western Europe are either humble and wise or they are ridiculed.

      Yeah, I derision is really the key. It does not really matter what scientists or teachers or politicians do or say. The crucial point is whether you can lough about them when they act stupid.

      Unfortunately you took the alternative road. Instead of secularizing holy dogmas you invented political correctness to make the mundane a taboo.

      --
      Post tenebras lux. Post fenestras tux.
  96. Too bad by Anonymous Coward · · Score: 0

    Too bad about 90% of the /. community are aggressive evolutionists. I'm proud to be one of the few who believes there is a God. No, I don't claim that there is no evidence to support evolution, but there is evidence of a God, too, and no one seems to even acknowledge that (probably because it's true).

    I like how every time evolution or creationism is mentioned at Slashdot, it's considered "alarming" how many people believe in a deity, and how that is instantly equated with ignorance. Religion was the primary source of education when America started and was in fact one of the main reasons the country was started. I think most people who disagree with evolution would have less of a problem with evolutionists if evolutionists didn't consider them to be ignorant simply because of their beliefs. It's hypocritical to consider your belief backed by evidence and then ignore the evidence supplied by people who oppose your beliefs, not to mention calling their evidence-backed beliefs complete stupidity. And here I thought Slashdot, regardless of its members' beliefs, was full of intelligent and _fair_ people. But people, it seems, are unceasingly amazing and never see the flaws in their own reasoning. (And yes, some clever individual is going to use that very statement against me, saying that my own reasoning is flawed. Well, perhaps, but if you'd be so kind as to point out where I'm wrong, then I will accept that or discuss why I believe I am right. Would you?)

  97. The Difficulty of Having a Real Argument by olyar · · Score: 1

    If you read through the comments on this article you can see why its hard to have any kind of real argument on this topic.

    The people responding to this poll - in large part - aren't responding to the actual question. They're responding to the feeling that they are given by the word "Evolution" which has been thrown at them over and over as something that disproves the religious faith that is one of the most important things in their life. You go to College and you hear, basically, "You shouldn't believe in God because Evolution has made that foolish".

    If you dig in, and study the original Theory of Evolution, you start to see that it is possible to believe in the process - that evolution has and does occur in nature - without embracing it as an explanation for how all life came to be. There is that huge hurtle of figuring out how life began in the first place.

    My point is not to argue that one way or another, but rather to point out that people are responding to the feelings that they have about Evolution more than to the question itself.

    Its worth noting that the vast majority of the /. comments on this are the same thing in the other direction. Folks don't like Christianity - in particular the "Ignorant Fundamentalists", and so its much more fun to make fun of them, than to try to figure out what's really going on, or to even *gasp* try to understand their point of view.

    --
    Custom, hands-free Linux installs. Instalinux
    1. Re:The Difficulty of Having a Real Argument by onlyfacts · · Score: 1

      I really agree with your observation about having a calm, intelligent discussion about evolution. I personally don't have enough faith to believe in in the so-called theory of macro-evolution. But rarely does one get to debat why before it is side tracked into subjective opinions about why you do or don't believe in evolution. There is a big difference between micro-evolution and macro-evolution - no debate there. But you will not find a single piece of evidence for macro-evolution - a species evolving into another species. I have asked multiple times and the answer I get is "it is just too complex to simply prove in a a few "facts" - you just have to imagine". As I have stated on other sub-threads - the crux of macro-evolution is a coherent fossil record - it doesn't exist and it doesn't exist even close. Logic screams that if evolution is true, then after billions of years and trillions upon trillions of reproducing animals - we could easily track down a reaonsable fossil record. Even better, if macro-evolution is so dominate, it should easily be reproduced in the lab where information is naturally added to DNA to produce a completely different species - has never happened - not even close. Even the evolutionsts have given up on this and created Punctuated equilibrium to fill in the gaps in the theory. I haven't even touched on a lot of the other very esoteric, almost crazy sub-theories being attached to evolution that I really can't imagine anyone believing if they just followed the logic.

  98. I love this title by The+Great+Pretender · · Score: 1

    It suggests that 48% of American refuse to evolve, the question is from what?

    --
    A positive attitude may not solve all your problems, but it will annoy enough people to make it worth the effort.
  99. So simple... by fahrbot-bot · · Score: 1
    ...a caveman can use it.

    Now, I'm confused. If the survey is correct, for whom was GEICO's site Intelligently Designed?

    --
    It must have been something you assimilated. . . .
  100. Intelligent Design by troysor · · Score: 1

    Maybe it would be constructive if we stopped assuming that the 48% of people who reject evolution were all dribbling idiots. After all, the ability to see both sides of an issue is probably a good indicator of an evolved species.

    Before I get too far, I feel it necessary to head off the inevitable insults that will come my way for presenting a differing opinion. Yes, I am an intelligent person. I have been a network administrator for 10 years, I am an RHCE, I scored high on my SATs. And I am also a Christian who believes in "Intelligent Design", the simple concept that God masterminded creation. I believe that he planned and designed the human species. I do not believe that we evolved from other species. I understand that there are intelligent people who do believe in evolution, and it is possible that I may be wrong, so I try and look at both sides of the issue.

    It might help to acknowledge that what you accept as "fact" influences what theories you are prepared to believe. I think it is a fact that the Earth is round, therefore I am inclined to reject the theories of the Flat Earth Society, no matter how much evidence they present. Many people are atheists. Since they don't believe in God, they are well prepared to look for and accept scientific explanations for our existence. If, on the other hand, your faith tells you that God exists, and you accept that as "fact", then you are less likely to believe that God had no hand in designing humans.

    It simplifies things a bit to recognize that there are 2 types of evidence: logical (or circumstantial), and empirical. Sometimes logical evidence can make perfect sense, but might still be wrong. This is why criminal court cases are stronger if they have empirical evidence, such as a smoking gun and a witness. Unfortunately, none of us can claim to have witnessed the Earth 1 million years ago, so we have no empirical evidence of the state of the planet and its species at that time. And don't tell me that some species adapting to a different environment over the last hundred years (micro-evolution) is empirical proof of macro evolution. No one in the last hundred years has witnessed the spontaneous birth of a new species. I think that natural selection makes perfect sense within a species, but it is a stretch to extrapolate that to fish crawling out on dry land and developing legs. What most posters on here don't seem to realize is that they sound just as dogmatic and close-minded as the Creationist believers they casually dismiss. How about instead of dismissing those with a different point of view as dribbling idiots, we actually discuss the issue with an open mind.
    1. Re:Intelligent Design by maxume · · Score: 1

      Ever raise a frog? It starts as an egg, turns into a tadpole(a thing that looks a lot like a fish), grows legs and crawls out of the water onto the ground. I'm not offering that in support of macro evolution, but as an example of the diversity of life that happens to be a somewhat humorous juxtaposition to your post.

      Anywho, you are drastically overestimating your ability to cope with the idea of 3 billion years. Humans go through about 5 generations in 100 years; other mammals may go through more than 100; simpler animals might go through 500; bacteria might go through 100,000(that's 3 a day. Is that too fast?); individual molecules might smack into millions of other individual molecules. Skipping over genesis, just because, in the hundred or thousand millions of years that it took for the first multicellular organism to accident its way into existence out of what was probably a soup of single celled organisms, there were probably something like 1 thousand million million generations of that organism. That number doesn't really mean anything, there simply isn't a way to relate it to any experience a human might manage to have, but it is a nice label that puts it in a rather interesting place among the many things that are pretty much beyond our experience(this is where the coping breaks down, in the relating of a number to experience).

      --
      Nerd rage is the funniest rage.
    2. Re:Intelligent Design by SEMW · · Score: 1

      Unfortunately, none of us can claim to have witnessed the Earth 1 million years ago, so we have no empirical evidence of the state of the planet and its species at that time. And don't tell me that some species adapting to a different environment over the last hundred years (micro-evolution) is empirical proof of macro evolution. No one in the last hundred years has witnessed the spontaneous birth of a new species. I could argue that they have. Natural selection is a continuous process, and the dividing line between different species if fairly arbitary (http://en.wikipedia.org/wiki/Species_Problem). If an organism is, through natural selection, gradually changing, when do you decide it's a new species? If many small changes in an organism accumulate over millions of years, enough for it to be generally agreed to be a different species to what it was when it began, when do you pinpoint where it "became" a new species?

      I would also question the way you're seperating microevolution and macroevolution, as if they were somehow different processes. Fairly obviously, lots of small changes (what you're calling microevolution), over a very, very long timescale, add up to big changes (what you're calling macroevolution). (The only thing I can think of that would allow a distiniction is if you're arguing that God intervenes and prevents any further evolutionary changes at the point where an organism could start to be classified as a new species?).
      --
      What's purple and commutes? An Abelian grape.
    3. Re:Intelligent Design by troysor · · Score: 1

      You are right, your frog example is interesting but is an example of metamorphosis, not macroevolution. Life is indeed very diverse.

      You are also right that I have limited ability to cope with the idea of 3 billion years. I think this is generally true of mankind, and I think that our science gets fuzzier and fuzzier the farther back we go. Assumptions and best guesses pile up, and we reach unjustified conclusions. We just don't have enough hard, empirical evidence to support one species evolving into another species.

      Even assuming that you are correct about 3 billion years, the part where you lost me was "the first multicellular organism to accident its way into existence". Sounds about as scientific as spontaneous combustion.

    4. Re:Intelligent Design by troysor · · Score: 1

      I think that at some point there has to be a big jump. Small changes do not get you from an organism that swims to an organism that breathes air. Or from a creature that walks, runs and jumps to one that flies. Either there was at some point a "macroevolutionary" jump, or the species were designed to do very different things.

    5. Re:Intelligent Design by maxume · · Score: 1

      My point was that while there seems to be a transition between single celled and multi celled organisms, we don't know how it happened.

      --
      Nerd rage is the funniest rage.
    6. Re:Intelligent Design by troysor · · Score: 1

      And that is the weakest part of evolutionary theory, the part where a small changes don't explain everything. There has to be a big jump, a macroevolution, to go from single celled to multi celled organisms. I don't believe that we have ever witnessed a macro-evolutionary jump, and we have no smoking gun. All we have is logic and our limited understanding. I would hold that it is just as probable that there never has been a macro-evolutionary jump, that God designed single-celled organisms and that he also designed multi-celled organisms.

    7. Re:Intelligent Design by SEMW · · Score: 1

      Small changes do not get you from an organism that swims to an organism that breathes air. Or from a creature that walks, runs and jumps to one that flies. Why not?

      Lets take the jump from walking, swimming etc. to flying.

      There are many examples of creature that aren't birds, but nevertheless have some wing-like attibutes, and could be a 'jumping-point' from which flight could evolve through only small changes. For example:
      • The skin between legs on flying squirrels
      • The flattened body of the flying snake
      • The large webbed feet on gliding tree frogs
      • The fins on flying fish
      • The expanded lateral membranes supported by elongated flexible ribs on gliding lizards
      • In some flightless birds (e.g., penguins), wings are used for swimming.
      Thanks Google for that list.

      In all of these, partial flying functions exist in creatures that aren't birds. The first 5 examples are of normally non-flightless animals that have developed some semi-flying features. The last one is a bird, but with 'wings' that are look, and function, like fins (and I would say, evolved from fins). If these were developed more, and more, through many millions of years of small changes, is it really inconceivable that a bird could evolve? (N.B. I've no idea which on this list birds evolved from -- probably none of them, the direct descendant of modern birds is probably extinct).
      --
      What's purple and commutes? An Abelian grape.
    8. Re:Intelligent Design by maxume · · Score: 1

      Remember the 1 thousand million million generations of single celled bacteria? Often, those generations are going to be composed of upwards of 1 million million million million individual cells; if an intervening creator is more likely for you than some of them eventually sticking together for one reason or another, that can be your thing.

      --
      Nerd rage is the funniest rage.
    9. Re:Intelligent Design by Dr.+Zowie · · Score: 1

      The existence of kefir is a good proof-of-concept for accidental transition between single-celled and multicellular organisms. Kefir curds are right on the border of being multicellular -- they are communities of many organisms, who collectively exhibit homeostasis and can reproduce by collective fission. Scrambling a curd in a blender doesn't kill (all) of the component organisms, but it does break the homeostasis.

      Slime molds are another type of single/multi straddling organism. Slime molds are collections of single cells that can survive on their own and reproduce by fission. Under the right circumstances they work together to form a fruiting body that reproduces sexually, then they break apart into a population of individuals.

    10. Re:Intelligent Design by troysor · · Score: 1

      It is indeed conceivable that a bird could evolve. It is logical and makes sense. It fits the theory of evolution nicely that flying fish exist and seem to be "stepping stones" from fish to birds. Your point of view is valid and well supported.

      Some intelligent people look at flying fish and see the handiwork and design of God.

      I guess the point of my original post was not to get into a detailed debate, but to comment on the assumption (prevalent in most Slashdot posts to this kind of article) that everyone who rejects evolution is an idiot. The "religious right" and the "scientific left" both could use a bit more empathy and understanding of the other sides point of view.

    11. Re:Intelligent Design by Dr.+Zowie · · Score: 1

      I think that at some point there has to be a big jump. Small changes do not get you from an organism that swims to an organism that breathes air.



      Well, think what you might, but your second sentence is wrong. Ever study lungfish? They form a nice hybrid between fishes and land creatures. Similarly, a nice spectrum of small changes links book gills (found in horseshoe crabs) to book lungs (found in land-based arachnids).


      Contrary to your intuition, most "macro-adaptations" can readily be explained in terms of a sequence of "micro-adaptations" each of which marginally improves the survivability of the organism. In fact, this is the case even when another engineering solution would have been better or more economical: vestigial parts, historical accidents, and the evidence of earlier "choices" executed with no forethought for future consequences abound throughout (for example) the human body, from our vestigial toes to our crappily designed carpal tunnels.

    12. Re:Intelligent Design by loxosceles · · Score: 1

      Some intelligent people look at flying fish and see the handiwork and design of God.

      The first half of this video, Neil Tyson's presentation from Beyond Faith, is directly relevant.

      You "see design" at the limits of your knowledge. Appeal to "design" ends rational inquiry. Historical appeals to "design" have been premature.

  101. Re:Infrequently used refutation of 10,000 year the by wperry1 · · Score: 1

    [sarcasm] Don't you know that carbon dating is wholly inaccurate? As is the dating of layers of sediment etc...[/sarcasm]

  102. And then a miracle occurs... by (H)elix1 · · Score: 1

    Amazing how much folks get lathered up over where things came from. Do species change over time - you betcha! Just watch one dog show and you will see the amazing results of selective breeding over a short time period. Natural selection and evolution of living things is not in question. Nature abhors a vacuum.

    My beef is people taking evolution and pushing the theory that 'life' started from a random mix, and then natural selection/evolution got us where we are today. Working in the lab with 'simple' single cell organisms which seem to die by just looking at them funny leaves me a bit cynical. It is not like .05% mutations tend to be positive. Life - even if using self replicating as the measuring stick - is amazingly complex. I don't care if someone believes in the beginning 'bang it happened' or 'God created the heavens and the earth' - whichever you chose requires an enormous amount of faith in a theory that does not match nicely to what is observable. Picking a theory on where life sprang from seems largely irrelevant and a waste of time.

    1. Re:And then a miracle occurs... by geek · · Score: 1

      I tend to believe the idea of single cell organisms evolving into us personally. It really just jives with my understanding of human evolution and how we, to this day, have vestigial organs which no longer function. Just looking at our skeleton you can see how it's changed over the last 500,000 years. Remember mutation isn't the only thing causing dramatic changes. Just because a mutation occurs doesn't mean it'll become dominant. We may have had a mutation 250,000 years ago that allowed us to breathe fire but if environment didn't encourge it as a beneficial trait, it would be selected out. Mutation happens all the time and there are significant environmental causes for them to be beneficial, for instance an ice age or warming period. Some mutations rely heavily on others, for example mankind may never have created civilization if wheat hadn't mutated on it's own to produce more seeds, allowing humans to plant it and grow crops and build encampments and tribes around their crops rather than having to go out and forage for food.

      4 billion years is a very long time. Mankind as we know it has been around for barely a minute on the clock. I think there has been plenty of time, through trial and error, mutation, environmental changes and other factors, for single cell organisms to evolve into what we see today. That however is opinion and likely will never be provable save for the invention of time travel.

    2. Re:And then a miracle occurs... by (H)elix1 · · Score: 1

      Agreed! No arguments about life evolving. I also could buy the idea of a single celled organism becoming what we see today - but where things don't work for me is getting that very first viable organism and then survive long enough to replicate. All odds are stacked against it. Getting anything to work is such a delicate balance. There is no debate what so ever (in my mind) that living organism evolve. They do. When folks start talking Evolution vs Creationism, it a question about that first spark of life. Most of the interesting science about evolution and ecology get lost the moment someone jumps into that 'where did everything come from' rather than how living organisms adapt. I don't know.... heck, all I'm saying is I'm a bit shocked when folks are so forceful about what I consider a questionable theory. Plenty of others were quick to point out that Galileo was teh stupid for his crazy theory about the earth not being the center. Non religious or religious issues are not part of this. Folks are way to quick to take things for fact when it stands as an educated guess, at best, for where things came from.

  103. Time again for Cosmos? by akaky · · Score: 2, Insightful

    I'm not surprised by the percentages, frankly. I'd be interested in seeing the trends. I'd (like to) be surprised to see if it was really all that different in the past. That said, I do think it reflects on our state of education in good ol' USofA. Possibly a good excuse to rail about the state of science education in particular, but I'll take it, 'cause I think it does indeed suck.

    I love the story of Genesis; there's good stuff in it. Almost as good as the Silmarillion.

    As chance would have it, I'm reading through my old copy of Carl Sagan's Cosmos. Now, I know it would be viewed as dated (both factually and cinematographically), but it was a tremendous influence on me. It addresses topics in a very approachable and friendly manner, and is (as I remember it) very far from preachy. It lit me on fire about science, and though I don't make my money in science, I think this program had an impact on my science-based view of the world.

    But this is more than 20 years ago now. Short of a Sputnik analog, what voices do we have to popularize science?

    --
    .sig, .sig a sog; .sig out loud, .sig out strog
  104. How was the selection of querents done? by HiThere · · Score: 2, Insightful

    I've read the original article (perhaps) which indicates that this article is misrepresenting the data, but even there I couldn't find out how they selected who they would ask questions of.

    --

    I think we've pushed this "anyone can grow up to be president" thing too far.
  105. Re:Alarming? Consider this... by SatanicPuppy · · Score: 1

    To an ignorant person, it would be just as impossible for them to believe that we created plastic, spaceflight, and nuclear power. Surely it must be the work of God or Demons!

    And don't demean philosophy by attributing religious doctrine to it. That argument is purely theistic, and relies on a hilariously poor understanding of the difference between the workings of a mechanical thing like a watch (or a 747 if you want the updated version), and the workings of the sort of life you find on this planet, which is not in any way inconsistent with our understanding of organic chemistry.

    Sure, no one was around to watch it happen, but looking at the fossil record we can watch hugely simple creatures in the deepest strata being replaced by more and more complex creatures that become more and more familiar to us as they evolve. We can see the mechanisims at work all the way up to the current day, with every succeeding generation of bacteria becoming more resistant to our efforts to kill them off...That's evolution at work.

    I find it absolutely hilarious that a person can live in the modern world and see, every day, around them everywhere, evidence that science is capable of some truly amazing stuff, and that the scientific method is the most powerful tool we've ever built for ourselves in the entire history of our race...And still be willing to discard all the mountains of evidence for a book written by some primitive Hebrews thousands of years ago...No questions asked.

    --
    ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
  106. Goodbye Superpower... by kentrel · · Score: 3, Interesting
    ...and goodbye to democracy. How can a country remain remotely democratic when AT LEAST 48% of people are completely ignorant of basic natural realities.


    This kind of ignorance makes it possible for once again, the same few to control the many.

    1. Re:Goodbye Superpower... by Anonymous Coward · · Score: 0

      Goodbye Superpower... and goodbye to democracy. How can a country remain remotely democratic when AT LEAST 48% of people are completely ignorant of basic natural realities.

      This kind of ignorance makes it possible for once again, the same few to control the many.


      That is exactly what allows capitalist democracy to flourish. An educated public is a dangerous and uncontrollable public, which might realise that voting is pointless.

      I'm quite sure this 48% that reject revolution also have an irrational fear of communism. Years of propaganda to discredit an ideology that brought us "religion is the opiate of the masses", is going to be very well ingrained in a population that loves the 'nanny state' so.

      In the developed world, within human populations, evolution does not really exist any longer, natural selection has been replaced by pure sexual selection, fecundity and lack of intellect. This is fostered by the capitalist establishment, as it is beneficial to such a pyramid scheme to have a large, stupid and pacified population.

      It really does not bear thinking about, it is too depressing and cannot be changed. It brought me near to suicide more than once, I promised myself I would no longer think too deeply, it is dangerous to my mental health. The result, I too have become a member of the mindless herd, they have won... sigh.
    2. Re:Goodbye Superpower... by glwtta · · Score: 1

      What makes you think that this is bad for superpower status?

      I don't think democracy has every been shown to be anything but a deterrent to flourishing imperialism.

      --
      sic transit gloria mundi
    3. Re:Goodbye Superpower... by Anonymous Coward · · Score: 0

      I'm quite sure this 48% that reject revolution also have an irrational fear of communism.


      Oops, I meant to say: I'm quite sure this 48% that reject evolution also have an irrational fear of communism.

      A most interesting slip. Perhaps I have not given up hope...
    4. Re:Goodbye Superpower... by onlyfacts · · Score: 2, Insightful

      I am more worried about the 52% who really don't have a clue why they believe in evolution other than "some smart people say I should". I would wager that more of the 48% know why (with good reason) they don't believe than the 51% do know why (with good reason) they believe in evolution.

    5. Re:Goodbye Superpower... by evilviper · · Score: 1

      How can a country remain remotely democratic when AT LEAST 48% of people are completely ignorant of basic natural realities.

      90% of the population have no reason to understand evolution. Knowledge of it will not affect their everyday lives.

      I'm sure somewhere there is an accountant complaining that 48% of people don't understand some important facet of tax law.

      This kind of ignorance makes it possible for once again, the same few to control the many.

      I fail to see how understand evolution would help or hurt such a goal in the slightest.
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
    6. Re:Goodbye Superpower... by Alsee · · Score: 1

      90% of the population have no reason to understand relativity.

      Hell, 90% of the population have no reason to understand electricity.

      The problem here is a MASSIVE failure of our education system and our media. You're right that 90% of the population have no reason to understand evolution, but they should know the basic point that evolution considered absolutely established by effectively 100% of all professional earth and life scientists, and that it is used as the very foundation of their fields. As far as a highschool science education overview goes, 99.85% does appropriately round off as "effectively 100%". There is no genuine controversy at all over evolution within science. The general public doesn't have much more need to understand the details of evolution that they need to understand nuclear science, but they should have the basic notion that evolution is on par with chemistry and aerodynamics and relativity and absolutely any other mainstream field of science.

      A small group of activist loons has managed to bamboozle half of the country into thinking that evolution is not well supported, into thinking that it is not accepted by most biologists, and these loons have manage to manipulate a significant portion of the population to VOTE for dangerous and damaging politicians based on that nonsense. These loons have convinced these people that any good intelligent politician who accepts or defends evolution is evil and dangerous.

      So while the evolution issue is not "the end of the world", it is indeed a troubling problem and it does indeed bode ill for democracy.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    7. Re:Goodbye Superpower... by Harin_Teb · · Score: 1

      out curiosity, how does the knowlege level of the populace affect whether or not they have the right to vote on the issues? Say what you want, but the USA is still a representative democracy (it never was a true democracy) and even if 99% of the country had a reading level of a 5th grader it still would be... just not an efficient one...

      also if 48% of the people is a "few" than what is the many?

    8. Re:Goodbye Superpower... by leereyno · · Score: 1

      Well Europeans are intentionally made ignorant of basic economic, social and political realities. The few that do wake up and smell the coffee are branded as fascists and racists, and that is when their attackers are being kind.

      Assuming for a moment that the conclusion proclaimed by the initial poster is correct, that 48% of Americans do not believe in "evolution," I can gurantee you that these very same Americans have a much greater grasp of the realities that actually affect them than do your average europeans.

      I'll take a dyed in the wool creationist who believes in hard work, individual rights, and equality of liberty over your average european who has been sold on welfare states, group rights, multiculturalism, and other ideas and policies that are fundamentally destructive to humanity.

      Truth is always important, but some truths are more important than others. Communism is far more destructive than creationism. Both are false, but only one is responsible for the deaths of 50 million people and the misery and suffering of countless more.

      --
      Muslim community leaders warn of backlash from tomorrow morning's terrorist attack.
    9. Re:Goodbye Superpower... by Cybrex · · Score: 1

      Your statement speaks more to the woeful state of science education in the US than to the correctness of either particular stance.

      I was originally going to challenge your statement and ask you to provide some facts to back it up, but the more I think about it the more I agree with you. Evolution is science, and science isn't always simple and intuitive. It's harder to convey in a single sentence (although "Evolution is the non-random survival of randomly varying replicators." works nicely), and requires a bit of thought on the part of the listener/reader to fully grasp.

      Creationism is the easy way out. "God made everything pretty much as it is, and God has always existed." Very simple to convey. Very easy to grasp. Very much completely at odds with all of the evidence if one is willing to study, investigate, and think, as opposed to just accepting whatever Kent Hovind and his ilk spew because it sounds good.

      --
      Boundless Expansion, Self-Transformation, Dynamic Optimism, Intelligent Technology, Spontaneous Order- BEST DO IT SO!
  107. Perhaps a better polling question ... by surfcow · · Score: 1

    These people who claim they reject science don't seem to reject the fruits of science.

    Perhaps a better polling question would be:

    "Would you take anti-biotics to treat a deadly bacterial infection, would you rather just die?"

    These folks who *say* they take creationism over science are just mouthing empty words. Their actions speak more clearly. How many Christian Scientists *actually* die of apendicitis? How many christians actually tithe their 10%?

    Lots of people today claim to be religious. But by the standards of their Puritan ancestors 2 or 3 centuries back, they are plainly athiests, pagans and idolators.

    Historically, religious fanaticism has been the norm, not the exception. With that perspective, we are living in very liberal, enlightened and rational times. Each generation is more secular than the last, and everyone knows it. We're just watching them pull their wagons into a shrinking circle.

  108. Article claims tolerance for atheists on the rise? by Seumas · · Score: 1
    From the article in question.

    only six percent said they don't believe in a God at all. Just 3 percent of the public self-identifies as atheist, suggesting that the term may carry some stigma. Still, the poll suggests that the public's tolerance of this small minority has increased in recent years.

    This is bullshit. There is no tolerance of atheists.

    From another article that made the rounds only last year:

    From the article.

    only six percent said they don't believe in a God at all. Just 3 percent of the public self-identifies as atheist, suggesting that the term may carry some stigma. Still, the poll suggests that the public's tolerance of this small minority has increased in recent years.

    This is bullshit. There is no tolerance of atheists.

    From an article that made the rounds only last year:

    Based on a telephone survey of more than 2,000 households and in-depth interviews with more than 140 people, researchers found that Americans rate atheists below Muslims, recent immigrants, homosexuals and other groups as "sharing their vision of American society." Americans are also least willing to let their children marry atheists. Is that tolerance? The average american doesn't even want you to marry their children if you are an atheist or agnostic. And as much as it always seems like there is nothing religious people hate more than gay people, they actually hate atheists even more!

    Oh, yes. Such tolerance! And yet these are the same assholes that are always going around telling us how Christianity is a minority in this country today and how religious people are persecuted.

    I am not an atheist. I am an agnostic. But you can bet your damn ass that I am hesitant to admit that to anyone who asks me in person unless I have a really good idea of how that person will react. Otherwise - at the best - I might find myself being locked into a two hour discussion trying to explain to the ignorant bastards why I can be agnostic and still not go on a murderous rampage - because in the mind of religious people, the only thing keeping them from slaughtering people wholesale is that their god might not like it.

    So.. tolerance toward atheists and agnostics? Bullshit.

    Based on a telephone survey of more than 2,000 households and in-depth interviews with more than 140 people, researchers found that Americans rate atheists below Muslims, recent immigrants, homosexuals and other groups as "sharing their vision of American society." Americans are also least willing to let their children marry atheists.

    Is that tolerance? The average American doesn't even want you to marry their children if you are an atheist or agnostic. And as much as it always seems like there is nothing religious people hate more than gay people, they actually hate atheists even more!

    Oh, yes. Such tolerance! And yet these are the same assholes that are always going around telling us how Christianity is a minority in this country today and how religious people are persecuted.

    I am not an atheist. I am an agnostic. But you can bet your damn ass that I am hesitant to admit that to anyone who asks me in person unless I have a really good idea of how that person will react. Otherwise - at the best - I might find myself being locked into a two hour discussion trying to explain to the ignorant bastards why I can be agnostic and still not go on a murderous rampage - because in the mind of religious people, the only thing keeping them from slaughtering people wholesale is that their god might not like it. Yet atheists and agnostics are the ones who have no morality, are responsible for all the brutality the religious people and their delinquent children commit and are selfish. What the fuck?!

    So.. tolerance toward atheists and agnostics? Bullshit.

    Also from the a

  109. US schizo by SpaghettiPattern · · Score: 1

    I believe I speak for a considerable amount of non-US readers which are in complete awe of the US. The land that brought us so many outstanding scientific achievements. The land that seems to be divided in brilliancy and utter ignorance. The land that wants to introduce creationism as a science in schools. The land where division of religion and state seems to vanish.

    --

    I hadn't the slightest objection to his spending his time planning massacres for the bourgeoisie... (P.G. Wodehouse)
    1. Re:US schizo by maxume · · Score: 1

      The US is not a land that wants to introduce creationism as a science in schools. We are a large and diverse country that is host to many different cultures, and in some places, some groups have worked towards this goal to temporary success; the end result has so far been that evolution was embraced and creationism rejected.

      --
      Nerd rage is the funniest rage.
  110. and sooo by dotspeaks · · Score: 1, Funny

    Evolution rejects Americanssss????

  111. Change the terminology: acceptance, not belief by BetaJim · · Score: 4, Insightful

    Because of my car's bumper stickers I'm frequently asked: "Do you believe in evolution?" Instead
    of just saying that I do, I try to raise their consciousness a bit by answering "No, I accept
    that evolution is the theory that best explains the evidence." This usually gives them a pause.
    Belief is often closely associated with faith, and faith is something that isn't necessary to
    accept evolution. Only evidence is needed and there is lots of that available.

    I'm a teacher and my bumper sticker if very appropriate and funny in several different ways, it
    reads: "Leave no child behind - Teach Evolution." I wish I had another one as this one is very
    faded.

    --

    "Drug related crime" is a misnomer, "prohibition related crime" is the more accurate and correct phrase.

    1. Re:Change the terminology: acceptance, not belief by Dirtside · · Score: 1

      I'm frequently asked: "Do you believe in evolution?"

      Heh, I just realized that that question makes about as much sense as "Do you believe that the Earth revolves around the Sun?" Neither one has anything to do with belief, of course.
      --
      "Destroy science and religion. Science would re-emerge exactly the same; but not religion." - Penn Jillette, paraphrased
    2. Re:Change the terminology: acceptance, not belief by Ksisanth · · Score: 1

      You can get them at bioliteracy.net.

    3. Re:Change the terminology: acceptance, not belief by BetaJim · · Score: 1

      Yeah, that's where I got my first bunch of stickers from. The problem is the stickers
      fade so fast. Just a few weeks and the red color of the text is very faded! Maybe I
      just need to donate more money to the bioliteracy project and hope that different, more
      light fast inks are used now...

      --

      "Drug related crime" is a misnomer, "prohibition related crime" is the more accurate and correct phrase.

    4. Re:Change the terminology: acceptance, not belief by Anonymous Coward · · Score: 0

      Have you thought about making one yourself through CafePress? There may be other places out there that let you make a very small run (like 1 :) ) of bumper stickers easily. I've also seen kits sold at office stores (Office Depot, Office Max, etc.) where you use a color printer.

      I can't attest to the quality of any of these, but I would bet that CafePress has a better technology than your usual home printer. I believe they also have some quality guarantees that would be helpful if you had problems with their bumper stickers.

      Anyway, post a reply if you want help with the graphics, which I'd be happy to provide. (I've made several non-profit CafePress items for a research community; the graphics are generally well-received, though I have no formal art training.)

    5. Re:Change the terminology: acceptance, not belief by Ksisanth · · Score: 1

      The problem is the stickers fade so fast. Just a few weeks and the red color of the text is very faded!

      That's a bummer. If I had a faded bumpersticker/sign that I wanted to keep but couldn't be assured that a replacement wouldn't also fade, I'd retouch it myself with acrylics. I have a personal quirk about wanting to paint *everything*, though.

  112. Odd coincidence by edwardpickman · · Score: 1
    Strangely enough IQs have dropped the same percentage.

    And yes I'm an American.

  113. Re:Article claims tolerance for atheists on the ri by Anonymous Coward · · Score: 0

    Sorry for the redundant lines in the post above. I was using a firefox plugin that somehow inserted info I had already deleted before re-pasting the entire comment into a new window. Hopefully it is still understandable, though.

  114. Sad by King+of+Attolia · · Score: 1

    The Ancestor's Tale and The God Delusion should be required reading in American schools.

  115. Design Science by jim_mcneely · · Score: 1

    I read a book called Darwin's Black Box, which I found extremely compelling. He posts some very devastating evidence against gradualistic evolution, which I have never heard really answered. Most of the answers are basically, "Yeah, but most scientists disagree with that." I don't care what most scientists disagree with. I care about what is true. I have read several Dawkins books, I have The Origin of Species, and I find Darwin's Black Box more compelling.

    Now, I don't mind people disagreeing with me. I have friends who disagree strongly with me. We are friends and they don't call me ignorant, stupid, uneducated, or fundamentalist. What I DO have an issue with is being called ignorant, stupid, or whatever because I challenge the status quo. There was a point in time when it was firmly established by all educated people that the earth was the center of the universe. Not that it was flat, but the center. There was a lot of astronomical evidence that really predicted the motions of the stars that supported this. It was several hundred years before Copernicus' evidence held sway.

    I would strongly recommend a book by Thomas Kuhn called The Copernican Revolution, or another called The Structure of Scientific Revolution. It simply does not do to dismiss ideas you do not want to believe out of fear for being called ignorant or a fundamentalist. We are interested in discovering the actual truth, right? We don't want to go on supporting a myth because of the fear of the opinions of others, right?

    For the record, I am educated, not a fundamentalist, I agree that the earth is probably several billion years old, etc. I simply do not believe that the evidence for evolution is well supported at all. I don't know what actually happened; do we need a myth to explain it? Perhaps the fact that it is a mystery is the most profound truth of all.

    1. Re:Design Science by SEMW · · Score: 1

      I have read several Dawkins books, I have The Origin of Species, and I find Darwin's Black Box more compelling. Evolutionary biology has come a long way since Darwin. He provided the foundations, but he was certainly wrong on some counts, and we've progressed far further, amassed much more evidence, and considerably expanded the scope of evolution as a science since he first advanced his theory. A modern biology textbook (or wikipedia for that matter) would serve you far better than The Origin of Species or Dawkins pop.sci books.

      Regarding Darwin's Black Box -- I have not read it, so please correct me if this is wrong, but a quick Google gives the impression that it doesn't so much give a reasoned criticism of modern evolutionary biology as it does evangelise biblical creationism under another name, mostly by trying to use irreducible complexity (!) as an argument against evolution (the other thing Google turned up is that the author for a time claimed that the book was peer reviewed in a refereed journal, which it wasn't).
      --
      What's purple and commutes? An Abelian grape.
    2. Re:Design Science by Pooua · · Score: 1

      What would a "reasoned criticism of modern evolutionary biology" look like? I would suppose it would have to include a discussion of all the major fossil finds around the world over the last several decades, at least. It would also have to discuss chromosomal research (which, incidentally, is sometimes at odds with fossil research). It would have to discuss the science actually conducted, a science which is funded by several billions of dollars in grants every year, just in the U.S. IOW, I would suppose this would amount to a very large book. No one has written such a book, though it would be a good idea for someone to do so. Preferably, not an evolution evangelist shilling out the science.

      I read "Darwin's Black Box" a few years ago. The author's biographical info states that he is an evolutionist. "Intelligent Design" does not presuppose God, only an intelligent designer. The book states that this designer could be any sort of intelligent being. Then, the book makes its case for claiming that current evolutionary theory is unable to explain certain features seen in Earth's creatures.

      --
      Taking stuff apart since 1969 (TM)
    3. Re:Design Science by jim_mcneely · · Score: 1

      I have not read it, so please correct me if this is wrong, but a quick Google gives the impression that it doesn't so much give a reasoned criticism of modern evolutionary biology as it does evangelise biblical creationism under another name

      Well it isn't like that at all, and in fact he does look at a lot of the chromosomal comparison research and all of that. He does NOT say anything about evangelical religion and refutes young earth creationism, as do I.

      So, as usual, we get an ad hominem fallacy and a non-answer to the problem of irreducible complexity, which is THE killer argument against evolution. I have never heard this properly answered. In this book and others there are several extremely detailed examples of molecular biological processes which could never have arisen by a gradual process. Why has no one come forward with a direct reasonable answer to this?

      This is exactly the kind of bullshit response I always hear to this. I'm actually glad this was posted, it is a PERFECT example of how people are totally hiding their heads in the sand on this issue. Why don't you actually give a substantive reasonable answer to the problem of irreducible complexity? I've never heard one, and I'm not sure it exists. If it did, I might listen. BTW this argument has absolutely NOTHING to do with religion. It is a scientific criticism of a prevailing theory.

    4. Re:Design Science by SEMW · · Score: 1

      I'm actually glad this was posted, it is a PERFECT example of how people are totally hiding their heads in the sand on this issue. Why don't you actually give a substantive reasonable answer to the problem of irreducible complexity? Umm, because you didn't ask for one? You wrote in your original post that you "do not believe that the evidence for evolution is well-supported", and from that I am supposed to extrapolate that it is irriducable complexity that you wish to debate? There are many, many different arguments that claim to disprove evolution, I am unsure if you were expecting posters to read your mind as to which one you wished to discuss (or just write out a preemptive refutation of every possible argument you could have had in mind)?

      In this book and others there are several extremely detailed examples of molecular biological processes which could never have arisen by a gradual process. Why has no one come forward with a direct reasonable answer to this? Like what? What are these processes that are supposed to be irriducably complex? State them!

      The only arguments I have heard before regarding irriducable complexity are the eye and the wing (neither of which are "molecular biological processes" so are presumably not what you are talking about), but since you haven't stated what processes you think are irriducably complex, I am left with little to debate; so I'll treat the wing, mainly because someone in another thread asked about it and so I can copy & paste my reply.


      Lets take the jump from walking, swimming etc. to flying [which the parent I was replying to questioned could happen through small evolutionary changes].

      There are many examples of creature that aren't birds, but nevertheless have some wing-like attibutes, and could be a 'jumping-point' from which flight could evolve through only small changes. For example:
      • The skin between legs on flying squirrels
      • The flattened body of the flying snake
      • The large webbed feet on gliding tree frogs
      • The fins on flying fish
      • The expanded lateral membranes supported by elongated flexible ribs on gliding lizards
      • In some flightless birds (e.g., penguins), wings are used for swimming.
      In all of these, partial flying functions exist in creatures that aren't birds. The first 5 examples are of normally non-flightless animals that have developed some semi-flying features. The last one is a bird, but with 'wings' that are look, and function, like fins (and I would say, evolved from fins). If these were developed more, and more, through many millions of years of small changes, is it really inconceivable that a bird could evolve? (N.B. I've no idea which on this list birds evolved from -- probably none of them, the direct descendant of modern birds is probably extinct).
      --
      What's purple and commutes? An Abelian grape.
    5. Re:Design Science by Dr.+Manhattan · · Score: 1

      I read a book called Darwin's Black Box, which I found extremely compelling. He posts some very devastating evidence against gradualistic evolution, which I have never heard really answered.

      Maybe you're not looking hard enough.

      --
      PHEM - party like it's 1997-2003!
  116. Never corner a Christian by erroneus · · Score: 1, Insightful

    It's pretty well-known that most people who call themselves Christian don't practice it in their daily lives and in essence, don't actually or truly believe. They are just club members who don't pay their dues. But when you corner these people, they will assert that they are true believers to the very end. It's best nnot to provoke Christians by asking them direct, polarizing questions. Better to let them go on acting like heathens. They will have children and they too will be non-participating Christians except that they will not likely go to church but once in a while... the next generation after that will be lighter still. Eventually, religion will fade away. It's fighting religion that keeps it alive.

    1. Re:Never corner a Christian by glwtta · · Score: 1

      I used to think that's true, but I don't anymore. They may not practice the rites of the religion all that often, but they do believe in the core tenets. It's kind of ironic that when people did take the form of religion much more seriously (you know, the Middle Ages), they generally had a much more nuanced understanding of their theological principles. Whereas today there's this almost comical clinging to the literal truth of a few bits and pieces of the Bible here and there.

      --
      sic transit gloria mundi
    2. Re:Never corner a Christian by detokaal · · Score: 0, Flamebait

      People like you have been trying to stamp out Christianity and Jews for eons either through institutions or murder. But we're still here. That's because humanity doesn't determine the fate of our belief system - God does. And He and His followers will continue to be here long after you and the generations after you have rejected Him and continue to murder and marginalize His followers.

    3. Re:Never corner a Christian by Dhalka226 · · Score: 1

      With all due respect, Christians certainly have no place whatsoever to criticize others for murdering and marginalizing those who do not share their beliefs.

    4. Re:Never corner a Christian by Overzeetop · · Score: 0, Flamebait

      I'm going to chime in with a bit of support here.

      Most Christians I know do not actually live by the standards their bible sets. They have very little compassion for thier fellow man, and will gladly take advantage of a situation to amplify their personal profit, even when they would be appalled to be treated the same way. They may attend church every Sunday, but Christians they are not. Sadly, I'm going to part ways with you in one respect - they will not go away. Christianity gives these people a sense of superiority, and plays into their need to be exclusive and special. Christianity is a salve for their egos, and they will pass on that to their children. It is just this superiority which causes so much grief in cross-religion interaction.

      I think it will get worse until it hits a breaking point (inquisition and backlach, for example).

      --
      Is it just my observation, or are there way too many stupid people in the world?
    5. Re:Never corner a Christian by Empiric · · Score: 1

      Interesting view, given yours would be the position that -cannot- survive, -by definition-, and -by your own definition-.

      It's called "entropy".

      As for me, I'm personally willing to dominate the opposition in as fully of an evolution-positive manner as God may allow me in the afterlife.

      --
      ~ Whence do you come, slayer of men, or where are you going, conqueror of space?
    6. Re:Never corner a Christian by Anonymous Coward · · Score: 0

      I'm a Christian. I believe in God. I don't act like a heathen. If you've got a direct, polarizing, question, then just ask.

    7. Re:Never corner a Christian by Anonymous Coward · · Score: 0

      a/c post on an off topic comment. No one is *ever* going to read this.

      Most people have a moment of self realization at some point, they can't figure out what they are supposed to be doing. For some people, this happens very late in life, after the kids are gone. For other people, it happens earlier, maybe if you don't have children it's earlier. The point is, at some point in people's lives they get up in the morning, walk outside into the sunlight and can't think of a single reason to keep living. It's not depression, it's self awareness.

      You either have to keep going because you just love being alive, maybe you focus on a loved one. The survey said 48% of people go read the bible, and try to what it says, so they will have purpose ( and eternal life! yippee! ).

      I wouldn't actually say that all religious people are clinging on to there chosen faith for direction. Some percentage of religious people are horribly horribly broken people who need the structure and rule religion provides in order to function in society. Sure it's the opiate of the masses, but some people need opiates. Lots of opiates.

        mmmm opiates...

      a/c

    8. Re:Never corner a Christian by melikamp · · Score: 1

      That's because people, especially those who determine the policy, are not worshiping Christian God as much as they worship money and power. The Christian rhetoric is but a veil. It plays to their advantage that people fight Christianity and science, while largely ignoring gods who really influence the politics.

    9. Re:Never corner a Christian by kindbud · · Score: 1

      It's fighting religion that keeps it alive.

      But if you decline to fight it, some of its adherents will pick one with you anyway. Evolution doesn't say anything about God or salvation or the purpose of life. Nothing whatsoever. Plenty of evolutionary biologists are church-goers and consider themselves faithful, so there isn't anything inherently incompatible between evolutionary science and religious convictions. The evolution debate wasn't started by scientists who study it, it was started by believers who took offense at the implications that they themselves worked out for their faith. No one told them "Evolution means belief in God is obsolete." They decided for themselves that evolution implies that.

      --
      Edith Keeler Must Die
    10. Re:Never corner a Christian by Anonymous Coward · · Score: 0

      With all due respect, Christians certainly have no place whatsoever to criticize others for murdering and marginalizing those who do not share their beliefs.

      True, but not so in the present day. Christians are generally accepting of other faiths and the Christian faith is an individual choice and not one where it's forced upon the people. This contrasts with Islamic countries where you can be killed for converting away from Islam.

    11. Re:Never corner a Christian by blakmac · · Score: 0

      The sad thing is you are correct. The problem with these people is this: that if they claim to be a Christian, and act as heathens, then they are NOT CHRISTIANS AT ALL! The Bible supports this. You can email me for references or with hate mail or what-not. I also welcome polarizing questions, and will answer with biblical evidence, and without slamming anyone. The Bible will support itself, and science DOES support the bible. Most people who claim to be Christians are not, for the exact reason you stated above. Also, in order for someone to be a Christian, they have to actually follow the examples established in the scriptures, which sadly, most who claim to be Christians do not.

      --
      http://wstewart.php0h.com - the sugarbuzz project blog
    12. Re:Never corner a Christian by erroneus · · Score: 1

      I wouldn't call it entropy. I'd call it "reverting to the more natural human state."

      There was a story here some time back about man being genetically predispositioned to believing in a deity. I wasn't able to respond to that story with my own take at the time. But my perspective is that it's not so much genetic predisposition as our immediately conditioned recogition of heirarchy and parent figures. From birth, our parents are our gods. And given the existance of other cultures presently and currently active in "ancestor worship" as a long standing alternative to god/gods as we, in the west, understand them, I'd say that my view fits human behavior in both examples.

      And without saying so, I'd say we all understand the true nature of the human state. The constant deviation from religious morals and ethics exhibited by practitioners does more than I ever could to illustrate much of the truth of human nature.

      But to put it into terms that christians can better understand: "Accept that we are all sinners and repent, repent, repent! Uh, and don't forget to donate ridiculous amounts of money that we all try to deny is most often used to add to the extravegant lifestyles of the CEOs of GOD inc. to ease your conscience."

    13. Re:Never corner a Christian by Empiric · · Score: 1

      I think you missed my central point. Entropy states that no matter what, from a naturalistic viewpoint, each individual, and all societies, and all species, holding any viewpoint whatsoever, will all die off, given sufficient time.

      Hence, a worldview incorporating "supernatural" elements, is the only one that could possibly "survive" in the context of evolution, by definition of physics.

      --
      ~ Whence do you come, slayer of men, or where are you going, conqueror of space?
  117. Re:Alarming? Consider this... by misanthrope101 · · Score: 1

    it takes far more faith to believe that a "deity" did not create human life

    It takes more faith to not have faith in a diety than to have faith in a diety? So... not believing in Santa Claus is really to have more belief in Santa Claus than those who... believe in Santa Claus? Being skeptical that Bigfoot exists means that you really have a stronger faith than those who believe in Bigfoot?

    Could you please explain your logic? You don't seem to be making any sense. Me not believing in your God does not mean I have more faith than you--it means that I lack your faith in your God.

  118. The worst part is.. by n3v · · Score: 0

    ... that it doesn't surprise me. :(

    Hopeless in Detroit, MI

  119. Re:Fortunately, It Doesn't Matter What You "Believ by glwtta · · Score: 1

    Unfortunately, a combination of other facts and beliefs make these beliefs relevant to our lives. Specifically, the fact that many of these people hold positions of power (and those that don't often make up a powerful majority), and their belief that they have a mandate from god to dictate how we live our lives.

    --
    sic transit gloria mundi
  120. Scientific community acceptance? by MarcusDonoghue · · Score: 1

    The article itself says absolutely nothing about opinions on acceptance 'within the scientific community'! That was, apparently, the poster's desire to paint evangelicals in the worst possible light.

    The truth is that most evangelicals simply believe what their pastors tell them about creation but almost all would be aware this is not supported by mainstream science.

    A small minority carefully track the science of creation/evolution and choose to believe that the Flood really could create the fossil record and that the evidence of helium diffusion (presented at a mainstream geology conference) explains the dating problem.

  121. Zealotry, Ignorance, War... by Anonymous Coward · · Score: 0

    Perhaps you should check out the film Flock of Dodos before you start pointing fingers at who is to blame. (Hint: the dodos are not the intelligent design folks, it's the scientists who are in danger of becoming extinct because they can't communicate simple facts to the mainstream audience.) Elitist attitudes like yours ("hey, if they can't keep up, fuck 'em!") is partially what drives the mainstream to give ID folks a listen. In the USA scientifically minded people are perhaps in danger of becoming extinct I don't know I haven't been there lately. One thing is for sure the USA certainly is a country of great contradictions. If these reports of the growing popularity of religious fundamentalism in the USA are really true and unexaggerated the difference between the USA and god-states like Iran is becoming less and less clear to me. Sure the USA is a Christian country and as such US religious fundamentalism is in many ways different from that of Moslems but the consequences of it's growing popularity are the same. The only sciences that Christian and Moslem religious fundamentalists don't seem to write off as offensive to god are those that lead to better weapons. The most extreme Moslem religious fundamentalist ban radios, televisions, CD player and tape recorders as being offensive to god (although the more realistic ones actually embrace them as tools to spread their message) but they don't seem to think Kalashnikovs, TNT and T-55 tanks are an insult to god. Similarly Christian US religious fundamentalists seem to revile the Sciences of evolution and paleontology, research into DNA and certain branches of physics that threaten their beleifs, but don't mind at all the sciences that brought us fire control computers, jet fighters with stealth technology and nuclear bombs. Wouldn't it be a delicious irony that if this trend toward religious fundamentalism continues (and I make little difference between the Christian and Moslem varieties of zealotry, the practitioners of both are equally ignorant) that WW3 may actually end up being a war of religion rather than a war with the Chinese or a reborn evil Russian Empire?
  122. False dichotomy? by 91degrees · · Score: 1

    I think the problem is, that belief in a deity is seen as incompatible with accepting evolution as a scientific fat. Ofcourse, this isn't a problem unless you take the Bible to be a literal account of the nature of the universe. The problem with that is that you would also have to believe that the sun goes round the earth, that mankind came before the animals, and that animals came before mankind.

    If you suggest to people that the bible can be taken metaphorically beforehand, I bet you'd see a substantial difference in the results.

  123. South Park underestimates stupidity by Dorceon · · Score: 1
    Cartman: One fourth of all Americans believe there's a 9/11 coverup! Are you saying one fourth of all Americans are retards?

    Kyle: Yes, yes I am.

    Stan: Yeah, at least one fourth.

    Kyle: Let's do a test sample. There are four of us here, and you're a retard. That's one fourth.

    --
    What sound do people on rollercoasters make? Hint: it's not Xbox 360.
  124. Parent is a troll by thefinite · · Score: 1

    C'mon, what is informative about such a blatant ad hominem attack? Promoting this kind of behavior doesn't promote a rational argument in favor of evolution.

    --
    Boom Shanka
    1. Re:Parent is a troll by PopeRatzo · · Score: 1

      Exactly what does my calling him a numbskull have to do with anyone else believing in Evolution? Are you suggesting that because I have a low opinion of anyone who finds more solid evidence in Genesis than in more than a century of scientific thought that it somehow invalidates all that science? I'm merely saying that a surprising number of the people who are so strongly against Origin of Species have a tendency to be suspicious of all Science.

      I'm pretty sure that most of the people who read Slashdot don't need you to point out a troll. Maybe you're just trying to be helpful to all the seminar readers from freerepublic who come here to game the mod system, but I'm guessing the regulars here can tell a troll when they read one without your instruction.

      --
      You are welcome on my lawn.
  125. Human (Re)gression by DaMattster · · Score: 1

    I think this is a sad thing because it shows we are regressing to thought patterns more common to turn of the 20th century thinking. This is more regression than progression. What's next? Will we re-enact laws making it illegal to teach evolution in the classroom? As other slashdotters have remarked, this is very sad. Evolution happens on both macro and microcosmic scales; it is really more than just a theory. I thought we put this issue to bed decades ago. Apparently, we have people so fervently religious that they are blinded to any view that would contradict the bible. Personally, I would like to believe that there was some mix of the two. I think a higher power did something to set the evolution dynamics in motion. But, after the dynamics were set in motion, life takes on its own forms and changes independently. This is my compromise to the different set of beliefs. I do not dispute Evolution at all but something was needed to trigger life and it is difficult to believe that life started randomly. It would have to be a 1 in several trillion chance occurrence. That said, I would not say the Bible tells the entire story either. The world was not created in seven days and our fossil and other (much more reliable) geological records attest to that. This may be the unanswerable question . . . at least with our current technology.

  126. Re:More news...Americans aren't good at maths eith by Clazzy · · Score: 1

    When the other 52% accounts for several religions as opposed to one.

    --
    If we can hit that bull's-eye, the rest of the dominoes will fall like a house of cards... Checkmate.
  127. learn your history by typidemon · · Score: 1

    "If a nation expect to be ignorant and free...it expect what never was and never will be." Jefferson, Thomas 3rd President of the United States (1801-1809)

  128. Seems about right to me by detokaal · · Score: 0, Troll

    Now we just need to continue to pour more government and foundation money into the crapper of evolution. Maybe if we put 100% of our dollars there instead of 99%, we can push that number of non-believers down. No matter that the scientific foundations of macro-evolution are completely bankrupt. Just keep putting this one-sided trash into our textbooks, science classes and other media so the same losers can keep parroting the same useless misinformation generation after generation. After all - how else are you going to get funded? Not by real scientific research, that's for sure.

  129. Re:Loaded Post by billgates · · Score: 1

    No it doesn't make you an idiot but it does make you unintelligent.

  130. Read the poll question by Eric+Pierce · · Score: 4, Informative

    Did anyone read the actual poll response in question?

    "Do you think the scientific theory of evolution is well-supported by evidence and widely accepted within the scientific community?"
    48% = Well-supported
    39% = Not well-supported
    13% = Don't Know


    39% not 48%. Zonk, you're fired.

    1. Re:Read the poll question by Xiroth · · Score: 1

      That was actually misreported in the article - apparently the journalist misread the organisation's own poll.

      They are the one that should be fired.

    2. Re:Read the poll question by Xiroth · · Score: 1

      Grr, I'm a damn fool. Link to raw poll results.

    3. Re:Read the poll question by Guuge · · Score: 1

      I noticed that as well. Why is it so hard to be factually correct in the summary? I think they intended to present these results:

      "12. Which one of the following statements come closest to your views about the origin and development of human beings? Humans developed over millions of years from less advanced forms of life, but God guided this process (or) Humans developed over millions of years from less advanced forms of life, but God had no part in this process (or) God created humans pretty much in the present form at one time within the last 10,000 years or so?"
      30% = God guided process
      13% = God had no part
      48% = Created in present form
      9% = Other / Don't know

      The title is justified; 48% do reject the concept of evolution (whether God-guided or not). The summary, however, is just plain wrong.

  131. which 48% by __aaacoe2998 · · Score: 0

    'Is evolution well-supported by evidence and widely accepted within the scientific community?', some 48% of Americans said 'No'. Furthermore, 34% of college graduates said they accept the Biblical story of creation as fact. An alarmingly high number of individuals responded that they believe the earth is only 10,000 years old, and that a deity created our species in its present form at the start of that period.

    I love studies that state "48% of Americans". Was that 48% of Americans from the Deep South? Maybe 48% of Americans with no formal education? Yeah, I didn't read the article but I don't generally have a lot of faith in studies that generalize an entire country's opinion on anything.

    And we wonder why 48% of Canadians think Americans are a little off.

  132. Two more reason for the rest of the world to laugh by Dracos · · Score: 1
    1. 48% of respondents refute science
    2. 48% of respondents don't pay attention to the question

    These uneducated dolts don't gbet to pick and choose their science, or the technology based on it. No evolution? Ok, then: no cell phones, no SUV's, no printing press, no metallurgy, no crop rotation, nothing. Don't care about evidence? Fine, you don't get a trial by your peers, we'll try you by Ordeal just like when the Church ruled Europe. Better start praying you weigh more than a duck.

    Take your oh-so-precious superstitions and go back to living in caves... us rational, civilized, enlightened people will even put a big fence around where ever you want to sequester yourselves with a big sign that says "Garden of Eden".

    When science discovers a maker's mark on the universe that says "God, 6000 BC" (very doubtful), then the situation will be diferent. Until then, someone telling you god is real doesn't make it true. I'm sure you wouldn't believe me if I told you the Flying Spaghetti Monster is upstairs in your house right now, having his noodly way with your wife.

    And I bet when you walk in on that live pasta pr0n, you'll still deny it, despite all the evidence.

    /rant

  133. 48% said the OPPOSITE of the /. headline claim by FLJerseyBoy · · Score: 0, Redundant
    The question in the actual 3/31 Newsweek survey reads:

    Do you think the scientific theory of evolution is well-supported by evidence and widely accepted within the scientific community?

    48% said the scientific theory of evolution IS well-supported. This is diametrically opposed to the /. editor's summary, "Given the straightforward question, 'Is evolution well-supported by evidence and widely accepted within the scientific community?', some 48% of Americans said 'No.'"

    Am I missing something here?

    1. Re:48% said the OPPOSITE of the /. headline claim by miro+f · · Score: 1

      Am I missing something here?


      Yes. This is slashdot.
      --
      being vague is almost as cool as doing that other thing...
  134. In unrelated downloads... by Anonymous Coward · · Score: 0

    "Most of them just use the tactic of saying things longer and louder than everyone else in the room and eventually people will believe you."

    It's NOT theft!

    1. Re:In unrelated downloads... by ScrewMaster · · Score: 1

      Every time someone tries to say, "Well, look, let's try to match our terminology to what the law says and the law calls it 'copyright infringement'" someone else starts shouting "IT'S THEFT AND I DON'T CARE WHAT THE LAW SAYS!" Regardless of whether it is "theft" or not, when one party says, hey, let's try to nail down our terms so we can communicate and the other refuses to do it, you're going to have a conflict. Guaranteed.

      Anyway, I don't think it's so much that if you say things over and over they believe you, it's just that they get bored of hearing you say it over and over and if what you're talking about isn't that important to them they just let it go.

      --
      The higher the technology, the sharper that two-edged sword.
  135. Re:Fortunately, It Doesn't Matter What You "Believ by kinglink · · Score: 1

    That's why we have findings, and we publish the process for the findings as well as the findings themselves. If another party can't reproduce the finding then our proof can be debunked.

    Well we used to, there's numerous global warming reports (Michael Mann's report early on comes into mind, though he's not the only one in the global warming debate, and far from the only scientist guilty of this) that issued findings with out their processes, as well as other places in science. So this wonkiness we speak of appears. Personally I think it's time science journals demand the processes as well as the findings for everything, but then their magazine would shrink because science has slowly been moving to a point where the "answer" is far more important than any question that can be asked.

  136. How alarming! by Anonymous Coward · · Score: 0

    People don't agree with the mainstream? People put stock in their faith even when society says not to? How "alarming!" An "alarmingly" high number of people are discussed in such language in this little blurb as to point out a truly alarming fact - bias and prejudice in the media. Of course, Slashdot's not part of THAT, now is it? How "alarming!"

  137. thats pretty depressing by aachrisg · · Score: 1

    This is especially depressing because of the form of the question - they're not even being asked about their personal belief or not in evolution, but a simple factual qustion "'Is evolution well-supported by evidence and widely accepted within the scientific community?". Someone could not personally belive in evolution and still come up with the correct "yes" answer to the question. The second part of the question is an indisputable factual "yes" - theres no room for opinion here. The first part of that question is pretty damn close to an indisputable factual yes as well - any honest creationist might be able to say "yes, evolution is well supported by evidence, but my 'god did it all 6000 years ago' theory is also perfectly supportable within my belief system" (honestly, pretty much anything is supportable if you assume an almighty being with limitless powers to say "abacadabra!" any time it wants to).

  138. I participated in this survey... by Clomer · · Score: 1

    I participated in this survey. It was conducted over the phone.

    When they came to the question about whether evolution is accepted in scientific circles, I immediately thought the question was poor. But I answered yes. It is the accepted scientific explanation of how things are. I answered this way even though my own religious beliefs do not agree with scientific reasoning on this matter.

    So I am also one of those that the survey identified that believes that humans appeared in their present form in the last 10,000 years.

    I suspect that a large percentage of those that said evolution is not supported by science were actually answering the question "Do you believe in evolution?" rather than what the survey actually asked. The way the question was worded is, I think, poor.

    As for people who believe the biblical account of creation, it does not mean that they are ignorant (though granted, it is likely that a lot are). It just means that they have differing views. I am fully aware of scientific views of the subject, as are many people. But I, like many others, have religious views that are contrary.

    --
    Intelligent responses welcome, flames will be met with marshmallows.
  139. Rejection of Evolution Is Putting G-d In A Box by Anonymous Coward · · Score: 0

    It is say that G-d can only do things one way, the way that a group of people claim. Thinking of G-d in those terms is not very G-dly.
    "G-d made man, but he used the ape in His plan." --Devo

  140. Humanity is done by Anonymous Coward · · Score: 0

    Let's get on with the next step in evolution already, this ones starting to wear thin.

  141. Since when do you get to decide who is Christian? by Trillian_1138 · · Score: 1
    Disclaimer: I'm not Christian - I'm culturally Jewish but consider myself to be religiously agnostic. That said...

    It's pretty well-known that most people who call themselves Christian don't practice it in their daily lives and in essence, don't actually or truly believe.

    Who the hell are you to decide what people "actually or truly believe"? (FWIW, I don't understand the difference, but that's not really the point.) One of the things I really do appreciate about Judaism, for all that I dislike, is that most Jews are willing to give a wide latitude toward what constitutes "Jewish." As a religion - at least, from my experience with the liberal branch of the religion - no one gets to say "Yup. You're Jewish."*

    And as far as I've been able to determine, the New Testaments basically says the same thing - it's up to God to say whether you were 'good enough' or not, and it's up to you to figure out how to best do that. For all the problems with the Bible, Jesus was pretty clear that being a good person and believing in God are more important than going to Church every Sunday. Again, I am no great fan of organized religion and have little patience for fundamentalism in any form. But you don't get to decide whether someone else is Christian or not. Neither do I. And, while there are certainly people who claim that the Pope or whomever gets that authority, I still have to disagree. Every individual knows for themselves whether they are or aren't religious and screw you for saying otherwise.

    Eventually, religion will fade away. It's fighting religion that keeps it alive.

    It sounds like you're an atheist, although it's possible you're simply an opponent of organized religion specifically. Regardless, I really take issue with your anti-religion stance and, as a larger issue, the occasional anti-religion stance on Slashdot.** The idea that intelligent design should be taught in school next to evolution is ridiculous. The only place religion has in public school is social studies, history, and (arguably) English or literature. And I would readily agree that religion has brought forth some unfortunate consequences (ID being one of the more recent ones). But that doesn't mean religion (or religious people) are inherently bad, or that religion and scientific inquiry are mutually exclusive.

    I've drifted off-topic, so I'll get back to my main point. People completely and utterly have the right to create their own identities. That's what really bothered me about your post - that you claim to have the ability to judge who is "truly" or "actually" Christian, as if you are privy to some mystical knowledge that eludes the rest of us. You can't make that call.

    -Trillian

    As a post-script, part of my conviction of self-identity comes from long discussions this past summer about the Jews for Jesus who had suddenly appeared in the New York City subway system. After doing some research on Messianic Jews (see http://en.wikipedia.org/wiki/Messianic_Jews) I came to the conclusion that while Jews for Jesus are annoying as hell, Messianic Jews as a larger group honestly believe they're Jewish and I really can't argue. Likewise, even if someone practices religion in a way you don't understand or in a way you feel isn't "good enough" doesn't mean they're not religious.

    *There are theological complications if you want to talk about more Orthodox branches of Judaism, but my understanding is you'll find that in the more fundamentalist branches of any religion
    **I know, it's not everyone...
  142. Agnostics/Atheists by Ksisanth · · Score: 1
    Atheists were lumped in with agnostics, so the 40% perhaps represents those who claimed to be agnostic but forgot they were supposed to say "Don't know".

    Question 12: Which one of the following statements come closest to your views about the origin and development of human beings? Humans developed over millions of years from less advanced forms of life, but God guided this process (or) Humans developed over millions of years from less advanced forms of life, but God had no part in this process (or) God created humans pretty much in the present form at one time within the last 10,000 years or so?
    13% of agnostics/atheists chose "God created humans pretty much in the present form at one time within the last 10,000 years or so". The 48% probably comes from the total for that response from all groups, not the question about whether it is well-supported by evidence/accepted by scientists.
  143. Did April Fools' Start Early? by Anonymous Coward · · Score: 0

    No? Damn.

  144. Argument ex plumbum by ibi · · Score: 1

    This is a variant of what I call the "Argument from Plumbing". When the plumber comes and fixes your drains, he isn't taking away your free will. He's enabling you to exercise your free will to do other things than suffer crappy plumbing. An omniscient good God would have created a world different in too many ways to count.

    There's more interesting ways to exercise your free will as a healthy well fed buddist than as weak starving christian, to boot :-)

  145. stake your health on your faith by Scrameustache · · Score: 1

    I'm ready to accept evolution just as soon as the science is more credible than faith and the Bible. Next time you're sick, for the love of god, put your faith in prayer, not in antibiotics.
    --

    You can't take the sky from me...

    1. Re:stake your health on your faith by Anonymous Coward · · Score: 0

      Why do you equate a disbelief in evolution with the disbelief in science in general? I believe in science-fact, not science fiction.

      Mark twain wrote:

        "There is something fascinating about science. One gets such wholesale returns of conjecture out of such a trifling investment of fact."

      Evoltuion is based on conjecture after conjecture. Lets see some hard evidence! Otherwise, you might as well believe in the Bible or that the earth is supported by elephants on turtles or vice versa.

  146. There isn't any evidance though! by Micklewhite · · Score: 0

    If evolution is real then how come I've never found a monkey in my peanut butter?

    http://www.youtube.com/watch?v=FZFG5PKw504

    --
    I don't own a snook, and if I did I wouldn't leave it cocked.
  147. Re:Two more reason for the rest of the world to la by mvdwege · · Score: 1

    we'll try you by Ordeal just like when the Church ruled Europe.

    Next time, crack open a few history books before you shoot your mouth off. It was during the Enlightenment when most witch-burnings happened. The Mediaeval Church was pretty open-minded about the role of science in explaining the world (try looking up Augustine's opinion on science for a laugh).

    The particular brand of moronity referred to in TFA is almost exclusive to the United States of America. Meditate on that before you start spouting off more stupidity.

    Mart
    --
    "I know I will be modded down for this": where's the option '-1, Asking for it'?
  148. And... by Anonymous Coward · · Score: 0

    Americans elected George W. Bush.

  149. Not restricted to Americans by perkr · · Score: 1

    25% of the Swedish population do not believe in Evolution either.

    Source: Svenska Dagbladet (one of the largest news papers in Sweden)

    Personally, I think the effect we see is due to a change of public perception of science and scientists today. People just do not respect scientists the way they used to. If this is due to news coverage, politicians or bad science I have no idea.

  150. Bull by wytcld · · Score: 1

    A standard hypothesis is that as soon as you have conditions in a chemical soup that can support selection for self-replicating chemical chains, you have the beginning of life. That is: As soon as evolution is a supported possibility, just then is when life takes hold.

    Now, this is not proven, yet. But for decades there have been experiments with very suggestive results on this - setting up initial (and lifeless) environments in chemical conditions approximating early Earth, and seeing what just could be the start of the formation of such chemical chains. This was standard in main-stream press science reporting well back into the '60s. There's still much current research in it, and a whole lot of theory.

    --
    "with their freedom lost all virtue lose" - Milton
    1. Re:Bull by coopex · · Score: 1

      Are you suggesting that however the universe began, it did not include evolution, and it was a "patch" 4 billion years ago that allowed abiogenesis?

      --
      The road to hell is paved with good intentions.
  151. Thank about the term "average intelligence" by SmallFurryCreature · · Score: 1

    Have you ever met a person that you would describe as having an average intelligence? What do you mean, I am reading a post by one right now?

    Anyway, half of the people, are even less intelligent then that.

    There are people out there with IQ's well below 100 and they are allowed to vote.

    Now just because a person has a low intelligence does NOT have to mean they are stupid. Far more dangerous are the people with just enough of intelligence to think they know better. You know the type, "How can there be global warming when it is freezing outside".

    These same people look at evolution, can't see how a bacteria instantly develops into a human being and therefore it must be done by magic. Evolution is possible because of two things. First because if you have enough time even the most unlikely event is bound to happen but far more importantly, because the end result isn't nearly so fantastic as we would like to believe.

    Lets face it, if a god had designed human beings would he have made such a mess. Take teeth, human beings live far to long for their teeth, so why hasn't god given us the constatly growing teeth of rabits OR the constantly replaced teeth of sharks? No instead we are lumbered with teeth that rot because of our diet and just don't have the required lifespan to last for 80+ years.

    The eyeball is often used as an example of god's existence but lets face it, who of us couldn't come up with a better design if they were all powerfull. How about a simple autocorrection system so we don't need glasses. For that matter why not give your "top" design not the same eyes as say an eagle so they can see properly?

    Part of the blame for religous nonsense like ID lies with the scientists. I seen everything from scientist trying to explain woman's boobs to us walking upright by "logic". Nature/evolution don't work that way. Women got boobs, because they got boobs. They are NOT substitutes for a baboon's bottom. (think about it, other big apes don't have them either, plus just because humans walk upright don't mean you can't see their asses) And human walk upright because, well we do. I am pretty sure that if somewhere there is an intelligent species that cartwheels around on 1004 limbs they will have scientist claiming that this is the most efficient system that could evolve.

    Evolution happened because given enough time anything will happen. Nature does not exist, there is no goal, no end result, no plan, no path. We just happened.

    Darwin never claimed Survival of the fittest. It is like how the term "global warming" got used instead of global climate change wich in itself is just a part of the impact human's have on nature. People focus on the warming bit because they can attack that and ignore that even if it NOT correct, we still are in trouble if we die of poisenous air and/or destory the ozone layer.

    But yeah, global warming ain't real, because it is freezing outside, and god created man because you have this amazing eyeball that is outmatched by dozens of animals eyeballs. We can't see in the dark, our color vision sucks, we can barely see any distance, have trouble with fast moving objects OR objects standing still. IF a god created us, he didn't want us to see much of his creation did he. We can't even properly see the bloody flowers.

    --

    MMO Quests are like orgasms:

    You may solo them, I prefer them in a group.

    1. Re:Thank about the term "average intelligence" by Proudrooster · · Score: 1

      These same people look at evolution, can't see how a bacteria instantly develops into a human being and therefore it must be done by magic. Evolution is possible because of two things. First because if you have enough time even the most unlikely event is bound to happen but far more importantly, because the end result isn't nearly so fantastic as we would like to believe.

      Ok, I agree with you on "average intelligence" and "vi vs. emacs" but the part about "evolution isn't nearly so fantastics as we would like to believe" threw me.

      You can treat life as a statsitcal probablility if you like. If so, evolution doesn't fit for two main reasons which have nothing to do with the FSM.

      1. Why are species extinct and where are the new species? Let's assume that given enough time a lizard will 'evolve' or a-speciate into a dinosaur or bird. Of all the pets and zoo animals humans monitor on a daily basis, no one has ever witnessed the magic.

      2. Assuming something evolved into something else "a-speciation" what is the probability that 1) at least two evolved, found each other and were able to mate and reproduce while finding a suitable environment and food source before dying. Additionally, to have a healthy genepool at least 8-15 pairs would have to simultaneously a-speciate to not die off in a few generations due to inbred defects.

      Evolution sounds good and it's easy to say, "Look everything is made up of DNA! Viola! Evolution". However, the facts and probabilities don't match. Using Wikipedia, assuming life began about 3.5 billion years ago and evolution is a linear process (not exponential), and based on the number of known species (even though the word species doesn't really have a valid definition, to me, any two lifeforms genetically compatible for reproduction constitutes a species) we should see the magic of evolution on average once every two hundred years. If the process is exponential, we should see it about once every 10-20 years. So far, no magic has been witnessed.

      No fish have turned into birds or lizards into dinosaurs. Also, no extinct species have magically re-evolved. If someone can produce this evidence we can stop the debate, at least in my mind since that is how the scientific method is supposed to work.

    2. Re:Thank about the term "average intelligence" by rthille · · Score: 1

      You can see speciation here in California.

      Really, all it takes is some driving. It's going on today, right now.

      It's the salamanders around the central valley. They can all interbreed with their neighbors, as they progress around the valley, but the funny thing is that when they 'close the loop', they can't breed anymore.

      for more information, google 'ring species'

      --
      Awesome furniture, accessories and cabinetry in Santa Rosa, CA: http://humanity-home.com/
  152. Americans are not uniquely stupid. by TerranFury · · Score: 1

    >Conversely, at least here in the UK, I know of many religious Christians, including IIRC the Archbishop of Canterbury, and I believe the Pope (obviously he's not in the UK); who accept the theory of evolution with no problems.

    This is not because you and your friends are British! It's because you're the type to post on Slashdot (e.g., at least moderately well-educated, and somewhat scientifically or technologically inclined) and they're the type to be your friends!

    Because actually, the stats tell the same story about the UK that they do about the US.

    It's true that most Americans are bleeding idiots, but that's not a trait of Americans so much as it is of Homo Sapiens.

  153. it's ironic by nanosquid · · Score: 1

    Many of these 48% are the same people who are pushing to go to war and kill thousands of innocents on the flimsiest of evidence, yet a century of carefully researched, incontrovertible evidence for evolution fails to convince them. Newton's laws are more likely to be wrong at this point than evolution.

    And may of these 48% are the same people who think that the closer a market economy approximates social Darwinism, the better, yet when the same principles apply to evolution, they all of a sudden become an instrument of evil.

    All I can say is that, with any luck, those same 48% of Americans will be rejected by evolution.

  154. God at 48% compared to Tobacco at 25% by 140Mandak262Jamuna · · Score: 1
    Well, almost every American, including almost all the smokers agree that tobacco is bad for them. Still 25% of the Americans smoke. So even if you prove that belief in God will degrade their health and probably kill them sooner, you could expect 25% of the Americans to continue to believe in God. Since the position of atheists is that God does not exist, and it is logical to conclude what does not exist cant hurt you, God scoring at 48% is not much of a surprise.

    AFAIC I am not worried or alarmed by people believing in God or being agnostic or even atheistic. I am far more worried about people blindly following an ideology, be it communism, be it islamic terrorism or be it blind faith demanded by many churches. Fortunately communism is in the dust heap of history and the power of church over the population has been in decline for a long time. I just wish the churches will leave science alone and pick its fight with an equal adversary, the islamic terrorists.

    --
    sed -e 's/Chuck Norris/Rajnikant/g' joke > fact
  155. Ironically, evolution is at work with the 48% by bl8n8r · · Score: 1

    We are witnessing evolution and natural selection in the 48% polled. As people become increasingly more ignorant, they are slowly evolving back into lemmings which will, in turn, increase the number of people that are unable to comprehend simple scientific fundamentals such as evolution, natural selection, or formatting a floppy disk. I blame Clippy.

    --
    boycott slashdot February 10th - 17th check out: altSlashdot.org
  156. Re:Since when do you get to decide who is Christia by javabandit · · Score: 1

    Who the hell are you to decide what people "actually or truly believe"? (FWIW, I don't understand the difference, but that's not really the point.)

    Everyone decides these things on their own. It is simply a case of a hypocrite versus practitioner. I was a born-again Christian for several years in my teens. When I was nineteen, I literally left the church, left my faith, because I simply didn't "believe" anymore and that happened over a two year period. My fellow Christian friends told me, "If you are leaving, then you never really believed in God to begin with."

    Basically, they were calling me a hypocrite. That over those years, I was simply "going through the motions" and not really believing in what I was doing. And at first, that couldn't have been further from the truth. But towards the end, they were right. I really didn't believe anymore.

    Point being, "truly believing" means that someone is simply practicing what they preach. People who preach something and don't practice it don't "truly believe" in what they are saying.

    In other words -- hypocrites.
  157. This is terrifying... by stu9000 · · Score: 1

    What the hell is wrong with the US people? Why has rejection of evolution become a necessary part of believing in god? If you North Americans reject science I am worried that other countries, ones culturally colonised by the US such as Australia will follow suite. This would clearly be a disaster. Scientists over there clearly need to get with the new mind control program. You guys have got to get on TV and you've got to be FUNNY. That's right MAKE FUN of creationists, not with elitist in-jokes like the Flying Spaghetti Monster but with broad, undeniably funny humour. See Dave Chappelle and Sasha Baron Coen for inspiration. The best way to undermine ridiculous ideas is with humour. God bless Jon Stewart and Stephen Colbert.

    1. Re:This is terrifying... by Dunbal · · Score: 1

      What the hell is wrong with the US people? Why has rejection of evolution become a necessary part of believing in god?

            Because Darwin is a terrorist and everyone knows he's hiding WMD's in the Galapagos. They must be under them giant turtle things...

      --
      Seven puppies were harmed during the making of this post.
  158. Fools! by Anonymous Coward · · Score: 0

    Furthermore, 34% of college graduates said they accept the Biblical story of creation as fact. An alarmingly high number of individuals responded that they believe the earth is only 10,000 years old, and that a deity created our species in its present form at the start of that period.
     
    Don't they know that it is the great Thulsa Doom that created this planet? He is like a father to all of us and once he is gone we will cease to exist? But worry not, my friends, Thulsa is immortal and will forever roam this planet, slaying those who would scoff at him.

  159. I think god used agile processes... by javabandit · · Score: 1

    When you read Genesis, it is clear that god was following an agile methodology -- except that he was his own customer. He did all of that in six days. That probably would have taken six years using a waterfall methodology.

    The start of Genesis reads like agile. He literally wrote a story card (declared the requirement), solved the story, approved it (saw that it was good) and then took the next card. He didn't plan and design it all in advance.

    Only problem is that nobody reviewed his implementation. So when it got fucked up, he just got pissed at himself and flushed it (literally) down the toilet so he could start over.

    Even god refactors things, I guess...

  160. Did anyone read the actual question on the poll? by w3woody · · Score: 1
    I'm always suspictious about polls: you never know if the question asked introduced bias into the survey so that the author of the story would have something to talk about:

    Apparently the headline comes from the answer to question 12 on the survey. Here is the actual text of the question:

    12. Which one of the following statements come closest to your views about the origin and development of human beings? Humans developed over millions of years from less advanced forms of life, but God guided this process (or) Humans developed over millions of years from less advanced forms of life, but God had no part in this process (or) God created humans pretty much in the present form at one time within the last 10,000 years or so?

    Uh, I think this should have been followed by a question 13: "Did you understand question 12?" (yes) (no).

    This was by far the longest and worst worded question in the survey.

    The other fascinating thing to note is that on the detailed survey was that 13% of self-described "agnostics and athiests" answered "yes" to the idea that God created the Earth in its present form--a philosophical logical fallacy.

    Tells me the numbers in the survey are at best junk.
  161. So what, people can think what they want by katorga · · Score: 1

    Jeez, what kind of fascistic bent this post had. Who cares what people think. My guess is that world wide, well over 50% believe in some kind of creation myth/faith instead of evolution. Do you think the 1 billion Muslims believe in evolution? The 1 billion Catholics? The 1 billion Buddhists?

    The fact is that forcing people to recant their religious faith in favor of Evolution is just as wrong as religions forcing scientists to recant their beliefs in favor of religious dogma.

  162. The saddest thing.... by TJ_Phazerhacki · · Score: 1
    Is that apparently, at least according to the slant of the article, science has already disproved the existence of god.

    --
    Physics is nothing like religion. If it was, we'd have an easier time trying to raise money!
    1. Re:The saddest thing.... by Dunbal · · Score: 1

      at least according to the slant of the article, science has already disproved the existence of god.

            Maybe not, but it has certainly disproved the effectiveness of prayer on the recovery of coronary bypass graft patients... (published in The Lancet a few years ago, I'm too lazy to look it up).

            Perhaps they just weren't praying hard enough, or in the right direction, or with the right "magic" words, etc....

      --
      Seven puppies were harmed during the making of this post.
  163. Ambiguous Question by soanso · · Score: 1

    Is evolution well-supported by evidence and widely accepted within the scientific community?
    Think about all the news coverage and random people encouraging intelligent design in various states. I know the evolution is correct, not a doubt in my mind. It's a scientific theory and I know what that means. But reading this question makes me think briefly as to what the answer should be. Anyone who read it as "Is evolution well-supported by evidence and widely accepted?" and just that probably responded "No" because so many idiots are arguing about its validity.
  164. The tragedy of religion by mattpointblank · · Score: 2, Insightful

    The sad part here is how backward the Church is being (assuming that those 48% are all God-fearing Christians). Rather than trying to fill the gaps in science or offer alternatives for the trickier aspects (where did the Big Bang come from? What was there before? etc), Christianity (or its public face) tries to send us back to medieval concepts. Their mistake is denying clearly factual evidence (the Earth is 6000 years old? Ancient fossils are there to test our faith? etc) rather than moving with the times and working alongside scientific theory and using it as a backup for Christian beliefs rather than a contender.

    1. Re:The tragedy of religion by ChromeAeonium · · Score: 1

      Ancient fossils are there to test our faith? One guy said that because he couldn't think of anything else to say. One guy proposed the Hopeful Monster theory for the same reason. It's getting old.
  165. Only 39% (whew!) by Kelson · · Score: 3, Informative

    You have to click through a few links to get to it, but the actual poll states:

    13. Do you think the scientific theory of evolution is well-supported by evidence and widely accepted within the scientific community?

    Well-supported: 48%
    Not well-supported: 39%
    Don't Know: 13%

    It looks like the submitter got mixed up with the two stats that were both 48%.

    Disclaimer: This quote has been modified from the original version. It has been reformatted to fit within Slashdot's HTML limits.

    1. Re:Only 39% (whew!) by Alsee · · Score: 1

      Cringe. Reading through your link I cam across this wonderful gem:

      14. Do you believe in God?
      91% Yes
      6% No
      3% Don't know

      15. People who don't believe in God are called atheists. Do you personally know any atheists, or not?
      49% Yes
      48% No
      3% Don't know


      16. Would you describe yourself as an atheist?
      3% Yes

      96% No
      1% Don't know


      Ok, so 6% do not believe in God, "People who don't believe in God are called atheists", and only 3% are willing to say they are atheist. WTF is up with the other 3% who do not believe in God?

      Hmmmm....
      Do you have hair? No.
      People with no hair are called bald.
      Are you bald? No.


      Ayup.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    2. Re:Only 39% (whew!) by ultranova · · Score: 1

      Ok, so 6% do not believe in God, "People who don't believe in God are called atheists", and only 3% are willing to say they are atheist. WTF is up with the other 3% who do not believe in God?

      They likely disagree with the definition of atheist given there, and only include someone who actually denies the existence of God - that is, believes that there is no God - rather than simply not having any believe either way. They'd likely consider themselves agnostics. Or they could worship a pantheon of some kind and think that God - with the capital letter - refers to a monotheistic deity of some kind. Or maybe they consider atheism to be synonymous to irreligious and are members of some non-theistic religion.

      This is why it's so very important to set the question and possible answers just right, to ensure that you're actually researching the thing you think you're researching.

      As a specific example, you really need to distinguish between strong atheism - the belief that there is no god - and "dunno". Otherwise you're going to get results like these.

      --

      Forget magic. Any technology distinguishable from divine power is insufficiently advanced.

  166. You chimpanzees are going to be extinct shortly by Master+of+Transhuman · · Score: 1


    What are these nearly 50% of morons in this country going to do when Transhumans come down the pike?

    They're going to try to exterminate them.

    And they will fail - getting exterminated in the process. Because, contrary to the Star Trek and Terminator movies, there is no way humans are going to outmaneuver Transhumans. Can't happen.

    This applies to most other humans worldwide, I suspect, since religious stupidity is not limited to this country.

    The human race will be mostly gone from the earth by the end of this century (by extermination, transmogrification, or their own hand) - and late, too.

    Have a nice day, chimps.

    --
    Richard Steven Hack - This sig is TOO GODDAMN SHORT TO DO ANYTHING USEFUL WITH! MORONS!
  167. Re:Since when do you get to decide who is Christia by Trillian_1138 · · Score: 1

    Thanks for the response.

    I completely agree with you - someone going through the motions without believing is a hypocrite. But what I was responding to was the claim that only occasionally going to Church and not 'practicing' in a daily, public way means you're not Christian (or Jewish, or whatever). More to the point, if they "truly believe" that being Christian can mean occasionally going to Church, celebrating Christmas, and believing in God in a non-confrontational kind of way, more power to them. erroneus said that these people call themselves Christians but don't "actually or truly believe" and, while you have given me some things to think about on what it means to truly believe (and I agree with what you said) I don't think you responded to my original issue: erroneus claimed that "most people who call themselves Christian don't practice it in their daily lives and in essence, don't actually or truly believe."

    I'm challenging that assumption on the grounds s/he has no right to claim knowledge of the beliefs of another. S/he could have said "Most people who call themselves Christians aren't living in a way that I feel lines up with what it means to be Christian" or even "Most people who call themselves Christian have very vague definitions of 'Christian,' but s/he didn't - s/he made a very specific claim and I'm calling bullshit.

    Likewise, s/he was vague as to what it would mean to "practice [Christianity]." Daily Church attendance? Weekly Church attendance? No Church attendance at all but obeying the Bible as you understand it? Keeping slaves and stoning neighbors who don't observe the sabbath? Depending on your viewpoint, any of those might mean "practicing Christianity." My point is that there's a wide range of what it means to be Christian (Jewish, Muslim, etc) and no one person gets to decide for everyone else what exactly that means.

    Unless you found your own religion, in which case feel free to go hog-wild (see Scientology).

    As a complete side note, kudos to you for having the strength to leave the church when you no longer believed.

    -Trillian

  168. "I don't think it means what you think it means.." by anvilmark · · Score: 1

    Kelson:
    "America continues to worry about losing its edge in the high-tech industry.
    But that couldn't possibly be related to poor science education, could it?"

    I don't think anyone would argue that acceptance of evolution has been an ongoing process in America.
    This would mean that currently more Americans believe in evolution than at any time in the past.
    Conversely, it would mean that during the period of America's greatest technological and scientific dominance, there was less belief in evolution than at present.

    If anything, this factoid would tend to support that the *acceptance*, not *rejection*, of evolutionary theory correlates with any perceived reduction in America's technological and scientific dominance.

    *insert obligatory comment about correlation, causation and coincidence here*

    There *was* a country that rigorously enforced evolutionary scientific education, religion was not tolerated in any way in it's schools. It's name was ... the Soviet Union ... and it doesn't exist anymore.

  169. organized religion should be banned by Anonymous Coward · · Score: 0

    If you believe the earth is only 10,000 years old, you should be killed. Period. No ifs ands or butts about it, you are too stupid to draw another breath.

    1. Re:organized religion should be banned by onlyfacts · · Score: 1
      Organized science should be banned. Just because a bunch of so-called scientists say we should trust them and just accept their conjecture is not a good thing. If you don't "go with the crowd" in science, you are black-balled. This is primarily because it is a "publish or perish" culture and not a true open environment for debate. Ban organized science!

      If you can't produce a single observable, reproducable fact for macro-evolution without a lot of explaination then shut up.

  170. Theory as in model, not as in WAG hypothesis by Tom+Christiansen · · Score: 2, Insightful

    Theory is a problem-word. No big surprise: I'm sure most /.ers
    realize this. But I can't help but wonder whether we don't all
    underestimate how *much* of a problem this little word is.

    Referring to the *theory* of evolution makes too many people think of
    some dubious hypothesis, perhaps just another man's opinion, rather
    than of the fact-constructed model for explaining observed phenomena
    that it truly is.

    I bet if we talked about the *model* of evolution, we'd have less
    trouble than we currently do with all the knee-jerkers who attack
    the word theory. A model is stronger than a mere conjecture, but
    even an unproven conjecture as it's used in math or science is on
    firmer territory than figmental tenets of something like, oh,
    Frisbeetarianism (just to pick a religion I'm unlikely to get
    lynched over).

    Consider number theory: no one imagines number theory to be some vague
    notion open to individual interpretation and belief. Imagine if
    instead of talking of Newton's three laws of motion, these were
    bundled together and called Newton's theory of motion. Swap law into
    theory and what happens? Sound a bit shakier?

    Not if you understand that theory means more than just somebody's
    guess. The Dictionary records 7 principle senses for the noun theory;
    of these, the first 2 are obsolete, and the 7th is for combining forms
    such as theory-neutral or theory-making. The last main sense, sense 6
    (whose first citation is from 1792) is the one giving us grief here:

    6 In loose or general sense: A hypothesis proposed as an explanation;
    hence, a mere hypothesis, speculation, conjecture; an idea or set of
    ideas about something; an individual view or notion.

    However, sense 6 that's *not* the operative definition for theory as used
    in number or automata theory, or in the theories of gravity, of relativity,
    or of evolution. Instead, it's sense 4 (first cited in a 1638 example) that
    applies here, usually in subsense 4a but sometimes in 4c:

    4a A scheme or system of ideas or statements held as an explanation or
    account of a group of facts or phenomena; a hypothesis that has been
    confirmed or established by observation or experiment, and is
    propounded or accepted as accounting for the known facts; a statement
    of what are held to be the general laws, principles, or causes of
    something known or observed.

    4c A systematic statement of the general principles or laws of some
    branch of mathematics; a set of theorems forming a connected system:
    as the theory of equations, of functions, of numbers, of probabilities.

    If our treatment of science and math in primary and secondary education in
    the United States weren't in such sorry shambles, more Americans might
    understand that *this* sort of theory isn't so much a loose notion as a
    model that explains observed phenomena and predicts others, all subject
    to empirical testing.

    Which would be easier: fixing general science education in American public
    schools, or adopting a term like evolutionary model? Although the second
    may seem only a small measure compared with how serious the first is,
    wouldn't it still be a good idea to attempt the second anyway?

    Perhaps I've been listening too much to George Lakoff or Jeffrey Feldman
    talking about the importance of word-choice in framing discourse and
    debate. But I truly see this "theory"=="hypothesis" misunderstanding as
    an unnecessary source of trouble, and think underplaying "theory" in
    favor of something more readily apprehended by the layman might help.

    --tom

    1. Re:Theory as in model, not as in WAG hypothesis by Dunbal · · Score: 1

      While perhaps I can understand the drive to change the wording to soothe the layman; perhaps it would be better to leave the wording as it is, and educate the vulgar. Although I realize that this is an insurmountable task, a fool with an education is just an educated fool.

            So fuck 'em, and let's get on with our useful work. Don't expect them to thank us, either. According to them, the human lifespan is getting SHORTER...

      --
      Seven puppies were harmed during the making of this post.
    2. Re:Theory as in model, not as in WAG hypothesis by onlyfacts · · Score: 1
      Hey Tom, what's your point? $toms_comments =~ s/bs//; results in 'change how you say evolution and it becomes credible'? Funny. Macro-evolution is lacking on facts alone. The fossil record should be clear, it isn't - the DNA traces should be clear - it isn't.

      How about we change the theory of evolution and make it credible? Oh, that has already been done ... about a few hundred times. Real science requires open debate about facts - this just doesn't happen today with maco-evolution - it isn't allowed. Why?

  171. Where did all the intelligent christians go ? by craznar · · Score: 1

    Who, like me - believed God created the universe 15 billion years ago, used evolution rather than a production line to make humans - and pissed off and left us all alone like a crazed scientist, waiting for an unbiased experimental result ?

    Why did he have to make it 10,000 years ago instantly filled with people and 2 million year old relics ?

    --
    EMail: 0110001101100010010000000110001101110010 0110000101111010011011100110000101110010 0010111001100011011011110110
    1. Re:Where did all the intelligent christians go ? by onlyfacts · · Score: 1

      You give yourself too much credit.

  172. MOD PARENT UP by miro+f · · Score: 1

    damn AC's hiding their informative posts.

    Darwin's famous book is called "The Origin of Species" and deals with how the different species came into existence, not how life came into existence. Abiogenisis is the study of the origin of life itself, a completely different field from evolution.

    --
    being vague is almost as cool as doing that other thing...
    1. Re:MOD PARENT UP by Anonymous Coward · · Score: 0

      Completely different but closely related and even less explainable in a coherent way with only natural forces than evolution.

    2. Re:MOD PARENT UP by mapkinase · · Score: 1

      It is a great basis alright, sadly, macroevolution does not pass it.

      --
      I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
    3. Re:MOD PARENT UP by notwrong · · Score: 1

      It is a great basis alright, sadly, macroevolution does not pass it.

      [Macro]evolution is surely falsifiable. If it were the wrong explanation for why we observe species we do, we would merely need to catch whatever the correct explanation is in the act, and we have our falsifying example right there. However, no-one has ever suggested any other plausible mechanism, nor or is there any known inconsistency between the biological evidence we have and evolution.

      There are already plenty of things that we have evidence for that would have disconfirmed evolution if they had been otherwise. Two major examples are the fossil record and the degree of genetic similarity amongst related species.

      I take it that your beef with macroevolution in particular means you obviously accept that microevolution has been observed innumerable times. What mechanism do you propose suddenly jumps in to prevent the combination of reproductive isolation and a large number of microevolutionary steps from becoming macroevolution? How falsifiable is your invention?

    4. Re:MOD PARENT UP by mapkinase · · Score: 1

      Propose a scientific experiment capable of disproving macroevolution. So far what you wrote does not qualify.

      By definition, falsifiability proof should not envolve experiments or observations that have been already done.

      --
      I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
    5. Re:MOD PARENT UP by notwrong · · Score: 1

      By definition, falsifiability proof should not envolve experiments or observations that have been already done.

      Sorry, but that is nonsense. Repeatability is a crucial part of the scientific method, and "experiments or observations that have already been done" must be repeatable to be reliable. Repeating potentially falsifying experiments is just as valid a test as doing them the first time. Are you saying that evolution was falsifiable, the experiments and observations that we have already made could have been disconfirming evidence if they had gone otherwise, but since they didn't, we can't do them again, and it's now not falsifiable?

      Propose a scientific experiment capable of disproving macroevolution. So far what you wrote does not qualify.

      I'll give you a few new experiments, expanding the examples I already used:

      • Dig up new fossils. If their stratification places descendents before ancestors without a plausible geological reason, this is disconfirming evidence
      • Take the DNA from two sets of animals from related species that can still have offspring, e.g; lion & tiger, horse & donkey. If the DNA similarity between animals from separate pairs is greater than within a pair, this is disconfirming evidence.
      • Again compare DNA, this time considering convergent species and their geographical/phylogentic relatives. Take for example echidna & platypus and hedgehog & shrew. If the echidna is more genetically similar to the hedgehog than the platypus, or the hedgehog is more similar to the echidna than the shrew, this is disconfirming evidence.

      Now I've responded to your request, could you explain either (a) why you do not think microevolution happens, in spite of being observed routinely, or (b) what mechanism you propose prevents microevolution of populations of a single species in reproductively isolated environments with differing selection pressures from leading to large-scale differences (i.e. macroevolution) over time?

    6. Re:MOD PARENT UP by mapkinase · · Score: 1

      Old experiments COULD HAVE BEEN tests on falsifiability if they were real scientific experiments, not just bone collection, paleozoology.

      There weren't any falsifiability experiemnts. The fossil data COULD NOT POSSIBLE disprove or prove macroevolution, because it is STATIC data. Macroevolution is a PROCESS. That is item 1.

      The offspring of close species are not reproducible organisms. If anything, they only prove for now that the chances of producing new species in that way is slim. DNA similarity or dissimilarity in that case proves nothing but microevolution.

      Item 3. You are arbitrarily extracting on phenotype component from the whole ensemble of phenotypic differences. It is well known that very similar function of the protein could be performed by quite different protein folds. So similarities or dissimilarities in this case prove nothing.

      Replies:

      a. This is not what I say. Microevolution (read: genetic changes within species) happens.
      b. I do not propose ANY mechanism. I even say that it is not SCIENCE at all, because it does not deal with time spans that allow us to produce decisive experiments. I do not have to propose mechanism to explain why something does not happen, the point is just to explain why this is not happenning: despite thousands of years of dog breeding (which is kind of accelerated "natural" selection) we are not observing new species. Even on the virus level we do not observe ACTUAL PROCESS significant changes in targets, methods, etc...

      --
      I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
    7. Re:MOD PARENT UP by notwrong · · Score: 1

      Old experiments COULD HAVE BEEN tests on falsifiability if they were real scientific experiments, not just bone collection, paleozoology.

      Oh dear. So is most of astronomy not science because it deals with observing light from events that happened thousands or more years ago? Is geology not science because most geological phenomena are too slow to observe within a human lifetime? Who decides what is a 'real' scientific experiment? You? The Discovery Institute?

      There weren't any falsifiability experiemnts. The fossil data COULD NOT POSSIBLE disprove or prove macroevolution, because it is STATIC data. Macroevolution is a PROCESS. That is item 1.

      Your claim that static data cannot prove or disprove a theory is half right - theories cannot be proved, only disproved. But the wrong half is more to the point. If the fossil evidence were different, it could disconfirm evolution. There is no theoretical reason to prefer observations from instances of processes we directly observed over processes whose results we observe. In fact in some cases (e.g. quantum phenomena and some parts of anthropology) attempting to observe a process directly changes the outcome.

      There is no reason to prefer empirical evidence from contrived, human-induced experiments to empirical evidence from observations of the rest of the universe outside those experiments. In both cases, we devise a theory, make a prediction on the basis of that theory, and compare our observations to that prediction. The only difference is that in the case of experiments, we have to do some extra work to produce the circumstances where we can make that observation, albeit with the payoff that we can gather all the data we like. There is no reason that observing the Aurora Borealis is any less of a valid source of observation to compare against our predictions about the behaviour of charged particles and magnetic fields than performing experiments with a TV screen and a bar magnet.

      The offspring of close species are not reproducible organisms. If anything, they only prove for now that the chances of producing new species in that way is slim. DNA similarity or dissimilarity in that case proves nothing but microevolution.

      I think you may have misinterpreted my implication here. I do not think that new species are formed frequently by hybridisation between populations that have already diverged. Paleological and anatomical evidence leads us to believe that within the pairs of animals I mentioned, a common ancestor lived relatively recently. My point was that modern evolution predicts that in this circumstance there will still be some residual capacity to produce offspring. As there is general agreement that these animals are members of separate species, this is evidence for common descent (or in terms of falsifiability: were it not the case, it would be evidence against common descent). Distinct species having a common ancestor is a component of evolution, i.e. speciaition, and observations that confirm this could be falsifying evidence, were they otherwise.

      Item 3. You are arbitrarily extracting on phenotype component from the whole ensemble of phenotypic differences. It is well known that very similar function of the protein could be performed by quite different protein folds. So similarities or dissimilarities in this case prove nothing.

      What they show is that common descent is the determining factor in genetic similarity. This is a prediction of evolution, and if a pair of species whose inferred common ancestor lived longer ago were genetically more similar than a pair whose common ancestor lived more recently, this would be disconfirming evidence. I chose a convergent evolutionary pair to contrast the effect of descent on genetics with the effect of phenotype.

      a. This is not what I say. Microevolution (read: genetic changes within species) happens.
      b. I do n

    8. Re:MOD PARENT UP by mapkinase · · Score: 1

      Astronomy is not science - it is data collection. Geology is not science it is stone collection.

      Experiment is a repeatable and reproducible observation in the controlled environment. That is why some experimental scientific papers are recalled - because others could not reproduce the results. It is well-established practice in the real scientific community, not among charlatanes, grant-scavengers and con-artists.

      You claim... This is just blah-blah-blah. Quantum mechanics deals with real scientific experiments, that is why Itrust physicists working in that field. You do not understand. The data in discussion here is STATIC information about ALLEGED UNREPEATABLE processes. Two things which in combination bring more scepticism in regards to evolution than to many other more respected fields of what today is considered science.

      make a prediction on the basis of that theory there are no predictions in macroevolution "theory". Predictions assume falsifiability. There is none, because any meaningful experiments in this would involve time spans incomparable to feasible laboratory time spans.

      Aurora Borealis is exactly the same repeatable phenomena in the same place, same spectrum, same, same, same... That is why it is solid observation. The fact that you found any kind of bones does not prove anything except that you found some animal that you do not see now. Big deal! Species get extinct, species get created. But it does not give you answer how. Some species are closer, some species are more distant. And we know why: more sequence similarity _generally_ tend to mean more function similarity (only tend, by the way), and _generally_ vice versa. Chunks of alumnium and copper behave similarly because the corresponding atoms have similar sturcture of external electron orbitales, not because copper "evolved" from aluminum.

      If there were only Aurora Borealis as a visible consequence of the electromagnetic phenomena, that would not play very good for Maxwell's equations. And it is exactly why the television is possible, because technology is possible only as a result of application of a real science. You can apply microevolution alright, that is why we get whole $megabillion most profitable industry in US. But not macroevolution. There is absolutely no technological application of macroevolution, similar to the absence of useful technological applications of astrology and alchemy. Because it is not science. It is hand-waving and metaphysics. Real science produce real results.

      Paleological and anatomical evidence leads us to believe that within the pairs of animals I mentioned, a common ancestor lived relatively recently. You can believe whatever you want. Without real scientific experiments it is a religious belief, faith in Evolution the God, not scientific belief beyond reasonable doubt.

      modern evolution predicts that in this circumstance there will still be some residual capacity to produce offspring. So why nobody is working on that? Why do not we see any grants applied on producing new crossbred reproducible species? Tell me? When in the science relating protein sequence to its structure people are making theories, there is CASP. When in the science relating protein structure to protein interations people are making theories, there is CAPRI. Where are hordes of scientists involved in confirming this exciting ultimate prediction of evolution, the FIRST of its kind?

      All we see is metaphysical and tautological hand-waving.

      As there is general agreement I am not convinced. And plenty of physicists (if you compare the percentage of people who doubt macroevolution "theory" among different sciences, physicists will give you the higher propotion - and highest proportion, next only to mathematicians, of believers in God, by the way).

      Distinct species having a common ancestor is a component of evolution What observations? Bones again? We have already passed this point. I said my "tomatoes" on this non-scientific subjec

      --
      I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
  173. 48% of americans by Anonymous Coward · · Score: 0

    is this something to do with 48% of americans having never really evolved anyway

  174. Evolution is not a matter of scientific debate by Lengyel · · Score: 1
    Recently there was a panel discussion at the CUNY Graduate Center entitled, Intelligent Design under the Microscope. Eminent biologist James E. Darnell was the first speaker; he noted that among scientists, evolution is accepted as scientific fact and is not a matter of scientific debate. The evidence from microbiology is overwhelming: the same biological structures have been used repeatedly over millions of years. From his textbook, Molecular Cell Biology:

    Even scientists brought up in the evolutionary tradition have been surprised to learn in recent years just how closely the genes of different species are related. During evolution, genes have been conserved to such an extent that some human genes will function in a yeast cell and quite a few will function in a fly cell. Clearly, one feature of evolution is the maintenance unchanged of many aspects of cellular life even while great changes in external form and capability are occurring. Recent progress in determining the sequences of all the genes in a variety of organisms is revealing the subtle changes that have fueled evolution.
    1. Re:Evolution is not a matter of scientific debate by onlyfacts · · Score: 1
      Just because a few guys say something is not up for debate doesn't make it so. They desperately WANT it to be finalized and accepted since they are trying to have the last word on the subject. Problem is, they just can't seem to tie up the loose ends on their idea of macro-evolution.

      Used to be that the discussion was finalized on all the "junk" DNA. Guess what, someone decided it wasn't, pursued it and found out that a bunch of that "junk" DNA was very important. How many times will atheistic scientists try to shout down others who don't salute their brilliance? I guess the answer is, as often as they have to until we all just check our brains at the door.

    2. Re:Evolution is not a matter of scientific debate by ColdWetDog · · Score: 1

      Just because a few guys say something is not up for debate doesn't make it so. They desperately WANT it to be finalized and accepted since they are trying to have the last word on the subject. Problem is, they just can't seem to tie up the loose ends on their idea of macro-evolution.

      Slow down Cowboy! You're digging a pretty big ditch here. You seem to think that scientific en devour strives to create a "final" and "accepted" view of (in this case) evolution. Nothing could be further from the truth. A post or two above, I suggested you read some works by Stephen J. Gould concerning the intellectual and experimental underpinnings of some of the areas of evolutionary theory that are being actively researched. I think you should take a few steps back on understanding tree and start by brushing up on just what the scientific method tries to do. Finality ain't in it.

      --
      Faster! Faster! Faster would be better!
  175. Re:Since when do you get to decide who is Christia by Dread_ed · · Score: 1

    I am saddened that your "Christian" friends treated you that way. Souds like they were trying to guilt you into staying in the cult. Heinous and sick if you ask me.

    Just remember that one of the basic tennents of Christianity is that mankind is imperfect and subject to what we will call wishy-washyness. Someone who declares themself a Christian, and then is caught doing things that are decidedly un-Christian, is only a living example of the doctrines of the Bible. Their actions after they do these un-Christian things reveal their strength of character and recognition of the ideals they portray as valuable to themselves. It is easy to point fingers and scream "hypocrite." It is much harder to acknowledge that all people are posessed of a nature that is fraugt with imperfections and a yearning to do what is right that is many times unfulfilled. It is even harder for people to acknowledge this knowledge in a deep and personal way.

    Even more interesting is the fact that other people will reveal their character in their reaction to that transgressing person. In ohter words, what you think about someone else (especially someone else in an all too embarrasing human situaion) says more about yourself than it does about them.

    --
    When the only tool you have is a claw hammer every problem starts to look like the back of someone's skull.
  176. rant by SnappyTurtle · · Score: 1

    If you apply some logic to this then I'm sure one question might pop into your head - Why is this so? Surely its not for lack of scientific proof. If we rely on science to create our template for truth, why would we ingnore it and futhermore, ignore it in favour of theories that imo have absolutely no substance or base in reality. This is not a matter which can be blamed on science because science has done and continues to do it's bit. Information is power and power is wealth and religion has produced some of the most powerful and wealthy people the world has ever seen. Think about the 'Gatekeepers'. There are many, many, reasons why science would be brought to it's knees; a knowledgable society is not one of them. This unforunate situation is something that has to be addressed more forcefully by the global scientific community. The media had portrayed science with a rather unfavorable image for a long time and because of this kids think its dumb. Personally, I'm hoping Toffler was right and that we'll come out of this brushing the dust off our jackets. Rant over.

    --
    Don't set your machine up so that you can't pull the plug.
  177. Re:Since when do you get to decide who is Christia by javabandit · · Score: 1

    But what I was responding to was the claim that only occasionally going to Church and not 'practicing' in a daily, public way means you're not Christian (or Jewish, or whatever). More to the point, if they "truly believe" that being Christian can mean occasionally going to Church, celebrating Christmas, and believing in God in a non-confrontational kind of way, more power to them... erroneus claimed that "most people who call themselves Christian don't practice it in their daily lives and in essence, don't actually or truly believe."


    ah ok, my bad. I see the assertion you are challenging. "Most Christians aren't really Christians." I agree, a little too broad and misguided.

    I'd probably have been more comfortable if erroneus made two separate assertions:

    1) Most Christians believe that they themselves are being good and true Christians.

    2) Most non-Christians believe that Christians do not act the way that "true" Christians should act.

    Again, totally unsupported and subjective. However, it adds in the point that everything is relative to the observer. Rather than everything being absolute as was originally asserted.
  178. *snort* by jpellino · · Score: 2, Insightful

    "1: The existence of God is proven (or disproven) definitively to every dead human being."

    You're kidding, right? Because this would presuppose awareness, if not conscoiusness and self-awareness on the part of a human after death, for which you have zero - and I do mean zero - evidence. No one, not even you, can prove that a dead human being is anything more than compost.

    Your argument starts off with an unprovable statement. A glib and clever-sounding one, to be sure, but unprovable.

    --
    "Win treats sysadmins better than users. Mac treats users better than sysadmins. Linux treats everyone like sysadmins."
    1. Re:*snort* by gordo3000 · · Score: 1

      but I bet what he left out was:

      the existence of a CHRISTIAN GOD is .....

      the Christian religion supposes awareness after death and therefore once you die you will know(or not care) if there is a Christian god. as most popular religions are similar in their supposition of consciousness after death, most religions' gods have there existence proved or disproved to you at death.

    2. Re:*snort* by socerhed · · Score: 1

      I believe what he is trying to say is that if it was disproven, it would be disproven BECAUSE of the fact that they wouldn't be aware. Whether or not they are aware, the dead still "know" is the beyond life, be it nothingness or otherwise.

      --
      LostHobo.com
      Soup Kitchen of the Internet
    3. Re:*snort* by Planesdragon · · Score: 1

      No one [alive] can prove that a dead human being is anything more than compost.

      Yes, exactly.

      Once you're dead, you can't bring proof back to the scientific community. But you definitely have zero doubts about God's existence, one way or the other.

      Your argument starts off with an unprovable statement. A glib and clever-sounding one, to be sure, but unprovable.

      It's not an argument, it's a simple statement of logical truth. It's entirely unrelated to the rest of my comment.

  179. So Evolve by Roane · · Score: 1

    The handy thing about natural selection is that eventually, everything will turn out alright. Just probably not in your lifetime.

    1. Re:So Evolve by Dunbal · · Score: 1

      The handy thing about natural selection is that eventually, everything will turn out alright. Just probably not in your lifetime.

            And the cute thing about evolution is that we are all directly descended from that first cell, in (by definition) an unbroken line of succession. Not only are you my "brother", but so is the tree in front of your house, or your pet goldfish.

            Everytime you kill something you are breaking a line of inheritance that is billions of years old. Food for thought. Perhaps we shouldn't break them in vain.

      --
      Seven puppies were harmed during the making of this post.
  180. Does this mean? by Derosian · · Score: 1

    That there is 52% of the Slashdot community that is modded as troll's?

  181. Ok, lets check it by Anonymous Coward · · Score: 0

    Do you believe in some God theory? -- Vote: http://maxextreme.googlepages.com/yes.htm
    or in some evolution theory? -- Vote: http://maxextreme.googlepages.com/no.htm

    If you vote twice, it will count just one time. If you vote both, well, thanks for the visit :)

    I will publish the results in about 12 hours.

  182. I know the answer by squarefish · · Score: 1

    The truth lies in peanut butter.

    --
    Creationists are a lot like zombies. Slow, but powerful and numerous. And they all want to eat our brains.
  183. Not exactly flamebait if you think about it: by Penguinisto · · Score: 1
    Though apparently lots of folks thought the parent poster was flamebait, and the way he stated it was provocative, there is something in there that cannot be easily dismissed...

    (bear with me here - but first, set aside your ideology, whatever it may be...)

    The vast majority of atheists are pro-choice, yes? The vast majority of fundamentalist type Christians are pro-life, yes? If I am wrong in these, please say so.

    If the atheist demographic practices abortion/contraception regularly, and/or prefers a heavily-involved career to childbirth and family? The progeny will comprise a smaller pool of humans than those born of those that believe in having large families and not even bothering with contraceptives (let alone abortion).

    Note that "fittest" does not necessarily mean "most intelligent", or "what ideology I think is best", or anything beyond "most able to survive, reproduce, and therefore increase a given species' numbers".

    This alone is either proof of natural selection at work - or it is proof that it is not, if you assume "fittest" to be "best" in more than just the reproductive aspect. It doesn't matter whose laws (natural or supernatural) you believe to be supreme here - it is a simple chain of causation that I would actually love to see someone try to refute, instead of merely recoiling in fear and anger and shouting "flamebait!".

    /P

    --
    Quo usque tandem abutere, Nimbus, patientia nostra?
    1. Re:Not exactly flamebait if you think about it: by Anonymous Coward · · Score: 0

      And all of these arguments are stupid because belief in evolution or creation are, like anything cultural, not inborn but rather learned. Plenty of my friends (all of whom believe in evolution) have staunchly religious parents who reject evolution out of hand. But they have learned about evolution and chosen to accept it. What we really have to fear isn't creationists having kids, buit rather creationists being in charge of the education system and not allowing people to be exposed to the ideas behind the theory of evolution.

    2. Re:Not exactly flamebait if you think about it: by Penguinisto · · Score: 1
      "And all of these arguments are stupid because belief in evolution or creation are, like anything cultural, not inborn but rather learned."

      But there's the problem - you assume that because learned behaviors are different from genetic/inborn behaviors, this will somehow negate the final result, which it will not.

      /P

      --
      Quo usque tandem abutere, Nimbus, patientia nostra?
  184. Failure of Newspaper / Slashdot Editors? by abug · · Score: 1

    It appears the 48% statistic given by slashdot and the MSNBC / Newsweek article may have been transcribed incorrectly by the journalist summarizing the data. According to the poll data tables (http://www.msnbc.msn.com/id/17875540/site/newswee k/) (see table 13) linked from the original article, the 48% is actually the number of people who said evolution is 'Well-supported.'

    Also from the same table:
    --39% think evolution is 'Not well supported.'
    --13% 'don't know.'

    But this doesn't change my opinion that it's still a rather poor poll question.

  185. Re:Article claims tolerance for atheists on the ri by miro+f · · Score: 1

    I was wondering why there was suddenly an influx of "double redundant posts" on slashdot.

    --
    being vague is almost as cool as doing that other thing...
  186. laugh today, die tomorrow by Anonymous Coward · · Score: 0

    you leftists laugh at such claims, and you may be right, but at the same time you guys coddle the islamic front. in an islamic state if you held evolution up as fact you'd be 100% dead. these same muslims you sympathize with are the ones who will be sticking a gun in your back and forcing you to bow to allah or they'll start pulling the trigger.
     
    poke fun at christians... at least they're not executing people in public like it's civil.
     
    you faggot bitches will pay the price if you do not wake up today.

    1. Re:laugh today, die tomorrow by rtrifts · · Score: 1

      Execute people in the street? Gee - good thing those Religious freaks have never been a part of that huh?

      I'm guessing this wing-nut statistic has a lot more to do with the fact that 34% of Americans self-identify as conservative or evangelical Christians.

      In the part of the industrialized world that ISN'T crazy, (meaning - basically everywhere else in the West) it's a very different story.

      --
      .Robert
    2. Re:laugh today, die tomorrow by Dunbal · · Score: 1

      poke fun at christians... at least they're not executing people in public like it's civil.

            Frankly after seeing my ex wife turn into a born again nut (and putting up for her drivel for almost 10 years), I'm willing to wager that most "Christians" would be all for stonings and public executions, only they don't have the guts to say it out loud.

      --
      Seven puppies were harmed during the making of this post.
  187. Makes perfect sense by bumptehjambox · · Score: 1

    About half of our country rejects evolution, some going so far as to say Creation is fact and the Earth is 10,000 years old. About half of our country voted for Bush. About half of our country is stupid. Makes sense. As long as the North kept the superior military and made the big decisions (the south just enough to defend itself,)I'd say we should split back up. As a bonus, the South would have to deal with Mexican immigration, and we could wipe our hands clean, blame everything on the South and try as hard as we can to clean up our image internationally. We'd definitely have to get props for giving these morons the ax.

  188. Re:48% of americans by askegg · · Score: 1

    When I fist read the title I thought it meant "48% of American's refuse to evolve". I am not sure this erroneous misreading is actually that wrong after reading the storey.

    --
    I don't make predictions, and I never will.
  189. They vote by brit74 · · Score: 1

    Come on, who cares? Let people be ignorant. It's not like bringing people of below average intelligence or fundamentalist mindset into the scientific fold is going to make them valuable contributors. It'll just be a new type of ignorance to deal with. Let them be.

    They vote, they help elect our leaders, they get on school boards, they affect what laws get enacted in our country.

  190. ...and apparently English as well by Roger+W+Moore · · Score: 1

    Majority (noun): the greater part or number; the number larger than half the total.

    Just in case there is any remaining confusion to have a majority you have to more that 50%. In the case in question you have a majority of Americans being non-Christian.

  191. Subject Pool for Poll by freecorbinj · · Score: 1

    Something that jumped out at me when reading the article was that the subject pool was only 1,004 people. I will admit that I am no statistician, but 1000 people sounds quite a small number to represent almost 300 million people. The location of the people polled could have a drastic effect on the results. If you polled 1000 people living in the bible belt, the results would be vastly different than, say, someone in San Francisco or something. Anyway, correct me on this if I'm wrong on this, it's just that this little tidbit stuck out to me.

  192. How stupid by JimDaGeek · · Score: 1

    Who exactly was polled and how many were polled? Claiming 48% of Americans is just stupid. Did someone poll close to 150,000,000 Americans? I doubt it. Hey, I can come up with a "poll" that show that 80%+ of Americans support affirmative action. All I have to do is just poll mostly black communities. Heck, I can even come up with a poll that shows that XX%+ of Americans want the Mexican border open. I just have to poll mostly Hispanic communities.

    I cannot believe how so many /.ers responded to this FUD. I know many Christians that don't believe that 10,000 year old crap. I am one of them. I am a Christian and I believe the earth is very old and ... I believe that evolution is a natural part of the world/Universe.

    Faith is faith and science is science. Many religious people can keep them separate.

    Hey, I have a cool "poll". I asked 10 /. users if they have ever had sex. 8 out of 10 said no. So I guess I can say from my "data" that 80% of /. users have never had sex?

    I personally hate when people do "polls" to try to push their agenda.

    There are Muslims out there that believe if they die a martyr they get to go to "Paradise with 72 black eyed virgins". In Hinduism, people believe that when they die they will be reincarnated. Christians believe in life after death where you live for eternity with God when you accept Jesus as your saviour. Jews believe similar, though with out Jesus and they believe to live by laws passed down by God. There are religions where people think it is wrong to even kill an ant. Atheists believe that when they die, they are gone for ever and will just decompose.

    So, my point is that there are many different beliefs in this world. It would be very easy for me to construct a "poll" to make any one of those belief systems look dumb. Get over it. There are billions of people and guess what? We have many different beliefs.

    --
    General, you are listening to a machine! Do the world a favor and don't act like one.
  193. This is a problem in every society. by Anonymous Coward · · Score: 0

    One cannot expect to educate the masses in every scientific invention and expect them to develop mathematical prowess. That is how it works. You can take any society, any nation as an example.

        Thus far, USA had German knowledge and USSR's competetion to encourage its citizens forward (Dont forget to credit Nazis for the road system, nukes and v2 rocket tech). Now the latter has vanished and everyone in the world seems to have gotten the former.

          Cradles of Civilization are waking up. Yes, those are India and China. Long kept in dark by colonial forces and the weight of their own stupidity. How are they doing it? Self-realized individuals playing role in grass roots. Just like el-stupido baptists in southern USA, but for opposite reasons.

          America has a long way to slide down and I believe American intelligensia are too smart to let that happen, but who knows? This is one step in that direction. Democracy is a bitch.

  194. Think evolution is heresy? Try Quantum Mechanics! by moly · · Score: 1

    Religious zealots attack the Theory of Evolution because they think they understand it. The premises can be simplified (with requisite loss of meaning of course) to the point where the average uneducated person can poorly paraphrase its basic premises. Clearly, it disagrees with both of the two (yes, two) Genesis creation myths-- the one where "Man and woman, he created them," and the one with Adam created first, and Eve out of Adam's rib.


    Take this person, and try to explain the Stern-Gerlach experiment, which first demonstrated the existence of quantum phenomena. I've had more physics professors explain it inadequately than explain it well. Try to explain the twin-slit photon experiment. Try to explain the non-local nature of quantum phenomena, or Heisenberg's Uncertainty Principle. Explain how a Feynman Path Integral works. I won't even touch the General Theory of Relativity.


    The people who cannot accept the Theory of Evolution would launch a pogrom over the Second Law of Thermodynamics, if they understood it. Physics contains dozens of premises every one of which is much, much scarier than anything in biology. They pick on Evolution because they think they understand it. Once the Nazis twigged to Quantum Mechanics, they began clearing out the universities and filling the concentration camps. Don't think the Religious Right, were they smarter people, wouldn't do the same.

    --
    "Indeed, it is wise never to consider any form of electronic data as final." --Arnold Robbins
  195. Solution to Americas stupidity by Anonymous Coward · · Score: 0

    Remove all warning-labels and... :

    A) (for Darwinists) ...let the fittest survive.

    B) (for fanatics) ...let God sort them out.

  196. The Article Is Wrong? by yls07 · · Score: 1
    According to the actual survey linked from TFA, this is the actual survey question and response data (sorry for no table formatting):

    13. Do you think the scientific theory of evolution is well-supported by evidence and widely accepted within the scientific community?

            Well-supported Not well-supported Don't Know
    Current Total 48% 39% 13%

    Evangelical Protestants 25% 63% 12%
    Non-Evangelical Protestants 57% 24% 19%
    Catholics 58% 33% 9%
    Agnostics/Atheists 73% 18% 9% From this information, it would appear as though 48% of Americans think evolution is BOTH well-supported AND well-accepted in the scientific community. (The question, of course, is terribly constructed because it conflates two potentially divergent beliefs.) 39% believe EITHER it's not well-supported by evidence OR it's not well-accepted in the scientific community, and it's easy to see how propaganda would make it easy to influence people on one of those two variables.

    Certainly, it doesn't seem to support the proposition from TFA, that "Nearly half (48 percent) of the public rejects the scientific theory of evolution".

    Is it possible MSNBC/Newsweek didn't get their facts straight? Or am I missing something?
  197. According to Garrison by mixxu · · Score: 1

    "You're the retarded offspring of five monkeys having butt sex with a fish-squirrel."
    Seriously though, I'm a believer (of evolution).

    1. Re:According to Garrison by Dunbal · · Score: 1

      Seriously though, I'm a believer (of evolution).

            Fortunately evolution doesn't require your belief, any more than gravity does.

      --
      Seven puppies were harmed during the making of this post.
    2. Re:According to Garrison by mixxu · · Score: 1

      I'm not sure if anything requires belief. I believe I am entitled to my believes.

  198. Rejection by simpl3x · · Score: 1

    Will evolution dismiss the same 48%?

    1. Re:Rejection by Profound · · Score: 1

      The religions that have survived over the last few thousand years are the ones that had specific policies to increase the numbers of their flocks. The pro-birth control, non-recruiting religions were overwhelmed and replaced.

      The amount of religion today says that the uncaring forces of natural selection favours it.

  199. Slashdot... Wake Up Slashdot... by Anonymous Coward · · Score: 0

    Did you read the damn summary? It's a poll by *NEWSWEEK*. I mean, there's no POSSIBLE way there's a selection bias here, right? This means CRAP, and nobody's pointed it out (at least nobody who got moderated up)... everyone's just eating the shit up. You're all doing exactly what you're condemning - just believing it because they're saying it, because some truly random (or not) survey group says it.

    We all know Slashdot is church for atheists (hear me out!), but let's at least exempt the Catholic Christians & other denominations and religions that do believe in evolution and science from your elitistness, huh?

    God knows it's terribly difficult to comprehend that some believe that our intelligence and ability to barely decode the complicated system of biology, chemistry, physics, time and etc. in which we live, of which we have not even explored 0.00000000000000000000000000000000000000000000001% (including any substantial depth into our own planet, let alone the other billions of galaxies), is somehow evidence that a more intelligent being created it...

    And that gabillions and gabillions of fucktons of matter and energy go boom & go crunch & go boom & go crunch every n billion years may not just occur for no purpose whatsoever... the oscillating universe theory is in this week, isn't it?

    Because, you know, as oppose to the awful fairy tale religions of the world, science has NEVER changed its stance on anything from day one and has the integrity of an empty vacuum... it was really all said & done when they recreated the Big Bang in that lab at MIT that one time.

    And humans are surely 100% capable of observing all of the empirical evidence from all of time and will transcend to another dimension before the next Big Crunch... I mean, despite our ability to personally observe a small fraction of a percent of the energy spectrum at any given time... yeah.

    Horrible generalization, right? But that's how atheists come off to us. Does that sound like anything you've condemned lately?

    There's an awful lot more of us Christian scientists than the world's braindead media money agenda will have you believe. I'm sorry you've had such a terrible experience with these "in-your-face" (sometimes violently so) young-Earth creationist people (and I say that with the utmost of sincerity) but that's not all of us!. It's the same tiny minority that got everyone in trouble in school and ruined your 10th birthday party.

    If we're going to place stock in this poll, let's at least observe that 49% of us who accept Evolution also believe in God? The other 3% who are atheists must all be on Slashdot - I swear they're as abundant as water here, while believers in God here occur about as frequently as I have sex. And if you believe I'm a hunky stud... well, I'm not going to argue with you...

    It's most certainly not inconceivable that if there is "satisfactory" empirical proof of God, we haven't discovered it yet - NOBODY has EVER undoubtedly disproved God at any level (nope, not even your priesteist Dawkins, who indeed acknowledges the possibility), and for those of us who gain comfort, wisdom, strength and will from our own relationships with God (we do have this thing called undeniable personal evidence which, when encountered, does not leave science or otherwise as some requisite for faith), it's a necessary component of science.

    If you want to flame, shoot. Please do NOT misquote any of my post; don't throw in "Bible" instead of "God" - I don't believe that if God dropped a completely accurate specification of the universe along with a wormhole traveling Messiah on the middle east thousands of years ago, that they'd have had anything to do with it.

    If you're any sort of respectable programmer or mathematician, and likewise a hating atheist, you better never buy The Art of Computer Programming... it was written by one of the religious "sheep". Odd, isn't it? Such a smart man...

    Now go ahead and mod this post to FSM hell. In case you find it anything but a steaming pile of flamebait, just remember that AC posts are not meta-moderated... nor is "Underrated"...

  200. MOD PARENT UP by notwrong · · Score: 1

    This is a great, concise statement of the legitimate basis for scientific theories, and the best I've seen in this thread at that.

  201. Irrelevent? by Tony · · Score: 1

    People are not going to stop inventing, trading and banking simply because they disagree with someone else about a purely abstract idea.

    Many inventions, especially in medicine, rely on the *fact* of evolution. So, though inventions will continue if everyone believed the Lord God created the Universe 10k years ago, and evolution is a deception of de debil, many things will *not* get invented. Life-saving things.

    The rejection of the proven, objective epistemology of the scientific method will lead to ignorance and superstition.

    I do now say people have to give up their faith. But I suggest they might want to give up their belief.

    --
    Microsoft is to software what Budweiser is to beer.
    1. Re:Irrelevent? by MSTCrow5429 · · Score: 1
      Many inventions, especially in medicine, rely on the *fact* of evolution.

      Which medicines rely on a specifically Darwinian theory of evolution? Evolution in and itself, such as mutation of strain A into strain AB (note it is still a sub-species of strain A), is not something either side contests.

      --
      Slashdot: Playing Favorites Since 1997
  202. Dumb & Dumber by vorlich · · Score: 1

    I cannot help but be reminded by what Alberto Moravio said:
    "The ratio of literacy to illiteracy is constant, but nowadays the illiterates can read and write."
    Alberto Moravia, The Observer, 1979
    and while we're on the subject of Italians, let's never forget that Gore Vidal advised allowing the Bible Belt to teach fundamentalism and creationism on the basis that they would disappear within two generations.
    Galileo could happily remain under house arrest in Florence while seafarers sucessfully discarded charts based on Ptolemaic systems and navigated the Earth using Galilean methods.
    Why was Britain so succesful during the industrial revolution? It never allowed religion or ignorance to get in the way of making money using science.

    --
    Posts, MyBio or Sig, may contain satire, sarcasm, bolded nouns be sardonic or even witty & be Church of SD
  203. Be smart... by josh_db · · Score: 1

    Listen! Genesis is in NO WAY a basis for history! While it may have some moral basis in it's stories (i.e. Noah) the earlier in the Old Testament it is, the less reliable it will be. Why? Simply because of oral tradition. Most of the Bible as we know it were passed down by word of mouth until writing it down became a custom, creating the Torah.

    Science is a good a right practice, from which we get things like the computer, the air conditioner, shampoo, etc. etc.

    Don't be idiots. I, being a Christian myself, don't accept Genesis in it's entirety. It doesn't make sense, and unless God tells me what happened or simply to believe Genesis, I'll go on my way believing in what matters to me and my faith.

    1. Re:Be smart... by Anonymous Coward · · Score: 0

      I, being a Christian myself, don't accept Genesis in it's entirety.

      Too bad the love of Christ can't teach you to use the correct form of "its". Tool.
  204. Catholic Church... by Anonymous Coward · · Score: 0

    Actually... the Catholic Church has pretty much said "The question may never be finally settled" so they have laid out a ground work for what is acceptable to believe. You can read more here: http://www.catholic.com/library/adam_eve_and_evolu tion.asp

  205. I wish I could mod down that by aepervius · · Score: 4, Insightful

    You are a stinking animal. Get over it. Love (the passionate one you feel in the first 5 years of meeting somebody) can directly be linked to hormons delivery in the brain. This 5 years periods can definitvely be traced to the divorce rate being higher at the end of it, and the drop off when that type of neurotransmitter drop down in level. As for the "longer" love I would not be surprised that there is a similar explanation based on neuron pathway created during those 5 years. Remmember the brain learn by repeating.

    Yes this is all chemistry despite you prefering to think you have a soul and be a "higher" being than the rest of the animal, in reality you are a mamal and you simply go in a complexer "rut". Sorry to break it to you , you aren't "superior" and "chosen".

    --
    C. Sagan : A demon haunted world:
    http://www.amazon.com/gp/product/0345409469/
    visit randi.org
    1. Re:I wish I could mod down that by servognome · · Score: 1

      You are a stinking animal. Get over it.
      Why stop at animal. As you say we are a series of chemical reactions; we're no better than how laundry detergent gets out stains.
      Which makes the whole converstaion meaningless in the grand scheme of things, all fates are predetermined since the beginning of the universe.
      --
      D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
    2. Re:I wish I could mod down that by Hatta · · Score: 1

      Why stop at animal. As you say we are a series of chemical reactions; we're no better than how laundry detergent gets out stains.
      Which makes the whole converstaion meaningless in the grand scheme of things, all fates are predetermined since the beginning of the universe.


      Entirely true. Yet because they're meaningless doesn't mean they're not useful. We will continue talk, and figure things out, because we like to. We will continue to fall in love because it makes us happy. We will continue to look into the sky and see beauty, because our brains are just wired that way. We will continue to live because that's the kind of beings we are. Acknowledging the reality of our existence takes nothing from that.

      --
      Give me Classic Slashdot or give me death!
    3. Re:I wish I could mod down that by Phyvo · · Score: 1

      On the contrary, it does. If you really believe that life is meaningless you will feel like your life is meaningless. Then the only time you can have a "meaningful" life is when you forget that you don't believe in "meaningful" lives. To cheer up a suicidal person you wouldn't say "Don't worry, all these feelings you're having right now are just chemical reactions in your brain." To say that these ideas shouldn't, or won't, affect human behavior is silly. If it doesn't it's because no one actually believes them.

    4. Re:I wish I could mod down that by Hatta · · Score: 1

      You can say that, but I don't think it's true. Of all the atheists and christians I've known, I don't think either group is any happier or sadder than the other. Atheists are generally able to find the meaning they need in their lives without resorting to magic. Spending time with your grandchildren makes you happy, whether you believe in god or free will, or not.

      --
      Give me Classic Slashdot or give me death!
  206. Really? by alisson · · Score: 1

    Only 48% think that? I thought it was a lot higher... I mean, there are a lot more stupid people than that :)

  207. Idiocracy by RKBA · · Score: 1

    Depressing polls like this make me think that the evolutionary scenario portrayed in the movie "Idiocracy" is already happening. :-(

  208. Who modded that insightful ? It ain't. by aepervius · · Score: 1

    "intentionally conceived without basis in reality" godS with a small g and a big S, as well as spiritS, ghostS, comes under multiple form and mythos of creation, and are ALL unproven if you use only logic and evidence gathered in the world. ONLY if you use faith and circular reasonning can you prove gods exists. Let me use 2 examples : can you prove the existence of shiva , brahama, and vishnou to a , say, western christian ? Can you prove the existence of the christian god to , say, a brahamist or an atheist ? If in BOTH case you can only bring them to an agreement of possibility, then the existence of what you believe in is 100% UNPROVEN and can really be qualified as imaginary from somebody not being in your faith.

    --
    C. Sagan : A demon haunted world:
    http://www.amazon.com/gp/product/0345409469/
    visit randi.org
  209. Given that the primary explanation... by Anonymous Coward · · Score: 0

    ...amounts to "well, it just kinda happened that way by accident" can you wonder at people looking for a better answer?

    At least when you have an unpredictable super-intelligent deity mixed into the situation, the response "I don't understand" is quite rational. Given said superintelligence, one should be expecting to walk face-first into that situation from time to time, and also to find interesting explanations for things "being so" which really don't fit into the randomness situation very well at all.

    The next step to understanding creationists is to realise that they come in a kind of spectrum, from someone who "just believes" as ardently as the biologist who recently claimed evolution for a feature which could not have evolved, through to someone who will lug out reams of scientific reports and go through them line by line to show you each startling discrepancy. One will walk through the Grand Canyon and say "Ain't it beautiful?" where the other will be pointing out sandstone formations with features which are entirely incompatible with gradual emplacement.

    An important step in understanding evolutionists is to realise that they're subject to religion, too. They firmly believe that things could not possibly have come to be in any other way than the theory they currently believe in.

  210. welcome to the new dark ages by jt418-93 · · Score: 1

    Welcome to the new dark ages. now we have the inquisition with computers. instead of witches, we have terrorists.

    burn the terrorist! he turned me into a newt!

    im so ashamed we have let our country become what it has. and still it continues.

    --
    -.no
  211. I have always belived in evolution but... by koutkeu · · Score: 1

    Evolution implies natural selection, and with that many stupid people alive, i am starting to think there is ground to invalidate the evolution theory. I still have faith tho, hoping few hundread years will fix that.

  212. This must be the 48%... by eremitic · · Score: 2, Insightful

    This must be the 48% that also believe Abass Ayeni Dantate, a very wealthy Nigerian, has over $35 million waiting to be transferred directly to their bank accounts.

    --
    Warning: Could be fatal if taken seriously
  213. Why are some people so insecure? by aristotle-dude · · Score: 1
    Why are so many people so concerned that not everyone believes the same thing? I find it kind of amusing that the same atheists who claim someone is always trying to shove religion down their throat seems to be bothered that not everyone is 100% convinced that the current theories of evolution are correct.

    In a pluralistic and democratic society, differences of opinion and belief should not only be tolerated tolerated but encouraged. Quite frankly, some of you staunch supporters of Darwin sound more fanatical than the biggest religious fanatics in the middle east. Get over it and live your own lives.

    --
    Jesus was a compassionate social conservative who called individuals to sin no more.
    1. Re:Why are some people so insecure? by Shados · · Score: 1

      Science only provides models to explain thing, and real scientists will never shove anything as facts. Hell, seems more and more like "what goes up must go down" (when speaking about earth's gravity field) ain't even all that true, what with all the theories about dimentions and such...

      Humans, in general, are retards. Atheists, agnostics, christians, islamics, whatever. Science works in a way to accomodate that: a model is never final, and is only there to explain things until we find a better model. That ALSO includes, that if someday, as long as real science is applied as such, if we figure out that it IS indeed a supreme being that is responsible for everything, it WILL replace the evolution model. It implies a "we're right, until proven otherwise".

      Religion, however, by definitions, implies a "We're right you're wrong. And everyone who disagrees with us will rot in hell (or whatever, depending on the religion) Pwned." idea. And that is, in my opinion, quite disturbing, as it is an incredible display of ignorance, and intolerence.

      Good scientists might push evolution a lot, but its not like the scientifict community just stopped studying the theory. "We're right, okie, we're not, its over. NEEEEEEEEEEEEXT". Religious communities, however, usually does.

  214. Those numbers are probably exaggerated by Animats · · Score: 1

    About 44% of US adults say, when polled, that they go to church once a week. About 20% actually show up. People thus self-report much higher levels of religion than they actually practice. Polled numbers should be derated according.

    The 2001 National Survey of Religious Identification, the largest study on this in the last decade (113,000 respondents) came up with the following self-identified stats, for religions with 0.1% or more market share:

    1. Christianity: 76.5%
    2. Nonreligious/Secular: 13.2%
    3. Judaism: 1.3%
    4. Islam: 0.5%
    5. Buddhism: 0.5%
    6. Agnostic: 0.5%
    7. Atheist: 0.4%
    8. Hinduism: 0.4%
    9. Unitarian Universalist: 0.3%
    10. Wiccan/Pagan/Druid: 0.1%

    Major trends are that "Secular", "Islam", "Buddism" and "Hinduism" were all up over 100% since 1990.

  215. Disbelief Does Not Mean Lack of Intelligence by apharmdq · · Score: 1

    It's kind of disappointing to see so many people assume that just because one does not believe in evolution, they're stupid or poorly educated. This certainly isn't the case, as a majority of those people are quite intelligent and do well in school and in the field as well. For example, I know of several Christian families that have home-schooled their kids, and while they've taught them of the principles of evolution, those kids do not believe that evolution is a proven fact. Yet all of these kids are quite smart, the younger ones having been taught advanced concepts like calculus and advanced physics in their early teens, while the older ones have been accepted to some pretty prestigious universities. And it's not just the home-schooled kids either. I've seen plenty of public-schooled kids who don't believe in evolution do the same. Granted this probably doesn't apply to everyone who disbelieves evolution, but there is enough of a majority that they can't be generalized in that manner.

    And really, does the belief of whether evolution is a fact or not really affect much today? I mean, someone who disbelieves it is probably not going to encounter difficulties living his life, even as an intellectual. Whether evolution actually occurred or not doesn't affect the fact that humanity is here today.

    But more importantly, this whole argument is really causing a lot of people to consider others "second class citizens" of a kind, just because they don't believe what everyone else does. Speaking only for the US here, our country was founded on the idea that people would be free to believe what they wanted to believe, whether it be a particular sect of Christianity, Mormonism, Buddhism, or even Scientology. Heck, people don't even have to believe in anything and that's just fine as well. (Not to say that the US is alone in this regard, as there are several other countries that follow this ideal as well.)

    Let's not judge people's intelligences by what they believe . . .

    1. Re:Disbelief Does Not Mean Lack of Intelligence by onlyfacts · · Score: 1
      I agree that believing or not believing evolution is not a measure of intelligence. In reality it really is a measure of faith. I do believe it is important that one know WHY you believe or do not believe in evolution. The reason I believe this is an important debate is that the scienific community as a whole wants to disprove the need for belief in a God. Proving that God could not exist then means you don't have to have faith in anything and therefore I really don't need to have any morals or be accountable for my actions.

      I don't have enough faith to believe in macro-evolution. The Borel number has been vastly exceeded on the probability of macro-evolution occuring (even just the simple aspects of macro-evolution) and therefore also logically not reasonable to embrace or pursue.

    2. Re:Disbelief Does Not Mean Lack of Intelligence by Cybrex · · Score: 1

      Wait. Are you seriously claiming that the intention of "the scientific community"- their purpose- is not to better understand the universe, but rather to find an excuse to be immoral and unaccountable? Is the patent absurdity of your claim not obvious to you?

      A few things to bear in mind. A) Scientists are a contentious lot, and getting them to all secretly conspire for the sole purpose of moral unaccountability is fodder for very, very bad fiction. B) Many scientists are religious. Even some evolutionary biologists. C) If you look at crime statistics the correlation between religiosity and ethics is inverse. Atheists are far less likely to be criminals than religious people are.

      --
      Boundless Expansion, Self-Transformation, Dynamic Optimism, Intelligent Technology, Spontaneous Order- BEST DO IT SO!
    3. Re:Disbelief Does Not Mean Lack of Intelligence by loxosceles · · Score: 1

      And really, does the belief of whether evolution is a fact or not really affect much today

      Admittedly, the problem is not belief in evolution per se. My problem is the associated ignorance, stupidity, etc. that correlates with it, and its large negative impact on social and international policy.

      Evolution is a common litmus test for scientific literacy. People who are scientifically sophisticated understand that evolution is a complex theory, and that while there are some gaping holes that seem to defy our grasp, enough of evolution makes sense and has scientific backing that most of them would agree, in a poll, with the statement that evolution is widely supported and has broad scientific support. Creation of the first cell through random congregation of the necessary components is certainly mind-boggling to me, and I can't quite imagine how something that's not similar to a cell can gradually mutate into a cell. Nevertheless, ask me if I think there's broad support and evidence for evolution, and I'll answer "yes" with no hesitation.

      In particular, creationists' claims about the fossil record are bogus. It's plausible that merely a few tweaked genes cause significant structural differences. Thus, there may not even be intermediate species (with intermediate skeletal structure) in the sense that creationists and some cautious scientists intuitively expect there to be. Intuition is very often wrong.

      Let's not judge people's intelligences by what they believe . . .

      So if I believe truly and honestly in the FSM, you can't judge me for that?

      If I believe truly and honestly that the world is run by a gnome in Cygnus X-1, you can't judge me for that?

      You want major organized religions to be insulated from ridicule. Why?

  216. HYPOCRITES!!! by Anonymous Coward · · Score: 0

    So... 48% of Americans believing in Biblical Creationism is evidence of scientific ignorance, but "X" percent believing in man-made Global Warming a la "An Inconvenient Truth" is an intelligent consensus???

    Please tell me you can smell that hypocrisy too! Science by consensus isn't science, in either case.

  217. Dawkins by grege1 · · Score: 1

    Richard Dawkins made a great two part documentary for the BBC called "The Root Of All Evil?" His book "The God Delusion" is heavy going, but the doco is accessible by anyone. Is there a US TV network that is brave enough to show it? One point made in both is that the fundamentalists vote in their own, and they hold a belief that Armageddon is a good thing as it heralds the return of Jesus. You end up with a President who thinks it is good to blow up the world. Fundamentalist belief is not a harmless delusion.

  218. Define "Evolution" by revitup.org · · Score: 1

    There must be some clearly drawn definitions here, particularly on the meaning of the term "evolution". If we are discussing micro-evolution, or small changes of color, etc. within a given species, then science definitely does prove this true. No intelligent person, Christian or not, disputes this.

    However, as regards the macro-evolution, or changes of basic structure between different biological phyla, such as the sequence of amoeba > fish > land animal > ape > man commonly taught in our textbooks and public schools, the case is quite different. There never has been incontrivertible fossil evidence proving this to be true. In fact, the fossil record has shown that the different basic forms of life appeared suddenly, and fully formed - take, for instance, the cambrian explosion.

    If you desire to bring up the many "missing links" supposedly discovered of apes with tailbones, etc., I highly recommend you investigate the book "Icons of Evolution", written by an evolutionist, which gives, in detail, the accounts of every famous attempt at a missing link, and proves the findings either mistaken or outright faked.

    I am a creationist, and believe that the Bible and Science must, in the end, agree. However, you must look over the historical record and ask yourself, between the two, which one has stayed fundamentally unchanged throughout centuries. If I lived in Newton's day, and based all of my beliefs on the infallibility of Newtonian mechanics, I would inevitably wind up making false conclusions, because Newton's theories were incomplete.

    If I, today, base all of my beliefs on current scientific "consensus", I will also wind up making some false assumptions, because our theories are still incomplete, even if we won't find that out for another hundred years.

    So, as the cutting edge of science is continually changing our assumptions about the world, all I can try to do is apply the new understandings that *have* been proven to what the Bible has always, and will always continue, to say.

    Take, for instance, the issue of the age of Earth, and the perceived discrepancy between the geological record and the biblical account of a six day creation: on the surface, without trying to twist the written account into ridiculous claims of day-ages and such, there appears to be no solution. However, taking the tested and fundamentally proven theory of relativity into account, the possibility of two different measurements of time comes into play. This gives the possibility that both the six day creation (with some 7 to 10 thousand years following) and the astronomically-derived 13.7 billion year age of the universe are, in fact, correct. It just depends on your perspective. And, if you carefully read the beginning of Genesis, you will find that it actually claims that this was the account of the "Heavens and the Earth", connoting a Universal, not an Earth-based perspective of the account.

    The bottom line is, the evolutionary account of universal development has not been conclusively proven, and until it is, both the creationist camp and the evolutionists are both exhibiting a great deal of faith to believe their respective creeds.

    Because evolution is, in fact, a creed. I simply wish that evolutionists would have the intellectual balls to admit that their beliefs are simply that - beliefs. And they require at least as much faith as the beliefs of Christendom.

    - Alex Wolaver

  219. Statistics by nurb432 · · Score: 1

    Can be skewed to how ever you want them to be.

    What 'segment' of the population did they use? How accurate is that to the *entire* population? ( hint: its not, its all a numbers game. )

    --
    ---- Booth was a patriot ----
  220. My Favorite God Quotes by GeoSanDiego · · Score: 1
  221. God Is Radiation by alucinor · · Score: 1

    "God is Light" -- the Bible

    So, according to it, mutations are caused by God.

    And wasn't life created on the primordial earth by lightning?

    Hahah, I'm just being playful. So take no offense.

    And I wonder, has anyone thought up an experiment to prove or disprove God? That sure would be useful! But a God that responds to stimuli doesn't seem like an omnipotent will to me ....

    Oh well ... at the end of the day, God is too big a concept for anyone to grasp anyway. Functionally, "all you need is love". Of course, that too is a bit abstract. So I would like to amend that to, "you have a friend in me".

    Have a swell day, random dude.

    --
    random underscore blankspace at ya know hoo dot comedy.
    1. Re:God Is Radiation by shaitand · · Score: 1

      '"God is Light" -- the Bible

      So, according to it, mutations are caused by God.'

      I take it you worship the sun god then?

    2. Re:God Is Radiation by alucinor · · Score: 1

      NO, the sun is not light per se ... light is in a lot of things, in (and not in, heheh) a lot of places.

      --
      random underscore blankspace at ya know hoo dot comedy.
  222. So where was the poll conducted by Anonymous Coward · · Score: 0

    The subject says it all.
    If you do it in the "bible belt", then *god* wins.
    If you do it at UCLA, possibly then the *real* people win.
    And what is it with doing a 1000 sample of 250,000,000 [means 1 person speaks for 250,000 of us] and is that valid?
    That is worse than Capitol Hill where the estimate is some 3000 lobbyists/congress-critters *run the country*.

    Evidently lots of folks did not watch Faux Newz [and also Leno, Letterman, etc] and understand JibJab's *That's the News* latest creation.

    And by the way, we should be getting near what the rest of the world already knows.
    This is no longer the USA, but the UCCA, United Corporations and Churches of America.

    Word-Salad is all that we get now days, with lots of *fattening* um-um-good tasting dressing laced with poisoned Chinese wheat glutin to cover up the bad taste of the ecoli-laced spinach/lettuce.

  223. Science and Religion serve separate purposes by alucinor · · Score: 1

    Science is a tool that lets us get useful, predictable results out of nature, and tells us something about how we interact with the Universe. By all intents and purposes, it's an extension of our fingers -- we can "touch" things with our minds, thanks to science, and know them through that.

    Religion, on the other hand, is what allows us to keep on touching and knowing things without feeling the weight of the meaningless chaos and nothingness of the Universe bear down on us. For some people, science is their art, it's their skill, and they find solace in discovery.

    But should that be the only avenue towards finding meaning for our lives? I think that would be a bit ethnocentric to conclude. Yet that's also not to say, anything and everything is acceptable, because we do have a society to maintain.

    --
    random underscore blankspace at ya know hoo dot comedy.
  224. 10000? by Anonymous Coward · · Score: 0

    I thought they believed the Earth was 6000 years old?

  225. Re:Read the book? by SEMW · · Score: 1

    Have you read Darwin's book? Do you even know the full title of the book? (No using Google). How on earth is knowing the full title of Darwin's book relevent in any way whatsoever? Evolutionary biology has come a long way since Darwin. He provided the foundations, but he was wrong on some counts, and we've progressed far further, amassed much more evidence, and considerably expanded the scope of evolution as a science since he first advanced his theory. A modern biology textbook (or wikipedia for that matter) would serve you far better.
    --
    What's purple and commutes? An Abelian grape.
  226. A good analogy by alucinor · · Score: 1

    I think a good analogy would be to see life not as a tree, which would be a lot of ARBORtrary (haha, I'm here all night folks) boundaries, but to see it as a kind of river. It's a liquid force, trickling into places that yield to them.

    What's so amazing about life, though, when you get down to the core of it, is it's DRIVE. Why the hell has the universe produced such a thing, when it's paradoxically so blind to its existence? Actually, life seems more like fire than like water -- why why why does it ... *want* to ~live~ so *badly*?

    --
    random underscore blankspace at ya know hoo dot comedy.
  227. evolution not so easy to swallow by jrhawk42 · · Score: 1

    First off I'll say I believe in evolution, but I've also had years of advanced education. Some specifically geared towards evolution theories, genetics, geology and even some geared towards trying to actually understand what goes on durring 50-million years. Back to my point evolution is not an easy concept to grasp and I'd say 90% of those that believe in evolution have no grasp on how it actually works. For me I feel like I'm trying to explain to somebody how a microwave works to somebody who's never seen/heard of a microwave. They aren't going to believe it until you can actually show them a microwave (and then they hang you for witchcraft). Even the scientest themselves tend to get into alot of arguments on how evolution works because we can't exactly test it very well. I feel like trying to come up with a great theory of evolution is like trying to put together a million piece jigsaw puzzle with 500 pieces.

  228. fscking IDIOTS by mclaincausey · · Score: 1

    idiot, n.: A person dumb enough to accept fair tale creation myths written by people who thought the earth was flat, in lieu of science. People who ironically provide a constant reminder that we are nothing but psychotic apes. These wastes of carbon should not be allowed anywhere near a doctor, nor should they be allowed to use anything else that owes its existence to scintific discovery.

    --
    (%i1) factor(777353);
    (%o1) 777353
    1. Re:fscking IDIOTS by Anonymous Coward · · Score: 0

      Creationists have not maintained that the Earth is flat. In fact, they'll point out verses in the Bible which state that it's round, and others saying that it's "hung on" nothing. They'll also point out the many foundational scientific (and biological, and medical) discoveries made by creationists.

      Don't believe me? Then try it. That's what happened to me when I questioned several of them.

    2. Re:fscking IDIOTS by Anonymous Coward · · Score: 0
      Please kill yourself now.


      Thank you.

  229. this means nothing, non-issue by Ryunosuke · · Score: 1

    I wasn't asked to participate in the survey, nor anyone I know. So the numbers represented here are in fact just random numbers that mean nothing. It's sad, but true. If you ask 100 nascar fans about nascar they'll 100% agree it's awesome, etc. nothing to see here guys, move along.

  230. but what is meant by "evolution"? by louzerr · · Score: 1

    There's a ton of confusion as to what people mean when they say "evolution", and especially in a TV SURVEY!!!

    Evolution happens. Species change to adapt to their surroundings. I believe in evolution.

    But then to go to this "grand mal evolution", where everything in existence started from a single cell somewhere? That makes no sense to me. I think the various creation myths, including the Judeo-Christian version, make a lot more sense than "the single-cell that could".

    Believe what you wish, there's no way to prove ANY theory about our beginnings or our end. I choose to believe God created us in seven days, simply because I believe God could do it. Why not?

    But it's not like it causes my universe to shatter when people offer other views. Bring on the discussion! But please, can we elevate it beyond the level of some sound-bite grabbing survey?

    --
    "The large print giveth, and the small print taketh away" -- "Step Right Up", Tom Waits
  231. 48% of Americans are Retarded by lowell · · Score: 1

    this goes along with 70% of college freshman who do not understand compound interest and 1 in 3 highschool senior cannot find the pacific ocean on a map.

    1. Re:48% of Americans are Retarded by onlyfacts · · Score: 1
      as well as 52% of those who can't give you a good reason why they believe in evolution other than "because other so called smart people told me I should".

      Post facts not a bunch of BS.

  232. Origin of Life scenarios are Atheistic Fairy Tales by geoffrobinson · · Score: 0, Troll

    http://pubs.acs.org/cen/coverstory/85/8513cover1.h tml

    Go to the above link by a Darwinist. Faith commitments seem to be holding Darwinist Origin of Life scenarios together.

    --
    Except for ending slavery, the Nazis, communism, & securing American independence, war has never solved anything.
  233. We WERE created.. FROM ALIENS you fools! by CranberryKing · · Score: 1

    I don't understand how 'rational thinkers' believe only in a recent fad in science theorized by Charles Darwin. If you don't subscribe to this idea then you must be a 'Christian'.

    I believe alien species came to this planet and crossed their genes with neanderthal 455,000 years ago so that we may work as slaves mining gold for their planet. Seriously. It doesn't seem harder to swallow to me than the idea that monkeys eventually 'evolved' enough to develop crude tools & then of course nano-technology; the obvious next step.

    Does that make me a creationist? I guess so. But I doubt there is anything other than a not-so-well planned out conspiracy to maintain human enslavement in the bible. If you look thoroughly, and read ANYTHING by Sitchin, it is pretty obvious that Jehovah was an evil motherfucker and regarded humans as nothing more than cattle. Bad alien, bad! But brilliant geneticists.

    Darwin is flat-world. In the future people will laugh hysterically at the idea that 52% believed in evolution.

    Believe it.

  234. how about in other countries? by Anonymous Coward · · Score: 0

    I wonder what sort of results they'd get if they surveyed people in different countries. Which country would have the highest percentage? The lowest?

  235. Evolution is just as good as gravity by Anonymous Coward · · Score: 0

    When people try and point out that the theory of evolution has holes in it. I generally respond that so does our understanding of gravity. After all the amount of matter in the universe only accounts for something like 30% of observable gravity (hence the concept of dark matter). Just because we don't completely understand something doesn't mean the parts we do understand are wrong.

    I also think part of the problem is a misunderstanding of the word theory. From Wikipedia
    "In common usage, people often use the word theory to signify a conjecture, an opinion, or a speculation."
    "In science, a theory is a mathematical description, a logical explanation, a verified hypothesis, or a proven model of the manner of interaction of a set of natural phenomena, capable of predicting future occurrences or observations of the same kind, and capable of being tested through experiment or otherwise falsified through empirical observation. It follows from this that for scientists "theory" and "fact" do not necessarily stand in opposition."

    1. Re:Evolution is just as good as gravity by onlyfacts · · Score: 0, Troll
      Based on the wiki's definition of theory, macro-evolution doesn't come close to qualifying for such. It is certainly a conjecture and a popular one at that.

      Macro-evolution is NOT a verified hypothesis, it is NOT a logical explaination, it is NOT a proven model, it has NOT predicted future occurrences of evolution that have been observed (since macro-evolution has not been observed or reproduced in the lab) and is clearly NOT tested through experimentation.

      I am glad you posted this to clarify the exact status of evolution - it is a conjecture - an opinion.

      Gravity is a testable and observable - nothing with macro-evolution has come close to be either. I will also point out that most evolutionists base macro-evolution on micro-evolution. That because something happens in small increments within a given species it should be extended to assume that this same process creates new species; it has never been shown to be true. This would be somewhat analagous to assuming that because I can jump into the air and achieve a small amount of zero gravity that one day, if I just try hard enough and let time take its course, I will be able to float in the air for as long as I want - get real.

      The problem with basing macro-evolution on micro-evolution is that micro-evolution, such as viruses mutating to resist, certain species losing a tail, etc, is all about information loss - the DNA and the "features" are lost, not added. Macro-evolution to a higher order species requires the addition of information to DNA and that just hasn't been proven/reproduced/observed in the slightest - at least I can't find it on Google :-)

    2. Re:Evolution is just as good as gravity by ColdWetDog · · Score: 1
      Here, as a weekend's exercise to the reader - pick up this book at the Library - Stephen J. Gould's "The Structure of Evolutionary Theory". When you've finished it, come back to the table. Come on, you can't just pick up drips and drops from the Internet and expect to be able to argue whether or not "macro evolution" is a theory or just or conjecture. You might, however, be able to figure out the difference (or perhaps the lack thereof) of those two words.

      In other words, you know not of what you speak. But thanks for playing.

      If you get put off by the weight and size of Gould's magnum opus, read some his collections (The Panda's Thumb and others).

      --
      Faster! Faster! Faster would be better!
  236. Re:Alarming? Consider this... by dvdrsmth · · Score: 1

    Honestly, I'm not sure I can fully articulate my logic behind the previous "it takes far more faith to believe that a "deity" did not create human life" statement. There are so many years of deliberation behind coming to that conclusion that I really can't state it concisely here. I hope to be able to some day, but for now all I can do is encourage you to be unbiased, consider the evidence, and decide for yourself.

    One book that helped me to weigh some of the scientific evidence available to us today is entitled, "Case for a Creator" by Lee Strobel. ( http://www.leestrobel.com/ )

  237. Worrying... by Anonymous Coward · · Score: 0

    Good job it was posted before midnight, or I'd have taken it as an april fool... guess 48% of Americans are fools all year round anyway.

  238. You can't make this up by billcopc · · Score: 1

    Where I come from, this post's title is a joke on its own :)

    Yes, we Canadians are comfortable with the fact that a large number of Americans are blissfully ignorant. On the other hand, you have more money and bigger businesses, evidence that intellect and wealth are not necessarily linked.

    [/Sarcasm]

    Jokes aside, religion seems far bigger in the states than it is up here in the freezing cold. That probably has a lot to do with it, as the theory of evolution goes directly against many religious writings. The preached nature of most popular religions makes such dilemmas difficult. Followers are told to blindly accept "the word of god" as law. Don't turn gay, don't eat pork, don't let women speak, and most importantly don't ask why things are the way they are! Many people can't adapt religion to reality... they don't even want to consider the fact that maybe evolution and "god" can coexist.

    In the end, if the jesus freaks don't like evolution, I'm fine with it. They can run their own evolution-free colleges and teach whatever the hell they like; live their own lives and leave mine alone. The biggest reason why agnostics/atheists dislike religion is because they're always trying to push their version of reality on everyone else like it's they're goddamned Dreamhost resellers!

    --
    -Billco, Fnarg.com
    1. Re:You can't make this up by Shados · · Score: 1

      Jokes aside, religion seems far bigger in the states than it is up here in the freezing cold.
      Thats because its bigger in the states than it is just about...everywhere else except in middle eastern countries, and even that is debatable :)
  239. This poll doesn't surprise me by mrbhave · · Score: 1

    Speaking as a statistician, this poll bodes well for the bell curve, given the fact that half of all respondents (on average) are of above average intelligence, and the other half are below. So it does not surprise me that nearly half of the respondents articulated a faith in an invisible avenger, while a little more than half thought otherwise. I would be interested to see a t-test of correlation with the typical sociological questions asked in polls, such as geographic location, age, schooling, etc. This would better encourage me to finish reading such a loaded poll. And after reading the many responses to this post, it's no surprise that people who read this blog are inclined to fall into the "scientist" label. Speaking as an operant conditioner (i.e., a behaviorist), B.F. Skinner points out that we are products of our environment. But I am in both of the "nature vs. nurture" clans. Lemark posited that all life has the ability to pass on behavior through genes. That's not a shock to me, any more than the belief that our environment is remarkably responsible for our current thought processes. The term "social Darwinist" came from those politically bent toward the right, not from Darwin. Darwin never said "survival of the fittest." This is a common misnomer. What he actually said was those species which can best adapt to their environments do well enough to procreate, thus passing on their genes. He also never said that the genes passed on were superior to those of their predecessor, only that they were better suited for survivability in the current environment. Speaking as a theologian, I cannot. I am not one who believes in theology...call me agnostic. In fact, I agree with one's former comment that routinely bashing religion is to fan the flames of perpetuity for people who would be much better served to just forget about religion.

    1. Re:This poll doesn't surprise me by mrbhave · · Score: 1

      Pardon my hypocrisy about not fanning the flames, but this post could use some levity on the topic, courtesy of an admired comedian, George Carlin...enjoy.

  240. meaning of "love" by falconwolf · · Score: 1

    Love isn't just a noun, it's a verb. Too many people seem to lose touch with how deep the meaning of love can be.

    Actually this brings up a deficiency in English. While English speakers usr "love" in various circumstances othe languages have different words for different meanings. For instance in Greek there are 7 different words that depending on the context English speakers would use the one word "love". In Chinese there are 5 different words. English words also can have different meanings depending on the context, heck the same spelling can be pronounced differently too and will then have a differnt meaning.

    What a crazy language English is. If the plural of tooth is teeth then why isn't the plural of booth beeth? Or why do feet smell while noses run?

    it's been suggested that relying upon Science requires no less faith than relying upon the Bible--I'm inclined to agree.

    Science is testable and verifiable, I have yet to see how a belief in a "God" can do either. At least without using the Socratic method and drinking hemlock tea.

    Falcon
    1. Re:meaning of "love" by hyperquantization · · Score: 1

      Science is testable and verifiable

      By what axiom?

    2. Re:meaning of "love" by Rakarra · · Score: 1

      The Scientific Method. And before you (or anyone else) shouts "aha," the Scientific Method is simply the best we have. If we find in the future some method of testing and verifying that can be shown to be better, then the Scientific Method says it should be replaced by the new one.

    3. Re:meaning of "love" by hyperquantization · · Score: 1

      Again, that's exactly my point. We take on faith that the Scientific Method works, which is based on the faith that our ability to perceive reality is accurate.

  241. Why? by Manchot · · Score: 2, Funny

    Why must you mock my belief system? I know that the Power Rangers are protecting us all!

  242. Great web site raising questions about evolution by rad1836 · · Score: 0, Flamebait

    Check out this site: http://www.answersingenesis.org/home/area/qa.asp. It is a gold mine of alternative information about the "theory" of evolution.

  243. Re:Fortunately, It Doesn't Matter What You "Believ by ungenio · · Score: 1

    Ah yes, the facts are everywhere. There's this planet, it has people on it, plants, bugs, fossilized bones in the ground, the bones have an isotope that can be measured, etc...

    These things are undeniable. But, none of these things prove that either creation or evolution happened. And since none of us were there to see it happen, we are left with assumptions.

    It's these assumptions that define the direction that people take to arrive at a conclusion. For example, you can either assume that the isotope in the bone has been decaying uniformly and at a constant rate and was thus formed millions of years ago. Or you can assume that the world was much different when created and suffered a cataclysmic worldwide flood, meaning the decay rate hasn't been uniform or constant.

    So I think we'll be much better off the sooner everyone just realizes that it's not believing evolution that proves there's no God, it's believing there's no God that affirms a belief in evolution. Likewise, it's believing in God that produces a belief in creation.

    Nobody is disputing facts. We just don't all share the same assumptions.

  244. Erich Von Daniken by RammsteinAddict · · Score: 1

    correctly postulated how human beings were genetically engineered from apes by visiting spacemen. It makes perfect sense.

  245. No, that's not true. by Estanislao+Mart�nez · · Score: 3, Insightful

    It is essentially the act of being falsifiable that actually makes Evolution a real scientific theory [...]

    This is a popular statement of Karl Popper's falsificationist philosophy of science. Falsification is known to be an inadequate demarcation criterion for what counts as science. No evidence can falsify any particular hypothesis, because we can always revise some belief other than the hypothesis.

  246. There are no other theories! by Tom+Christiansen · · Score: 1

    So, IMHO, all it takes is a few preconcieved [sic] notions to get you to pick one theory over another. Which one is right?
    Excuse me, but there really are no competing theories in this area. The only theory we have is the evolutionary one. There's aren't any others. Zero. Zip. Zilch. The Great Nought Itself. We only have one, one which we admittedly sometimes adjust in minor ways as new data come in, as new hypotheses are proposed and put to the test and those tests' results evaluated. But the theory of evolution itself remains intact.

    Not only are there no other theories, this one is the master theory that ties virtually everything in the biological sciences together. It underpins and informs our understanding of all those many related fields. In laboratories around the world, day in and day out, its fundamental accuracy and applicability are proved again and again and again. No other theory ever developed has been so subjected to so many tests across so many application areas. Without it, we could never have made the advances we've made in molecular biology, in genetics, in physiology, in medicine--in dozens of related fields. If there's any model of our natural world that we know to work, it is this one.

    --tom

    1. Re:There are no other theories! by onlyfacts · · Score: 1

      What a great approach - just use lots of superlatives and bolded words and your opinion becomes the final authority? Cool, then I can say confidently that you cannot possibly provide a single, coherent fact that can clearly show evolution is even close to a credible theory. It is a clever idea that is based on other clever ideas, but you will not find anywhere in the land of Google a single shred of evidence that you can post here. In fact this whole original thread contains a bunch of evolutionists who just use superlatives and broad comments about how evolution is true because it has been proven or it is logical, but not one person has posted a single fact. And just because I can't support "the obvious" logic behind evolution doesn't make me an idiot - an idiot is one who cannot possibly consider all ideas - even the ones they can't see. There is no evidence that can be found that shows DNA evolution from one species to another. The process where information is added to DNA to produce a higher order or different species. Did I use enough superlatives? :-)

    2. Re:There are no other theories! by Anonymous Coward · · Score: 0

      "There is no evidence that can be found that shows DNA evolution from one species to another."

      Excuse me, but DNA itself is part of the evidence of evolution from one species to another. DNA exists in every living thing on Earth. Structurally it is the same in every living thing on Earth. The same four nitrogenous bases. The same phosphate-deoxyribose background. The order and amounts of the bases can vary which gives rise to the genetic variation seen between and even among species but their distribution follows strict rules (Adenine always joins to Thymine, Guanine to Cytosine). There are numerous mechanisms by which variation can occur. To provide "facts" for this would involve far more space and time than the scope of a forum like Slashdot is capable of.

      "Cool, then I can say confidently that you cannot possibly provide a single, coherent fact that can clearly show evolution is even close to a credible theory."

      What would you like us to do? Should we copy and paste the text of Darwin's Origin of Species, Watson's The Double Helix or any of the other thousands of publications that have covered DNA, evolution and related subjects? If you're ignorant of the facts supporting evolution it's because you haven't made the minimal effort necessary to find them.

      If you would like to read a decent layman's introduction to evolution I can suggest Maitland Edey and Donald Johanson's book 'Blueprints Solving the Mystery of Evolution'. It provides an interesting history of the development of evolutionary theory as well as some detail as to how various parts of evolution and heredity work.

    3. Re:There are no other theories! by onlyfacts · · Score: 1
      You cannot find a single example of a lower order species DNA evolving to a higher order species DNA. You can only find small variations of DNA within the same species. Micro-evolution is observable, but you cannot extrapolate micro-evolutionary processes out to say it becomes macro-evolution. If you take any micro-evolutionary process that is documented, you will almost always find that DNA information is lost. One good example article to read is http://www.answersingenesis.org/docs2/4343Critics_ Plantcolour.asp . You can't evolve to a higher state without adding information and no scientist has yet been able to figure out how that can happen in nature.

      I have read several articles and books on evolution. It is still a simple conjecture that all animals and humans evolved over billions of years from a single primative original species and something that should be easily proven and hasn't! Just because several people have been very verbose in their explaination of how evolution could work doesn't make it true. Just give me the facts - it should be easy.

      I truly hope you read the article posted above and that website in general, it will at least give you good food for thought. Don't stop learning and challenging your ideas - evolution has a lot of gaps, at least be open to other ideas.

    4. Re:There are no other theories! by SEMW · · Score: 1

      Micro-evolution is observable, but you cannot extrapolate micro-evolutionary processes out to say it becomes macro-evolution. I was about to direct you to my post here that I'd made to someone else a while ago regarding this distinction betweem micro- and macro-evolution you are making, when I realised that you are the same person I replied to back then. Instead of actually debating the points, you appear to be just posting the same old many-times-refuted arguments copied from a Bible propoganda site called "Answers in Genesis". Since it is clear you have no wish to actually debate evolution, or even understand what it is (your paragraph on information hints of the 'argument' that evolution violates the second law of thermodynamics, possibly one of the most ridiculous and easily-refuted arguments to ever be apparently seriously used in a debate), I see little point in trying -- especially since this arugment of yours:

      Just because several people have been very verbose in their explaination of how evolution could work doesn't make it true. Well, no duh. the trick is actually reading the explanations, "verbose" as they are, because the explanations contain facts; rather than rejecting "explanations" and demanding "facts" instead -- possibly the most ridiculous debating tactic I have ever seen.

      Finally, as to your argument that evolution is a bad explanation because it has gaps; I'll leave you with the thought that quantum gravity has gaps as well, but that does not mean that things do not fall downwards.

      Good night!
      --
      What's purple and commutes? An Abelian grape.
    5. Re:There are no other theories! by onlyfacts · · Score: 1
      Your explaination on the distinction between micro- and macro-evolution was just not complete and contains the same old statements evolutionsts make when they can't get their evolutionary facts in order -- just give us a few more billions of years.

      I do like AIG because they are thinking people. They challenge anything that claims to be true science and isn't. The gaps in evolution are more than just little gaps - it is whole sections of logic missing and in sane logic at that.

      As stated, you aren't ready to debate the issue, you haven't even read the articles I referred you to which have great facts as well. Too bad you are stuck on your opinion being right, verses trying to discovering real facts. You don't have to agree with the whole philosophical premise of AIG, but you can certainly appreciate their research and challenges to evolutionary junk science.

    6. Re:There are no other theories! by Copid · · Score: 1

      Micro-evolution is observable, but you cannot extrapolate micro-evolutionary processes out to say it becomes macro-evolution. If you take any micro-evolutionary process that is documented, you will almost always find that DNA information is lost. One good example article to read is http://www.answersingenesis.org/docs2/4343Critics_ Plantcolour.asp [answersingenesis.org] . You can't evolve to a higher state without adding information and no scientist has yet been able to figure out how that can happen in nature.
      Before you go any further with this line of thought, please define "information" and explain how one would determine how much of it is in a given segment of DNA. If you can do that, I think that this discussion could get very interesting.
      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
  247. 50% of Americans are below average intelligence by DarthSideous · · Score: 1

    Well, it's true.

  248. In unrelated change... by Anonymous Coward · · Score: 0

    "It doesn't say there there must have been a single first organism, we've inferred that from the evidence."

    I think the fundamental flaw with their "infer"-ing is that they use the "like" argument. Some dinosaurs had wings, and present birds have wings. That however doesn't mean that one is the descendent of the other just because they use the same form of locomotion. IMHO here's a way to think about it with a question. If one were a deity tasked with creating a brand-new world? Would it make more sense to have creations that had as much reuse amoungst them? Or would it be better if everything was completely unique? I prefer to think the deity is a practical one.

    1. Re:In unrelated change... by servognome · · Score: 1

      If one were a deity tasked with creating a brand-new world? Would it make more sense to have creations that had as much reuse amoungst them? Or would it be better if everything was completely unique? I prefer to think the deity is a practical one.
      It is impossible for man to know the motivations of gods.
      If you accept the stories, God made man in his image and also expects man to obey and worship him. To me this points to an egotistical God, so wouldn't it make sense for him to create something so improbable that it would in fact prove his existance, like the babelfish... though there's that whole faith requirement thing.
      --
      D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
  249. Re:Since when do you get to decide who is Christia by exp(pi*sqrt(163)) · · Score: 1
    > that you claim to have the ability to judge who is "truly" or "actually" Christian

    If someone claims that 6+3 is 10, but when complain when you given them only $3 change when they pay you $10 for a $6 you know they were lying. You don't need to wax philosophical about people making their identities however they want. Most people who claim to be religious believers are liars in the same way that this hypothetical alternative mathematician is. So in answer to your question:

    > Who the hell are you to decide what people "actually or truly believe"?

    I'm happy to answer for myself - I'm just a regular guy who expects a modicum of consistency from the people around me. Don't you have a similar expectation too?

    I should point out (as someone who was brought up Jewish) that Judaism is unique among religions for its lack of creed and indifference to what its practitioners (note I use the word practioner) believe.

    --
    Doesn't it make you feel good to know that our freedoms are protected by politicans, lawyers and journalists.
  250. +N Insightful by ppanon · · Score: 1

    Somebody with points please mod parent up.

    --
    Laissez lire, et laissez danser; ces deux amusements ne feront jamais de mal au monde. - Voltaire
  251. In unrelated jokes... by Anonymous Coward · · Score: 0

    Hmmm. I seem to remember a post someone made here that (paraphrase) goes like;

    Scientist: I can create life.
    God: Go ahead.
    Scientist: Starts up experiment.
    God: Wait a minute! Use your own dirt.

  252. Close, but no cigar by Anonymous Coward · · Score: 0

    It is under 50%. That you did not know this, makes you, one of, them. We do not round. We are Borg.

    1. Re:Close, but no cigar by DarthSideous · · Score: 1

      No need to round. The concept of an "average inteligence" has no specific numerical value. Therefore there is no one who is exactly average. You are either above or below.

  253. Oh jesus! by Anonymous Coward · · Score: 0

    I really hope this is a lame april fool.

    Or then 48% of americans are really stupid, no, that can't be it, the number obviously is much higher...

  254. Sadly, I agree by WindBourne · · Score: 1

    For the Europeans, it was their acceptance of similar ideas that helped take them into the dark ages. And it was the slow rejection of such that helped lead them out of them.

    --
    I prefer the "u" in honour as it seems to be missing these days.
    1. Re:Sadly, I agree by Das+Modell · · Score: 1

      I wish people would stop propagating the myth of the "dark ages."

    2. Re:Sadly, I agree by hazem · · Score: 1

      Right, but how can you have an enlightenment if there was no preceding endarkenment?

      More seriously, my understanding of the term "Dark Ages" is that there simply was much less written in Europe during those times so there is not as much known through the writings. This is in contrast to periods before and after.

    3. Re:Sadly, I agree by EsbenMoseHansen · · Score: 1

      I wish people would stop propagating the myth of the "dark ages."

      From what I've read, for a 1000 years almost all scientific progress, and all improvements in living standards, were brought nearly to a standstill while Religion (Christinity) strangled the great minds of Europe, while most other regions were even worse off. So I like the term, "dark ages". May nothing like that ever occur :)

      To be fair, great strides were taken on the arts&litterature side of things, but I know which I would prefer any day.

      --
      Religion is regarded by the common people as true, by the wise as false, and by rulers as useful.
    4. Re:Sadly, I agree by EsbenMoseHansen · · Score: 1

      That page does not mention the scientific advances in that period, but does mention the cultural advances I also mentioned. Perhaps because there wasn't any to speak of?

      --
      Religion is regarded by the common people as true, by the wise as false, and by rulers as useful.
    5. Re:Sadly, I agree by Das+Modell · · Score: 1

      You should read about the Byzantine Empire. Seems like it was pretty advanced. I think WP's entry about Byzantine medicine is particularly interesting.

  255. MOD PARENT UP by Anonymous Coward · · Score: 0

    I don't know why the fuck someone hit him with the coward's -1, Overrated mod... probably because he dared suggest there was a legimate reason why America seemed to be more fucked up than those oh-so-righteous European Union countries. Anyway, +1, Insightful.

  256. Re:Alarming? Consider this... by dvdrsmth · · Score: 1

    Good points (especially if you take the emotion out ;-). One of your statements is particularly worthy of further consideration IMO: "...and that the scientific method is the most powerful tool we've ever built for ourselves in the entire history of our race..." Scientific method is essentially observation, hypothesis, prediction, and testing. For scientific method to work one has to be able to disprove/test the proposed theory, right? Take the big-bang theory for example, is it possible to even attempt to disprove the theory through testing? Perhaps down the road, but certainly not to the degree that it would take to confirm theory to fact. (btw, yes I understand the same argument applies to an intelligent design theory -- at that point you just have to decide for yourself) related blog article I ran across you might be interested in: http://hunstem.uhd.edu/HUNBlog/blogs/index.php?blo g=2&title=are_we_teaching_scientific_method_the_ri &more=1&c=1&tb=1&pb=1

  257. In point of fact, by WindBourne · · Score: 1

    there are some humans who still have small tails.

    --
    I prefer the "u" in honour as it seems to be missing these days.
  258. belief by falconwolf · · Score: 1

    That makes religious facts much more convenient. It doesn't take hard work to actually believe them, you can simply lean back and nod your head.

    Oh but belief, as in faith in something, is hard, "you don't choose the things you believe in, they choose you". Once you have belief then things get easy, "It's that way because X wants it that way."

    Falcon
    1. Re:belief by reub2000 · · Score: 1

      Believing that times moves slower when your moving is something that is hard to believe. Beliving that god created the earth in 7 days is easier when it's been pounded into your head since you where a little infant.

  259. Re:Alarming? Consider this... by Anonymous Coward · · Score: 0

    "sending people to hell for participating in gay sex"

    Contrary to the claims of His representatives on earth who should know better, God does not send gay people to hell for having their form of sex. Also, God loves His homosexuals. The notion that "god hates fags" seems to have been uncritically accepted by far too many people. If you're gay and have rejected religion because of homophobic lies, please reconsider. There's great comfort and joy to be found in being one of His creatures and contemplating Him on your own without going through homophobic intermediaries.

  260. My problem with religious people... by anglozaxxon · · Score: 0

    is that there's no way they can be proven wrong. A belief is essentially some unit of knowledge which has no basis in experience. The only reason they know a belief is because they were *taught* it, not because they were able to learn it. (I'm willing to concede this point if some Powder-esque recluse were able to write the Bible without outside influence, but I find this pretty improbably.) Faith is literally believing something without any reason to believe it, so, in the words of Disney's Sleepy Hollow, "you can't reason with a headless man". Thus, faith is more powerful than reason, since it can always defeat it. But this is a problem: if you can't trust the universe operates with a basis of reason, then the universe means nothing: it might as well be just random garbage, which is pretty much the definition of a pointless life. Therefore, faith is a poor basis for one's life: you might as well just kill yourself; life's just going to be arbitrary nonsense anyway.

  261. Why ''Alarming''? by Pooua · · Score: 0

    Why expose your bias by stating that belief in Creationism is alarming? Why worry that the U.S. will lose its technological lead if biological evolution is not wholeheartedly embraced by most of the public? Based on the statements many evolution-supporters make, one would think that biology gave us the technological marvels of our world, instead of physics. The threat to our nation's technological edge is not because people don't embrace evolutionary theory--though a lot of evolutionists want us to think it is. Rather, we are at risk because people don't know how to read, write, perform advanced mathematics and understand physics and chemistry and related technologies.

    Biology is an infant science. It has few equations to describe its processes. In fact, it has very little mathematical modeling at all, particularly compared to the most mature science, physics. This means that biology is a field offering much opportunity for those who want to make a name for themselves as pioneers in the field, but that is in pure science, not in technological application. It will take biology a century to reach the maturity of modern physics, never mind the applications to come from it.

    --
    Taking stuff apart since 1969 (TM)
  262. Not straightforward by jrieth50 · · Score: 1

    While I obviously don't agree with the outcome of the question, and it is straightforward to me. It is in truth, a compound question. It requires acceptance of both premises in order to provide a yes answer. Whereas disagreement with either statement could elicit a no. I'm just saying...

  263. Can slashdot stick to what it's good at? by nFriedly · · Score: 1

    I really wish slashdot would try and stick to IT stories instead of worrying why I, and apparently 48% of Americans, don't believe the unproven* theorie of evolution.

    I choose to believe what the Bible says, namely that God created man.

    *I believe in evolution to the extent that it has been proven but no further. Because birds beaks vary depending on what type of food is available does not prove to me that single celled organisms eventually turned into walking, breathing human beings.

  264. In other words, by xigxag · · Score: 1

    48% of Americans believe that God is a freakish sadist who created a fake fossil record, fake embryology, fake comparative anatomy, fake mitochondrial DNA and fake molecular genetics to deliberately mislead his creations and to confound our attempts to understand the world that we live in. Because that what good (heavenly) fathers do: They fuck with their kids' heads.

    --
    There are two kinds of people: 1) those who start arrays with one and 1) those who start them with zero.
  265. Re:Great web site raising questions about evolutio by onlyfacts · · Score: 1

    Ditto on your recommendation - unfortunately virtually no one on this thread who is an "evolutionist" will even visit the site and attempt to discuss even one point. They have already decided that Christians aren't smart and could not possibly have a competing idea or the ability to debate evolution in a credible way - now who is the narrowed minded ones? :-)

  266. Don't worry, be happy! by drolli · · Score: 1

    A few generations from now, society will be split into priests of high-tech and the masses, whose limited conception of science makes them beleive that a mobile phone of that time is magic. The priests will rule the world again and will send the masses to senseless crusades just to reduce their number to a level which is well-controllable.

  267. alternative theories by falconwolf · · Score: 1

    Our country's science education could benefit more by including other, maybe lesser known or less supported, theories. It would be better for the students to look at the different alternatives and decide for themselves based on the evidence.

    And what are these other scientific theories?

    Falcon
  268. Re:Great web site raising questions about evolutio by Bush+Pig · · Score: 2, Insightful

    I've had a look. It's nonsense - the babblings of a lunatic.

    --
    What a long, strange trip it's been.
  269. Bad question by Kuvter · · Score: 1

    Given the straightforward question, 'Is evolution well-supported by evidence and widely accepted within the scientific community?

    If you answered "No" to that you're not rejecting, or supporting, evolution at all it. All you're doing is saying "No" to one of the two situations in question, evolution well-supported or accepted in the scientific community. This is simple logic here if one of them is false the whole statement is false.

    If you asked the straight forward question, "Do you believe in evolution?" and then 48% of the responses said "No", then the title on /. would be more accurate. Assuming a reasonable sized population to get a reasonable probability.

    --
    "To be is to do." --Socrates
    "To do is to be." -- Aristotle
    "Do-Be-Do-Be-Do..." --Sinatra
  270. Re:Since when do you get to decide who is Christia by Trillian_1138 · · Score: 1

    If someone claims that 6+3 is 10, but when complain when you given them only $3 change when they pay you $10 for a $6 you know they were lying. You don't need to wax philosophical about people making their identities however they want. Most people who claim to be religious believers are liars in the same way that this hypothetical alternative mathematician is.

    We may have to agree to disagree. 6+3 is demonstrably less than 10, while there is no such test for 'religiousness.' I completely agree that many religious people come off as hypocritical at best, liars at worse, I just think it's unfair (and, more to the point, outside of the scope of abilities you possess) to determine whether or not someone else holds true to their personal beliefs about their relationship with $DIETY. I don't believe I was waxing philosophical about self-created identities, and I don't think you've responded to my point of contention - how do you know whether someone else is "truly" or "actually" Christian?

    Again, your comment implies you can judge who is "truly" or "actually" Christian, across the board. I reject the premise of your claim, and think that if someone says, "I am Christian," the only person they have to answer to is themselves. Now, as someone else in this thread noted (and I agreed) you could point out their hypocrisy and that they're not holding to their self-expressed value/judgment/etc system. I wouldn't have a problem with that, and I'd probably agree with you. I just really strongly feel this is, at least in part, an issue of people being able to choose their own identity.

    Thanks for replying though. Sorry if (rereading my comment) I came off as an ass.

    -Trillian
  271. How should a poll be interpreted? by thrawn_aj · · Score: 1

    'Is evolution well-supported by evidence and widely accepted within the scientific community?', some 48% of Americans said 'No'. I see nothing wrong with that statement. The poll was secretly designed to test the credulity of the American public :P. I would say it was a resounding, albeit depressing success =D. Perhaps another bad habit that Americans should be weaned of is expressing an opinion while knowing absolutely nothing about the evidence or the nature of the scientific community. Also, I wonder if perhaps we should just introduce Creationism (not just ID, but the full-flanged "C") into schools? The benefit here that no one seems to have thought of is that this would enable students to FINALLY question the Bible and other mainstream religion(s) in a classroom, where at least theoretically, questions are encouraged and mindless answers from teachers are frowned upon. While the Creationists think of ID as a wedge to gain access to public schools, perhaps atheists should think of ID as a sneaky way to REALLY bring intelligent discussion and scathing critical inquiry of religion back into scholarly debate. You wanna bring the Bible into a classroom? Well, don't blame us for the ensuing carnage *evil grin* and shredding of paper tigers. In a classroom, they won't be able to hide behind "because God made it so" like they do in more private mileux.
  272. Re:Great web site raising questions about evolutio by onlyfacts · · Score: 0, Troll
    A perfect example of the evolutionst camp - unable to debate based on fact - just insult all others and throw around broad stroked opinions.

    Operators are standing by to take your facts and post them to this thread .... oops, evolutionists don't have any, I guess this will be a short thread.

  273. I always wondered... by nschubach · · Score: 1

    I always wondered why I hated half the people I meet... How can you not see evolution? Blinded by ignorance.

    --
    Every time I start to have faith in humanity, I ruin it by driving to work between 7 and 8 am.
  274. They may be on to something by Anonymous Coward · · Score: 0

    I was a die-hard evolutionist until well into my 30's. I have an MS in engineering.

    I carefully considered the evidence for goo-to-you evolution, and have found it to be highly tentative and speculative. I am assuming the respondents to this survey were rejecting goo-to-you, not finch beaks getting bigger and smaller.

    Similarity of DNA? Maybe evolution, but maybe not. Designed systems also share similar "DNA" so to conclude that similarity is the result of evolution requires significantly more evidence than has currently been uncovered. And, keep in mind that the history regarding evidence for evolution is replete with hoaxes and outright falsifications. The most recent being Leakey's, one of the most respected in his field, until now.

    I studied the history of origin of life research and discovered that there are no known pre-biotic pathways that would lead to the origin of life.

    I read the rhetoric of the leading defenders of Darwinism and found that most resort to censorship and ad-hominem attacks towards doubters and skeptics.

    (Read this article about Forrest Mims and Scientific American: http://www.forrestmims.org/scientificamerican.html for one of many examples of this)

    Is the hypothesis of RMNS evolution falsifiable? If so, what is the alternative hypothesis? Some other form of evolution? Design, perhaps?

    For many the design hypothesis is not considered to be scientific, so to a large extent, evolution is one of the few scientific hypothesis whose true alternative hypothesis is disallowed on a technicality. What is the technicality? Well, there are many that are cited, but they are all reasons that ultimately point to a philosphical objection to design, rather than a scientific one.

    Flying spaghetti monster, I hear? Who knows. Inferring design is not the same as identifying the designer. For me, given what we know today, design is much more satisfying than spontaneous generation, which is where purely naturalistic science leads. Origin of the universe? "Oh" the physicists say, "that's due to a quantum fluctuation in nothingness."

    And the creationists are ignorant? Look, you can't rig the outcome and call it science. Science is always tentative, and the evidence we have today points clearly to design as well as to micro-evolution. Its not necessarily an either-or question.

    If you are truly concerned about the state of science eduation in the US due to this report, it may be your science education that is wanting.

    1. Re:They may be on to something by onlyfacts · · Score: 1
      I heard that!

      Just to be clear, not too many on /. will be willing to discuss this topic soberly, openly and with facts. Talking about narrow mindedness and inflexibility! Everytime we ask for facts, the response so far has been "RTFM", meaning, they can't recall any particular fact or reasonable train of thought by which they can support macro-level evolutionary processes but they can certainly quote the names of all the other smart guys who can write a bunch of stuff.

      Loved your post.

  275. A tornado is coming. by Anonymous Coward · · Score: 0

    America, the trailer park that won the lottery.

  276. This only proves... by Anonymous Coward · · Score: 0

    This only proves that 48% of Americans themselves haven't yet gone through evolution.

    1. Re:This only proves... by onlyfacts · · Score: 1
      I think God for that! :-)

      And if the other 52% have evolved in the same fashion as micro-evolution, then you should find you are just a little less smarter than the other 48% since micro-evolution always results in loss of DNA or features (a mutation). Don't despair, I'll loan you a couple genes. :-)

  277. And now for some statistics... by Assassin+bug · · Score: 1
    The basis for the Newsweek poll (via Princeton Survey Research Associates International) --

    The NEWSWEEK Poll, conducted March 28-March 29, has a margin of error of plus or minus 4 percentage points for questions based on all registered voters and plus or minus 6 percentage points for results based on registered Republicans and Republican leaners. In conducting the poll, Princeton Survey Research Associates International interviewed 1,004 adults aged 18 and older.
    The current US population is around 298,444,215 (as of about a year ago its now over 300M). So, Newsweek surveyed ~0.0003% of US registered voters and out of an unknown number of responders, over a 1-day period, they found that ~0.000016% (+ or - 40 people) of the US population "reject the scientific theory of evolution". Wow! Great scoop Brian Braiker! I am sure that everyone with an "M.A. in international affairs" is now looking forward to an exciting career in "journalism". Maybe Newsweek also should have asked, "are you smarter than a 5th grader?" Maybe they should have also asked, "'Is Intelligent Design or creationism well-supported by evidence and widely accepted within the scientific community?'" But who cares about internal controls if you are a "news organization" generating hyperbole?
    1. Re:And now for some statistics... by Anonymous Coward · · Score: 0

      Although maybe not quite as eloquently, I tried to make a similar point over here and got shot down as flamebait. If I had bothered to register and accumulate mod points I would've gave you far more than two points for stating the obvious. Cheers!

  278. the beginning by falconwolf · · Score: 1

    the question evolution fails to answer and which makes it counterintuitive is "Where/How/When did it all start"

    Eveolution DOES NOT try to answer how things, life, started. That is not it's purpose. Evolution seeks to explain how we got here and where we are headed. At least that's how I look at it.

    Falcon
  279. 91% noodles?? by Anonymous Coward · · Score: 0

    out of what??? if thats anything i know i wasn't surveyed. i believe in pasta, because it's spaghetti appendages touch me in places.. *wink*

  280. which farm animal represents the "fit" of america? by Anonymous Coward · · Score: 0

    "DNA + "survival of the fittest" = evolution. It's not a theory - it's just a plain consequence of the the tautology "survival of the fittest" and the fact that we're based on a naturally varying chemical hereditory mechanism (DNA). If you don't understand that people who have more children leave more descendents, or that we're based on DNA, then, YES, you are stupid."

    I suggest you read "1,000 common delusions and the real facts behind them. Page 177 before you start namecalling.

  281. the Vatican by falconwolf · · Score: 1

    The vatican gets it, but I guess the people who don't get it are the same people who think that being religious and being pro any kind of war can mix.

    Unfortunately as some think the Vatican is Devil's spawn, this wouldn't work for them. Actually it may reinforce their belief.

    Falcon
    1. Re:the Vatican by jelle · · Score: 1

      "Unfortunately as some think the Vatican is Devil's spawn, this wouldn't work for them. Actually it may reinforce their belief."

      Shouldn't they be nailing letters to church doors about it then?

      --
      --- Hindsight is 20/20, but walking backwards is not the answer.
  282. America the Great by Mark_MF-WN · · Score: 5, Insightful
    Don't you love how Americans can only maintain their delusions of adequacy by comparing their nation to the very shittiest, backwards little hellholes on the entire planet? God forbid Americans ever compare their nation to, you know, other modern industrialized nations?

    Here's the deal: stop saying that America is the greatest nation on Earth, the most advanced nation on Earth, the home of the free, the home of the brave, or any of that other bullshit, and MAYBE people will stop pointing out that every one of those claims is a baldfaced lie.

    1. Re:America the Great by sumdumass · · Score: 1

      Don't you love how non-Americans have to bring up stuff that has little to no bearing in practicing the vast majority of science to somehow make themselves feel better. As if a deity litmus test proved anything anyways.

      But what does this really say about their sense of self worth? Getting all pissy about he greatest nation on earth, the home of the brave and all and using something as trivial as evolution verses faith renditions as proof of it's non existence.

    2. Re:America the Great by cyphercell · · Score: 1

      Ok I'll bite, what country are you from?

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    3. Re:America the Great by Mark_MF-WN · · Score: 4, Informative
      The "deity litmus test" does prove something: it proves that a group of people reject empiricism and will believe in mythology -- no matter how many of the claims in that mythology are categorically false.

      We're not talking about whether people believe in some arbitrary omnipotent being. We're talking about people believing specifically in the Christian God. A god who supposedly said things like: "Ask, and it shall be given you." This is clearly an outright lie. So anyone who believes that the bible is anything other than fiction is believing something that they KNOW is untrue. That directly contradicts scientific thinking. "Behold, I give unto you power to tread on serpents and scorpions, and over all the power of the enemy: and nothing shall by any means hurt you." Another statement that Christians believe, even though Christians are routinely killed by natural causes, by each other, by non-Christians, by animals, etc.

      Let's review:

      • Americans are terrified that terrorists are out to get them, despite the fact that terrorism kills fewer Americans each year than the flu, fewer than cancer, fewer than suicide, fewer than murder, fewer than automobile accidents, fewer than natural disasters, etc. That pretty much makes Americans irrational cowards. So much for the "home of the brave".
      • Only a handful of Islamic Theocracies have people that are in less acceptance of evolution than America; not to mention the way Americans disbelieve scientists about every other subject as well. The universe is 13.2 billion years old? Of course not! The grand canyon proves the Genesis story! So much for advanced.
      • America has one of the highest murder rates in the industrialized world. So much for being anything other than a society of monsters.
      • America rather consistently loses wars against third-world countries. Very impressive, and definitely great. Then they criticize the rest of the world for not being stupid enough to get on board for the big defeat. So America is simultaneously weak (for losing), stupid (for going to war in the first place), and petty (for getting mad at nations run by rational, literate people).
      • Anti-illectualism: almost unheard of outside of the United States and Islamic Theocracies.
      What's remarkable in all of this is how closely America resembled places like Iran. The same obsession with imaginary enemies, quite comparable religion fundamentalism, a disrespect for rationalism of any kind, the idolization of leaders based on their charisma rather than their actual decision making skills, and a tendency to cling desperately to "moral" principles that have been clearly shown to make life worse for everyone.
    4. Re:America the Great by Mark_MF-WN · · Score: 1
      Is it really relevant? I'm not from an Islamic theocracy, and I'm not from a third world country.

      I'm from a country where most people are more worried about dying of cancer than they are of terrorism ... because they're not stupid enough to have failed to notice that cancer kills 10,000 times as many people as terrorism does. Even war kills 100x times as many people as terrorism, which is why my people have worked diligently to avoid war whenever possible. And questioning evolution is considered to be such a laughably stupid thing to do that I've only met one person in my entire life with the audacity to do so... and even he seemed rather embarassed about it, as if he knew how ridiculous he sounded. Our government does very little spying on its people. We aren't running a 3 trillion dollar deficit; in fact, our government has been CUTTING taxes and INCREASING spending ever year to make up for regular budget surpluses ... mostly thanks to the fact that we don't elect people that we know will deliberately mismanage the economy for personal gain.

      So yes, I look down my nose at Americans. Sure, at one time they were world leaders. They produced some great thinkers, and some great ideas came out of the US. Americans even stood up for freedom a couple of times. Then around 1960 or 1970, as the baby-boomers came into their own, Americans turned into lazy, spoiled, stupid, irrational, cowards. They no longer add anything of value to the world. America has to bring in hundreds of thousands of immigrants, just to get any work done at all -- particularly in scientific and technical fields. I mean, come on. Where is even the tiniest hint of greatness in modern America? The freedom is gone, the courage is gone, the innovation is gone, and even the democracy is pretty tarnished when Americans can't even go a single election without levels of fraud that make the worst Banana republics look like utopian.

    5. Re:America the Great by fucksl4shd0t · · Score: 1

      You can claim the other industrialized nations are more advanced than the US after the two most destructive wars in history have been fought in the US and primarily by the US.

      All those claims are historical facts at this point, whether they're still true or not isn't relevant. The Roman Empire retained many of its pre-imperial traits, even after the split into east/west empires, and the American Empire has done likewise.

      --
      Like what I said? You might like my music
    6. Re:America the Great by Skreems · · Score: 1

      To be fair, it's mostly a small but vocal minority that keeps spewing such rabid nationalism. There's a fair number of people who understand that all those empty sentiments are damaging, and they may even outnumber the first group. Stupidity tends to win on talk shows and "news" discussions, just because it has smaller soundbites.

      --
      Slashdot needs a "-1, Wrong" moderation option.
      The Urban Hippie
    7. Re:America the Great by cyphercell · · Score: 1

      I'm not from an Islamic theocracy, and I'm not from a third world country.

      ...maintain their delusions of adequacy by comparing their nation to the very shittiest, backwards little hellholes on the entire planet?

      So, your response is to state that you don't come from the shittiest, backwards little hellhole on earth?

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    8. Re:America the Great by fucksl4shd0t · · Score: 1

      First, are you in one of those countries that has a major political party with the word "Christian" in the name?

      Second, let's consider this review of yours.

      • Loses wars against third-world nations: Belgium vs Congo. France vs Vietnam. France vs Algeria. Germany vs the World (twice). Soviet Union vs Afghanistan. Great Britain vs her American colonies. The US lost against the same people France lost to, and the US is arguably losing in Iraq. What other wars have we lost against third-world countries? (Don't try Korea, we won in Korea until the idiot decided to cross over into China, at which point we stalemated at the current border, and yes, this is the same idiot that fought so successfully against Japan)
      • Highest murder rates: Has such a study been done on the aggregate of the EU? Individual states in the US compare favorably to nations in Europe, or neutrally. And how do you correlate this data vs for example the Srebrenica massacre?
      • Advanced: I suppose it depends on how you measure advanced. On the one hand, we've got 48% who don't believe in evolution. How does that correlate to poverty rates? Poverty and ignorance go hand in hand, after all, and we decidedly don't have the socialist economy that is found through so many parts of Europe. On the other hand, we inherited our religious idiocy from Europe, but by being one big country we avoided the trauma that 2 world wars brought to europe and followed it up by providing the most advanced military defenses to all of western europe for 40 years and rebuilt the area. How do you reconcile this information? Note: you're not really allowed to ignore the religious craziness without dealing with the influence of that craziness in rebuilding Europe after the war, we could have just left you for dead.
      • Terrorism: Spain and the UK are both on board in our war against terror. Italy was until they caved to terrorists holding some italian reporters hostage. If you break it down by population percentage, there's very little doubt in my mind that you'll find the EU looking any different than the US in this irrational fear.

      Face it, Europeans aren't in any better shape than the US. You just get to hide behind this half-implemented union, where we are 50 united states. So you get to play with the numbers and say "Well, Germany's obviously better than the US". Yeah, try comparing Germany to Massachussetts. Better yet, let's talk about Russia and Chechnya, and all the other little border conflicts going on over there.

      The bottom line is that all this US-hating isn't doing any good either, but I guess you figure if you hate the US, you're doing good for the world. Nevertheless, you are part of the reason we're on a roller-coaster that likely ends in WW3.

      --
      Like what I said? You might like my music
    9. Re:America the Great by Mark_MF-WN · · Score: 1

      The bottom line is that all this US-hating isn't doing any good either, but I guess you figure if you hate the US, you're doing good for the world. Nevertheless, you are part of the reason we're on a roller-coaster that likely ends in WW3.
      That is possibly the most ridiculous suggestion that I've ever seen on Slashdot. My contempt for Americans (and other assorted religious fanatics, anti-intellectuals, warmongers, and basically anyone who use words that refer to liking freedom in the pejorative) is going to bring about WW3? I'd say that wars are more likely to be caused by people that are so blinded by naive patriotism that they regard any criticism of their country as a stepping stone to the apocalypse.

      Besides, you're doing exactly what I pointed out in my original post. You've noted that there is at least one country on the whole planet that is worse than America in some particular way, and somehow conclude that America is the greatest nation on Earth, rather than the more reasonable conclusion that America is simply not the worst. I don't know about you, but when I was in school, knowing that there were a few kids in the class who got worse marks than I did was NOT enough to make me feel good about my grades. Being in the top five? Sure, that felt great. Being smarter than the boy who eats paste? Not so much. Only losers take pride in outdoing the kid who eats paste. But if that works for you, why not go down to the bad part of town and take pride in the fact that you're not a homeless drug addict, or in jail getting rammed? I mean, you're not the WORST citizen in the entire union, right? That must make you the best.

    10. Re:America the Great by Mark_MF-WN · · Score: 1

      I'm suggesting that anyone who doesn't live in an Islamic Theocracy or a third world country is already superior to most Americans. Besides, did I claim that my home is the BEST nation on Earth, the home of the brave, the land of the free, or any other blatantly false pseudopatriotic drivel? Americans make precisely those claims with NOTHING to back them up ... anymore. Back in the 50s people might not have laughed at that bullshit, but now it serves as nothing more than a mockery of what America used to be. And then American go and vote for an illiterate religious fanatic who repeatedly claims to speak the word of God ... something that usually only Muslims are stupid enough to do. They allow their government to spend tax money on "faith-based initiatives". Yeah, THAT'LL balance the budgets. PRAYING. Prayer can't even cure the common cold, and yet Americans vote for a guy that thinks that prayer will keep the economy from crumbling further. They hand over their money to evangelists to secretly spend on male hookers and crystal meth. They send their children to camps that will supposedly stop them from being gay. They make their daughters sign "abstinence pledges" that statistically decrease the age at which those children will begin having sex. They buy SUVs in order to feel safer while driving, even though SUVs are more dangerous for the driver, and then have the GALL to whine about the price of gas; and they ignore the fact that those SUVS are extraordinarily dangerous to other people, particularly low-to-the-ground people like children (to be fair, my home country has been infested by SUVs too, although I've yet to catch anyone who drives one being crass enough to even mention gas prices).

    11. Re:America the Great by fucksl4shd0t · · Score: 1

      That is possibly the most ridiculous suggestion that I've ever seen on Slashdot. My contempt for Americans (and other assorted religious fanatics, anti-intellectuals, warmongers, and basically anyone who use words that refer to liking freedom in the pejorative) is going to bring about WW3? I'd say that wars are more likely to be caused by people that are so blinded by naive patriotism that they regard any criticism of their country as a stepping stone to the apocalypse.

      No, your individual contempt is going to do nothing. It's the aggregate of all of the contempt of people who agree with you that is going to do these things. But don't let historical facts such as previous world wars stand in your way. Your now self-admitted prejudices are identical in feature and how they influence your behavior to the very behavior you are complaining about in other people.

      You've noted that there is at least one country on the whole planet that is worse than America in some particular way, and somehow conclude that America is the greatest nation on Earth, rather than the more reasonable conclusion that America is simply not the worst.

      I'd be interested in how you drew that conclusion, seeing as how I didn't give it. If I weren't some anonymous slashdot poster, you'd know better. I want to see the same attitudes in the US changed, but I'm willing to bet that I've had more success with less hateful and condescending methods than you have. I mean, how many americans have you influenced away from the point of view you're complaining about? Now compare it to me (I live in central Texas, so there's plenty of opportunity). You can't, of course, because you don't know what you're talking about.

      Now instead, let's consider what I was actually saying. I was actually pointing out where European nations have done exactly the same things you hate the US for. Do you hate Europe, then, too? What do you come up with? Oh, that Europe isn't in a position to be taking such a condescending stance about America, and that in fact you can't even say that all of europe has this stance. NOt without lying, at least. Because the so-called coalition of the willing contains European nations. The real problem here is that many of us here in America have our own brothers and sisters, friends and countrymen going off to fight a war we don't think should be fought in the first place. And you're not helping. We want the US to be better than it is, but people like you who try to point to Europe's long history of being nothing but good citizens in the world are part of the problem. Be part of the solution. You judge the people when you should judge the behavior.

      --
      Like what I said? You might like my music
    12. Re:America the Great by Mark_MF-WN · · Score: 1

      What on Earth does being advanced NOW have to do with wars that took place over half a century ago? Like it or not, Americans ARE falling behind in science, and they ARE falling behind in technology. And it has NOTHING to do with the Roman Empire, other than maybe in the sense that the Roman Empire collapsed and left its members states in the dark ages.

    13. Re:America the Great by Mark_MF-WN · · Score: 1
      Unfortunately, it's that small minority that run the country, and which present America's outward appearance to the world and inward appearance to itself.

      The average American is almost indistinguishable from the average Canadian, and is only distinguishable from the average Australian or Brit because of the accent. But ask someone what Americans are like -- and you cna even ask an American this -- and they'll describe someone that is a bizarre and insane cross between Pat Roberston, Rambo, Richard Nixon, Eddy Veder, and ... I'm trying to think of an ultraliberal flake, but unfortunately I don't know any by name (which is probably for the best, actually).

      It's the same in most nations, of course. The average Afghani or Iranian just wants to live his life, look after his family, and not get shot. Many of the Nazis were the nicest people you could ever hope to meet, and just wanted to make their country strong and whole. But shit always floats to the top... and the Taliban, the Reich, and the Union all seem to have forgotten to flush.

    14. Re:America the Great by fucksl4shd0t · · Score: 1

      Where's my "missing the point" button? Most of the wars I've mentioned have taken place in the last 100 years, and I mentioned several that have happened in the last 20 years. I've cited current events, even.

      I guess I'll spell it out for you. The events of the 20th century traumatized Europeans to a point where they are now capable of behaving in a way that seeks peace first and foremost. Those same events had a completely different affect on the US. They provided a way for the US to be everything that's good about the US and ignore everything that's bad about it, while simultaneously holding onto it's religious viewpoint. That religious viewpoint was inherited from Europe, we didn't invent it. But the events of the 20th century have given Europe as a whole (but evidently not you) a more useful and pragmatic point of view. Nevertheless, it didn't stop certain other really nasty events that happened in Europe, as I said, within the last 20 years, so evidently you guys have some ways to go before you achieve your ideal.

      What events am I talking about? It's easy to see I'm referring at least in part to the two world wars. I'm also talking about the Cold War, where the US showed the world that being the most technologically advanced nation was quite a bargaining point when dealing with totalitarian nations. We also got to do something scientific on a scale that had never been done. While we rebuilt western Europe by applying democratic and capitalistic ideals, the Soviets rebuilt eastern Europe by applying their own ideals. When you compare the two, it's pretty clear that democracy and capitalism are better than whatever the soviets were doing. Yet, Europeans already knew that unbridled capitalism was wrong and continued to search for something else. (Note that all the labor movements initiated in Europe, the American labor movement started late)

      Why does it matter? I'm sure you've heard statements about knowing history and repeating it, so I don't need to throw that at you. Europe is in fundamentally a different position than the US. There is still a great deal of competition within Europe as a whole, and after that Europe has to compete in the world. The US doesn't have that at all. We have to compete in the world, but we're not competing amongst ourselves. We're not trying to show that Texas is better than Oklahoma, or whatever. At least, not at the scale where Germany is trying to win trade and has to compete against France to get it. If Texas wins trade over Florida, Florida still benefits by it. But if Germany wins trade over France, does France benefit by it?

      That competition is a factor in current European development, full stop. Reread that. We don't have that competition in America, not even with our Canadian friends. Also, besides the competition, you're ignoring how much of the base that Europe is working from *now* came from the US. It's easy to say "The US is falling behind", but it's much harder to accept that in light of the fact that without trade from the US, Europe wouldn't be anywhere near where it is now. So is the US falling behind? Or is the population of Europe (4 times the population of the US) just being more productive?

      And as I said, which you have not attempted to refute, there appears to be no study of Europe that actually compares Europe as a whole to the US. So you're comparing individual states that you get to pick and choose to the entire US. Try comparing just east Germany to the US, do you still get the favorable comparison you want? Compare Poland to Utah, how does that look? Now compare Poland to California. We have diversity in the US that isn't matched by any single European country. How does the percentage of Europe that believes in creationism compare to the US? What does the Pope, a European, really think?

      --
      Like what I said? You might like my music
    15. Re:America the Great by Mark_MF-WN · · Score: 2, Interesting
      1.) Where, exactly, did I suggest that Europeans are good world citizens? I wouldn't even say that my own country (Canada) is a particularly good world citizen. We support WTO policies that impoverish third world nations. We are taking a very active role in mismanaging the war in Afghanistan, and our soldiers have an unusually high rate of killing civilians even by the standards of that conflict (although nowhere close to what goes in Iraq). We don't intervene when genocide is going on. We allow our own citizens to go homeless, in many cases because of factors that are beyond their control but are well within the capacity of society to solve -- like certain easily-treated psychiatric disorders, or simply being too disabled to work in a part of the country where even shared housing is too expensive to afford on a social-assistance cheque that hasn't seen a cost-of-living increase since the 80s. Our leaders almost never speak out against destructive American policies, despite being quite possibly the nation with the most capacity to influence America (enablers get no forgiveness).

      2.) Why would I judge the behaviour and NOT judge the people that CHOOSE to engage in that behaviour? Behaviours is just a set of actions -- they have no moral value on their own. It's the PERSON who makes the choices that is good or evil, stupid or insightful, superstitious or rational Judging actions makes no sense. When someone molests a child, we don't put their behaviour in jail, we put THEM in jail. When Rush Limbaugh says that drug addicts should be given life sentences in jail, do you mock his hypocrisy or do you mock the fat blubbering crybaby himself? When people invade a sovereign nation, destroy its infrastructure, slaughter its people, and allow civil war to wage unchecked, you don't hang the strategy book for its warcrimes, you hang the people that made the decisions -- and if you get the chance, you hang the people that supported them.

      3.) You still haven't suggested any way in which my contempt for Americans, even with millions of other people thinking the same way, can have any harmful affect on the world. In fact, you haven't even suggested a way that it can affect the US in any way. You haven't even suggested any reason why anyone would have even the slightest respect for America as a nation in any way. Europeans at least pay lip service to peace, freedom, and equality. England was the only one of the "coalition of the willing" nations to actually deliver more than a busload troops to Iraq, and even then it was against the wishes of nearly the entire population. Since world war 2, Europe has built up its infrastructure and invested in its people, while America has lets its cities collapse into huge ghettos and a few closed communities for the wealthy minority. Most Americans are at the point of considering "liberal" to be a slanderous and derogatory term, and think that the fear of change is a virtue. There is no way to put a positive spin on that kind of insanity.

    16. Re:America the Great by Anonymous Coward · · Score: 0

      Two World Wars? I guess America started it? No, but we had to finish it. Vietnam? I guess we also had to clean up France's disaster. I love all you high and mighty European Union assholes. You think your shit doesn't stink but lets look at your past. Your governments, which turn faster, than a hooker at a fuck fest. More senseless wars than we ever started. Refresh my memory again on who World War I started? How about WWII? Yes you peace loving socially and mentally superior Europeans have a great track record. How about England which is home to more cameras than Canon and Kodak have ever created? How about fighting a war for some islands in Argentina you never would have been caught dead living on.

      I can go on and on about the ignorance and violence that occurs when your favorite football team loses. Let's talk religion and Northern Ireland. Lets talk some more about jailing people who deny the holocaust.

      Face it, throughout history you guys have acted like a bunch of savage animals. 225 years isn't a long time in terms of a country but don't get all pissy because you can't even count on one hand how many failed systems of government you went through in that much time.

    17. Re:America the Great by Mark_MF-WN · · Score: 1
      Actually, the papacy has consistently supported evolution and modern cosmology. They even brought Stephen Hawking in at one point as a consultant to help update and revise their offical stance on the physical nature of the universe.

      It's funny that you mention Canada -- Canada has faced even less warfare than the United States. Canada didn't play much of a role in the pacific theatre in World War 2, avoided Vietnam and Iraq-II altogether, avoided the bloodshed of revolution or civil war, and has never deposed a democratic government in order to set up a military dictatorship in a South America OR the middle east. Canada even managed to not give money and weapons to the Taliban during the cold war, unlike the US. Canada is even more united the USA despite the fact that the last province joined just sixty years ago; competition within Canada is practically meaningless, and the population is just over 10% of what America's is. Yet Canadians love peace, have turned away from organized religion in great numbers, love capitalism and socialism and have generally avoided the fallacious notion that they are contradictory notions, etc. Decimation by warfare is NOT a requirement for a people to be reasonable.

      Next you could consider Australia, which has probably faced even less warfare than Canada, has an even smaller population, has been a nation for even less time, and yet even they don't seem particularly inclined to invade Iraq or arrange coup d'etats in Iran or El Salvador. They didn't even give money or weapons to Saddam Hussain.

      Then you could contrast them both with Japan, China, India, Europe, or Russia; various levels of warfare, competition, etc. But never in any of them do you never see quite that same level of irrationality, paranoia, delusion, and baseless pride that you see in Americans. You pretty much have to look to theocracies and despotisms to see anything that even compares, let alone outdoes it. And as has been pointed out, that's exactly what Americans seem to do when they need reassurance that America hasn't reached rock-bottom.

    18. Re:America the Great by fucksl4shd0t · · Score: 1

      1) You have to realize, then, that pointing out where the US is fucked up is useless if by doing so you ignore where other countries are fucked up. You ignore the fact that the problems you have with the US are a global problem, not a US-only problem. Therefore, a US-only solution isn't just suboptimal, it's useless.

      2) Europe as a whole tried your attitude at the close of WWI, which led directly to WW2. The US, however, tried something different at the close of WW2, and it has led to what I truly believe is a better world. Take it as you want, but you can't both complain about how your government denies psychiatric disorders that could be treated while justifying locking up child molestors and *not* treating them.

      3) This is where you've completely missed the point. Rabid nationalism and prejudice caused two really nasty world wars and has quite an influence in the US involvement in Iraq. I'm saying your attitude is identical to the attitudes of the Americans around me that think we should be doing what we're doing in Iraq. It's also the same attitude that was adopted en masse during the French revolution, the founding of the German Empire, and led to 3 major, destructive wars in Europe. If you can't see how your attitude is bad, then there's nothing I can say that's going to show you.

      --
      Like what I said? You might like my music
    19. Re:America the Great by fucksl4shd0t · · Score: 1

      Heh. You are aware that the US tried your isolationist approach before and it didn't work?

      Don't take this the wrong way, but the only reason Canada and Australia aren't considered "third world" is because they have engaged in good relations and a great deal of trade with the US, UK, etc. If they hadn't, they'd both be just as backwater as Iraq, Vietnam, or anyone else you'd care to name.

      You can't celebrate Canada's ability to hide when the bully rears its head without acknowledging that the US goes out to face the bully. The same reasons we try to do good in the world are the same reasons we do bad in the world. What would the world look like if we didn't do the good things we do? (keeping in mind that Canada would stay on the sidelines in that world, too)

      --
      Like what I said? You might like my music
    20. Re:America the Great by Rakarra · · Score: 1
      Americans are terrified that terrorists are out to get them, despite the fact that terrorism kills fewer Americans each year than the flu, fewer than cancer, fewer than suicide, fewer than murder, fewer than automobile accidents, fewer than natural disasters, etc. That pretty much makes Americans irrational cowards. So much for the "home of the brave".

      It sounds like you are neither American, nor know many Americans. I don't personally know any fellow Americans who are "terrified that terrorists are out to get them."

      Only a handful of Islamic Theocracies have people that are in less acceptance of evolution than America; not to mention the way Americans disbelieve scientists about every other subject as well. The universe is 13.2 billion years old? Of course not! The grand canyon proves the Genesis story! So much for advanced.

      Oh, I'll certainly admit that the US has its share of stupid people. Especially in certain.. *cough*cough* sections of the country.

      America rather consistently loses wars against third-world countries. Very impressive, and definitely great. Then they criticize the rest of the world for not being stupid enough to get on board for the big defeat. So America is simultaneously weak (for losing), stupid (for going to war in the first place), and petty (for getting mad at nations run by rational, literate people).

      I hope you're not proposing that the Korean and Vietnam wars were fought against the Koreans and Vietnamese. They were proxies at best, especially in Korea.

    21. Re:America the Great by Anonymous Coward · · Score: 0

      "US goes out to face the bully." Except the "bully" is really and effectively a weak, disabled, anorexic and poor. US only picks the weakest of targets, with the least amount of allies and wealth to attack. Your analogy is far from accurate.

    22. Re:America the Great by EsbenMoseHansen · · Score: 2, Informative

      I was curious about the murder rates, so I looked it up with google.

      First, are you in one of those countries that has a major political party with the word "Christian" in the name?

      Yes, but they didn't make the low limit (4%) last election, for the 2nd time in a row, I think. (Sorry couldn't resist)

      Highest murder rates: Has such a study been done on the aggregate of the EU?

      From around 2000, US seems to be about 6 per 100000, EU about 1.6 per 100000.

      Individual states in the US compare favorably to nations in Europe, or neutrally. And how do you correlate this data vs for example the Srebrenica massacre?

      Srebrenica is in Bosnia, which has not been and is not a member of EU.

      --
      Religion is regarded by the common people as true, by the wise as false, and by rulers as useful.
    23. Re:America the Great by fucksl4shd0t · · Score: 1

      I guess you forgot about the Cold War.

      --
      Like what I said? You might like my music
    24. Re:America the Great by fucksl4shd0t · · Score: 1

      Yeah, I got curious too and went looking, but I couldn't find a number for the whole EU. :/ Thanks, I was genuinely curious. :)

      On Srebrenica: Give me some credit for European unity! ;) Member states in the EU, afaik, haven't done anything nasty in years (at least, not as far as something that might affect the murder rate), and I was reaching for something to make the point that everything's not fine and dandy in Europe. I thought Germany had a Christian Democratic Party or something that had 1/3 representation in Parliament?

      Anyway, my point in another post somewhere in this thread is actually supported by the murder rate numbers you've got. But that's if these are the only facts considered. Do you happen to have numbers for the last 200 years? (I found such numbers for parts of the US going back to 1797) My point is made if you have numbers that show a much higher murder rate for the EU states, particularly the ones that participated in WW2 (since most of the WW1 states were dismantled) before the relevant conflicts, and it gets stronger if you can show comparable murder rates before WWI, and a lower murder rate around 1800, or some other year that's inarguably before the rise of nationalism.

      And yeah, until the guy said he was in Canada, my impression was that he was European. The only people I've encountered that get that vitriolic about the US have been europeans.

      --
      Like what I said? You might like my music
    25. Re:America the Great by Ash+Vince · · Score: 1

      A few points:

      Murder rate is usually given as per capita so aggregating all of europes would still leave the US on top.

      Spain left the war on terror after the Madrid train bombings.

      --
      I dont read /. to RTFA, I read /. to offend people in ignorance.
    26. Re:America the Great by Anonymous Coward · · Score: 0

      Russia and Chechnya? USA should compare it self with similar countries. If you insist on comparing neighbours, why not include Mexico in your defence of American values...

    27. Re:America the Great by fucksl4shd0t · · Score: 1

      Aggregating all of europe wouldn't be useful, what I want is a list of EU countries that can be compared to US states, because there are US states that have lower murder rates than even Canada. My point is that it's not fair to compare a country like Germany to the US because Germany's too small by comparison, so the comparison isn't useful nor is it intuitive. Then, after recognizing that there are states that compare favorably, depending on how you draw the comparison, it should be easily possible to recognize that you can't generalize the actions of one group of Americans to judge all Americans, we're just too diverse. Kerry won enough votes to show that many Americans were willing to elect someone who's only claim to fame was that he was "not bush". That means something. Then we elected enough Democrats to take both Houses. That, too, means something. So generalizing all of Americans as being dumb nationalists isn't accurate, and blaiming religion for it is just plain bad thinking. Some critical thought to the article (assuming it's not an April fool's prank, I didn't read it, I just thought the number was a bit higher than the last number I saw, which was near 20%) and to the conclusions drawn based on the article would go a long way.

      I didn't know Spain left the war on terror after the Madrid bombings, but truth to tell, I didn't know they were involved until the Madrid bombings. :) I think the whole war on terror is more complex than the guy I was arguing with is presenting, I don't think it can be summed up as "just an irrational fear".

      And one part of it is that I think the problems people have with the US are global, it's just that the US is easiest to single out right now. But it's just plain not smart to use the US as a scapegoat. Fix the US and some other country will come along and do Bad Shit. Fix the world.

      --
      Like what I said? You might like my music
    28. Re:America the Great by fucksl4shd0t · · Score: 1

      2 reasons. 1) Any objective comparison would make the US look good, and 2) living in Texas as I am, you would just say I was biased anyway.

      I wasn't comparing Russia and Chechnya anyway. I was comparing Russian imperialism and American imperialism, and Russia was acting as proxy for all of europe.

      --
      Like what I said? You might like my music
    29. Re:America the Great by EsbenMoseHansen · · Score: 1

      Yeah, I got curious too and went looking, but I couldn't find a number for the whole EU. :/ Thanks, I was genuinely curious. :)

      Searching the web takes luck as well as skill :*)

      On Srebrenica: Give me some credit for European unity! ;) Member states in the EU, afaik, haven't done anything nasty in years (at least, not as far as something that might affect the murder rate), and I was reaching for something to make the point that everything's not fine and dandy in Europe. I thought Germany had a Christian Democratic Party or something that had 1/3 representation in Parliament?

      Sounds about right. I have no idea whether they are actually very christian or if it is just something in their name, but I'd guess the latter. (Ask a German or wikipedia if you really want to know :) ).

      Anyway, my point in another post somewhere in this thread is actually supported by the murder rate numbers you've got.

      I'm sure, but forgive me for not finding the appropriate post :)

      But that's if these are the only facts considered. Do you happen to have numbers for the last 200 years? (I found such numbers for parts of the US going back to 1797)

      EU was founded in the 1992. It's predecessor was founded in 1957. Even the 2001 numbers are odd, because the union has grown since then. EU is a very young union compared to US, though it's memberstates are curiously enough much older. But no, I have no data going back 200 years... I'm sure it is out there, but there is no obvious aggregation so far back.

      My point is made if you have numbers that show a much higher murder rate for the EU states, particularly the ones that participated in WW2 (since most of the WW1 states were dismantled) before the relevant conflicts, and it gets stronger if you can show comparable murder rates before WWI, and a lower murder rate around 1800, or some other year that's inarguably before the rise of nationalism.

      The differences in murder rates are most likely correlated to US having a big poor population and easily available weaponry, but I am no expert.

      And yeah, until the guy said he was in Canada, my impression was that he was European. The only people I've encountered that get that vitriolic about the US have been europeans.

      --
      Religion is regarded by the common people as true, by the wise as false, and by rulers as useful.
    30. Re:America the Great by koreaman · · Score: 1

      There are a lot of retards in the United States, but that doesn't mean all of us Americans are. If you had a country a third of whose population lived in rural areas, and who had been founded by religious extrimists instilling a long tradition of protestantism, you'd probably have similar problems.

      By the way, there are a lot of idiots in Europe, too, in America we just happen to have something even better: brainwashed idiots.

    31. Re:America the Great by sumdumass · · Score: 1

      Here is an article that talks about some of the differences in crime rates between the US and Europe.

      Some murders aren't reported as such and some are counted differently. We had the same problems in the US when comparing crime statistics between different states which eventually lead to a single federal rules of reporting and tabulation. Without taking these differences into consideration and accurate comparison cannot be made.

    32. Re:America the Great by Anonymous Coward · · Score: 0

      I love internet bred eurotrash cowards

    33. Re:America the Great by janrinok · · Score: 1

      The Falkland Islands are NOT in Argentina - try looking at a map. 'Wouldn't have been caught dead living on....'. The vast majority of the Falklands are descendants of Welsh farmers. The islands are British. Why wouldn't we fight to defend them? Would the US have left Americans to be subjugated if the FI had been US territory? In fact, you often seem to get involved in other countries wars when you have no clear justification for doing so, but I will leave that for another discussion. As for the US ending both world wars. I agree that the US contributed greatly to WW2 and that success would not have been possible without US intervention and support. But Russia lost 25 million dead in WW2, far more than the US has ever lost in all the wars that it has ever taken part in. I think that you will find that Russia's contribution should perhaps be considered as more statistically important than that of the US, although perhaps your politics will never allow such a thought to be publically acknowledged.

      --
      Have a look at soylentnews.org for a different view
    34. Re:America the Great by Anonymous Coward · · Score: 0

      Of course, we (Americans) are not all like that. Though, something seems to have happened in the past 15 years, while I was in college and starting a career. When I was in high school, some teens went to church regularly and some did not. And nobody really cared. It was just a place where some chose to go and others did not. Now, however, there seem to be a lot that go to church and they seem to put a lot of pressure on those that do not. (Mostly pressure in an encouraging, fun way, not in a "you are a sinner" way).

      The tide seems to be sweeping more to the conservative right than ever before. But what is enabling this large shift? The new communications mediums? The dense populations of modern communities? A fundamental movement at the core of the church? January 2009, can't get here fast enough, but I don't think Bush holds that much influence, though he has served as a fine figurehead for the religous masses.

      But you are right. Somewhere, many years ago, greed and arrogance got a good foot hold. Now, they are not only embraced, but embedded in the core of american culture to the point that americans can't even see it. It's not like this for everyone, though.

      We have friends that are religious nuts, and we simply can't understand them.
      We have friends that are religous, have a relation ship with God, but live by respect, not doctrine.
      We have friends that abhor the church and have a great deal of problems from growing up around it.
      We have friends that are on their own spiritual journey, and are doing well with it.

      "American go and vote for an illiterate religious fanatic who repeatedly claims to speak the word of God"

      My question for those who follow the word of God is this...
      Did you ever study Greek/Roman mythology in school?
      Do you think they were silly for believing in mythological dieties?
      If you think mythology is so stupid, why is that the core of your life?

    35. Re:America the Great by BgJonson79 · · Score: 1

      Yeah, but aren't we all the same? Are you implying that some countries are better than others? That's awfully racist!

      --

      There are four boxes used in defense of liberty: soap, ballot, jury, ammo. Use in that order.

    36. Re:America the Great by sumdumass · · Score: 1

      The "deity litmus test" does prove something: it proves that a group of people reject empiricism and will believe in mythology -- no matter how many of the claims in that mythology are categorically false.

      It is interesting because the alternative you suggest them to believe in is more or less the same thing. I mean evolution has detractors inside it's own camp let alone elsewhere. And quite frankly, all evolution is revolves around taking guesses at parts of missing history when we find fossils and such. There is no fact involved with evolution outside the facts that animals adapt to their surroundings. Everything else is an unobserved guess based on what we want to know because it makes sense. All the Deity litmus test would prove is who's stories are someone going to believe over yours.

      We're not talking about whether people believe in some arbitrary omnipotent being. We're talking about people believing specifically in the Christian God.

      I can tell you have a problem with a specific type of religion. It is the type of religion more or less and not the GOD of that religion because it is the same god as several other religions too. You don't have a problem with their rendition of him.

      A god who supposedly said things like: "Ask, and it shall be given you." This is clearly an outright lie. So anyone who believes that the bible is anything other than fiction is believing something that they KNOW is untrue. That directly contradicts scientific thinking. "Behold, I give unto you power to tread on serpents and scorpions, and over all the power of the enemy: and nothing shall by any means hurt you." Another statement that Christians believe, even though Christians are routinely killed by natural causes, by each other, by non-Christians, by animals, etc.

      I'm not aware of the specific places this was said in the bible nor the context it was used in. And Yes, just because it is written in the bible doesn't mean it is true verbatim. More specifically, I am not aware of any ask and you shall receive that isn't specifically addressed to a particular charector in the bible. Same with the treading on snakes or whatever. I guess your taking this out of context and believing in something false places you along the same lines of these Christians you hate.

      I know, I know, You have some example of one group out of the thousands of different Christian denomination who have agree with you and using this example is much easier to generalize about every group of Christians and it is easier for you to hate them all then find points with each one of them. This is understandable. Other haters do the same, the KKK made it famous and popular to do this while your tone more or less resembles the Neo-Nazis movement in the northern isolated states.

      Americans are terrified that terrorists are out to get them, despite the fact that terrorism kills fewer Americans each year than the flu, fewer than cancer, fewer than suicide, fewer than murder, fewer than automobile accidents, fewer than natural disasters, etc. That pretty much makes Americans irrational cowards. So much for the "home of the brave".

      Well, for one, Americans aren't terrified at all by them. Sure you could find someone but then that goes back to the entire thing i talked about above. But maybe I should ask, Suicide takes less lives each year then the Flu, or Cancer, should we just forget about that too? I mean if we forget about terrorist because they take less lives each year, then we will have another bottom rung, so what would make suicide important enough to care about? And then once that is off the list, how about heart condition or something else that we can stop looking at because it doesn't claim as many lives as the top three killers. This makes no sense at all.

      But if you must see a difference between the issues, then I would say the difference is that the other diseases and are

    37. Re:America the Great by rodia · · Score: 1

      >You can claim the other industrialized nations are more advanced than the US after the two most destructive wars in history have been fought in the US and primarily by the US.

      In case this includes WWII, here are some numbers about military deaths:
      Soviet Union: more than 10 million
      Germany: 5.5 million
      China: 4 million
      Japan: 2 million
      USA: 400,000

      In Europe, WW II was not primarily fought by the US. And if I were Russian, I would probably be a bit disappointed every time I hear an American say it.

      bye, r.

    38. Re:America the Great by fucksl4shd0t · · Score: 1

      So you're saying that I was right, and that the guy can't claim other nations are more advanced than the US without considering that those other nations have had more traumatic experiences that changes their attitudes fundamentally that the US hasn't had?

      Thanks! :) That's exactly what I was saying!

      --
      Like what I said? You might like my music
    39. Re:America the Great by Anonymous Coward · · Score: 0

      It's hard to keep up with all those ridiculous blanket statements. Americans are all weak, stupid, petty cowards? Americans are all Christian fundamentalists? America is nothing more than a society of monsters just because we have a high murder rate? Yeah, okay, that's a logically sound argument.

      I think you've got it backwards. Sounds like America is YOUR imaginary enemy.

    40. Re:America the Great by Anonymous Coward · · Score: 0

      Gawd, what ignorant Euro-trash you are.

      It's no wonder your side of the planet is so screwed up.

      In the next world war, we should just let you shrivel up and die.

      But we won't. Because we're bigger than that. As usual, we'll save your sorry butts just to hear you whine about it for generations.

      That's the price we pay for being the land of the free and home of the brave.

      Sucks to be you (and your effin farterland).

    41. Re:America the Great by Phyvo · · Score: 1

      Interesting, but the ways you interpret those verses show that you are ignorant. The Bible is not Poor Richard's Almanac, where each sentence is independent of any other and completely straightforward. Christians, in general, do not believe what you just said they do, and interpret those verses in a different way which isn't rooted in taking them out of context and applying rash literalism. When Jesus said "eat my flesh" he wasn't endorsing cannibalism. You're also demonizing Americans. It's healthy to be able to point out some of the faults of a society, but you're making overarching generalizations about the whole populace as if Americans were all religious republicans who want to usher in a fascist state, making America exactly like Iran. Frankly, America does not "closely resemble" Iran. There is some truth in what you say; America is more religious than most European countries. But you're blowing everything out of proportion.

    42. Re:America the Great by cyphercell · · Score: 1

      You keep talking about the 50s like it was some golden era of American contribution, it was, but why? It was a golden era of contribution because there was about two industrial nations that weren't still war ravaged and rebuilding their infrastructure. I've worked in a saw mill, I lost my finger and comparatively it paid about one fifth what it paid in the fifties. I know plenty of people that work just as hard as any man did in the fifties and you know what, the manager at McDonalds makes the same. It's just not profitable any more, because we no longer have a monopoly on infrastructure, that's why we need to control things like oil, it's because our economy was built on a world that doesn't need us like they used to. Now I'm not saying that our war in Iraq is the right thing to do (cause it isn't), just that I understand why they would do it. Not to mention that every war we've had in the middle east is easily traceable to WWII, hell I can't think of a war that the US has been in since WWII that didn't result from WWII. Now the EU gets together creates the Euro which easily becomes stronger than the dollar and people like you come out of the woodwork talking about how the US is finally getting what it deserves. You're sick, we aren't the greatest nation on earth we never were, we're just one of the industrial nations that was left after WWII. Currently our leaders are tasked with letting our country degrade gracefully or clinging and fighting to maintain number 1. It's obvious which camp Bush comes from, but at the same time he could just ignore it and let our nation slip into astronomical poverty almost assuring WWIII. Yea he invoked way too much religion in his plans and that sickens me, but the fact that he got away with it is really just a testament to how bad things may actually get. He's been compared with Hitler and if our unemployment rates had risen about 20%, I think that's exactly how he would have been remembered. I think our nation (generally) realizes this and will at least make adjustments for our next election, but the next president will not be popular in the US as the best thing for us right now is to build international relations at the expense of our industry without letting unemployment go into a landslide. We are struggling for our place in a global economy, we just have more to lose while the rest of the world has more to gain. This is decidedly not our fault, it's just something our nation is tasked with, we may make catastrophically wrong decisions, we may make remarkably insightful decisions at critical points, or we may just drift out of the picture into mediocrity like the rest of the industrial world. You can look down your nose at me all you want, all it proves to me is that you have an extremely shallow grasp of politics and rely mainly on inflammatory rhetoric much like George W. Bush, inciting hatred disgust and fear to serve your means, the difference being that you do so without an end goal, without purpose, and without cause. You are nothing less than a Nazi sitting on a soap box.

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    43. Re:America the Great by Mark_MF-WN · · Score: 1

      You keep talking about the 50s like it was some golden era of American contribution, it was, but why?

      I'm referring to everything BEFORE the 50s. Like WW2, or the revolution -- both very "brave" acts. America didn't need to get involved in Europe during WW2; a strong navy would have been more than enough to protect North America indefinitely. The US didn't need to revolt against the British -- it actually made American taxes much higher and made Great Britain even richer than before, minus the cost of the conflict itself. Americans were leaders in industrialization, and practically reinvented the idea of capitalism -- both of which qualify as "great" by most estimations.

      I know plenty of people that work just as hard as any man did in the fifties and you know what, the manager at McDonalds makes the same. It's just not profitable any more, because we no longer have a monopoly on infrastructure, that's why we need to control things like oil, it's because our economy was built on a world that doesn't need us like they used to.

      The problem isn't that the world doesn't need America. Most nations don't really need each other. Trade is nice and all, but most countries can produce enough food to feed their people, enough cotton or wool to clothe them, and enough housing to stash them all somewhere. But Americans are so sickened by the idea of anyone getting something with working themselves half to death first, that they insist on making most people do meaningless nonsense jobs like working at Macdonalds. The rest get jobs micromanaging them. The service industry is economic death, because it keeps people out of genuinely valuable and practical jobs like resource acquisition, manufacturing, and research. Farmers actually produce value for society. Everyone would be better off if the people working at Macdonalds just went on welfare and people went and got their own damn burger. Yet Americans keep pushing more and more people into the service industry.

      I think our nation (generally) realizes this and will at least make adjustments for our next election, but the next president will not be popular in the US as the best thing for us right now is to build international relations at the expense of our industry without letting unemployment go into a landslide.

      Why not let unemployment rise? There isn't any evidence that it's actually a bad thing, assuming society has a good social support network (which the US doesn't). It's a natural way for economies to adjust and rebalance themselves. Unemployment periodically rises, which results in lots of people going off and getting higher educations, and more people trying to start new businesses, etc.

      Of course, your claim that Americans realize ANYTHING other than who the next top model is, or what they think of the latest celebrity adoption story, is ridiculous. Americans realize nothing. They'll vote for another demagogue just like they always do, and the nation will keep crumbling and millions more people will die. There's no way around at this point. Modern Americans, in general, are virtually incapable of learning from their mistakes or behaving rationally.

      The difference being that you do so without an end goal, without purpose, and without cause. You are nothing less than a Nazi sitting on a soap box.

      Technically, Nazis have purpose, end goals, and causes. If I do, as you suggest, not have those things, then I'm pretty much the opposite of a Nazi. At worst, I'm an opinionated loudmouth -- which should warm your heart, as those are the traits that Americans are most fond of in people. More realistically, I'm a disillusioned westerner who cares more about the hundreds of thousands of people that are suffering and facing civil war because of America than I do about Americans. The poverty and economic ruin that America is facing would be a blessing compared to what the people in Iraq are facing on your account.

      S

    44. Re:America the Great by Mark_MF-WN · · Score: 1
      Did Americans elect a president who repeatedly claims that he speaks the word of God, or didn't they? Did they elect a president who said that Atheists should not be considered citizens, or didn't they? Did they elect a pedophile to congress, or didn't they?

      Pat Robertson is a personal advisor to the current administration. That's ALMOST as bad as the Reagans consulting with astrologers ... almost.

      • "Don't use the word 'gay' unless it's an acronym for 'Got Aids Yet'". -- Bob Dornan (Rep. R-CA).
      • "God told me to strike at al Qaida and I struck them, and then he instructed me to strike at Saddam, which I did, and now I am determined to solve the problem in the Middle East. If you help me I will act, and if not, the elections will come and I will have to focus on them." -- George Walker Bush (President).
      • "We don't have to protect the environment, the Second Coming is at hand." -- James Watt (Secretary of the Interior).
      • "The New York Times and Washington Post are both infested with homosexuals themselves. Just about every person down there is a homosexual or lesbian." ... "All Latins are volatile people. Hence, I was not surprised at the volatile reaction." ... "Your tax dollars are being used to pay for grade-school classes that teach our children that cannibalism, wife-swapping and murder of infants and the elderly are acceptable behavior." ... "Homosexuals are weak, morally sick wretches." -- Jesse Helms (Sen. R-NC).
      • "Civilized people - Muslims, Christians, and Jews - all understand that the source of freedom and human dignity is the Creator." -- John Ashcroft (Attorney General).
      • "I'm an old-fashioned woman. Men should take care of women, and if men were taking care of women today, we wouldn't have to vote." -- Kay O'Connor (Kansas Senate Republican).
      • "George Bush was not elected by a majority of the voters in the United States, he was appointed by God." -- Lt. Gen. William G. Boykin.
      • "For the first time ever, everything is in place for the Battle of Armageddon and the Second Coming of Christ." -- Ronald Reagan (President of the United States).
      Americans VOTED for these people and for their political parties (except for William G. Boykin, he's in the military, which is even scarier). The kinds of claims I make are NOT exaggerated, not one bit. Americans are happily following evil, terrifying people, and giving the power of life and death over everyone on Earth.
    45. Re:America the Great by Mark_MF-WN · · Score: 1

      It's odd how, despite the fact that I CLEARLY condemn Iran and other Islamic Theocracies, you seem convinced that I think they're great. I hate America for the same reason that I hate Iran. So Iran gives explosives to terrorists in Iraq -- that's bad, right? Of course. But somehow you can defend America giving explosive to terrorists in Afghanistan so that they can fight the USSR? Or giving weapons to Iraq so that they can invade Iran? Or supporting genocidal regimes in South America? America and Iran DESERVE a war with each other. They have the same religious fundamentalism, the same tendency to encourage and support terrorism, the same pointless belligerence. Seriously, I hope you're looking forward to that war as much as I am, since you're going to be footing the bill. Plus, you'll probably get to pay to have Iran rebuilt, although Halliburton will keep most of the money and do very little actual reconstruction (funny how Iraq doesn't seem to have any of that awesome reconstruction going on, despite billions of dollars in public spending...).

    46. Re:America the Great by Mark_MF-WN · · Score: 1
      There's no reason not to provide child molestors with psychiatric treatment. After all, they are quite clearly mentally ill. The mistake that stupid people make is to suppose that acknowledging that pedophiles have a mental illness means that you should just let them go. Half the problem with western criminal justice systems is that they think punishment is enough, and never try to actually correct the behaviour. These systems just end up being about revenge, and end up doing nothing to make society safer or to rehabilitate criminals. I don't suggest locking up pedophiles as a punishment, I suggest locking them up to protect children. And I suggest hanging George Bush in order to protect the Iraqi people.

      So what attitude exactly was it that Europeans tried? World War 2 was caused by the fact that Germany was imposed with crippling war reparations after World War 1, and suffered under terms of surrender that were destroying their entire society. That's why the US had the sense to help rebuild Germany and the rest of Europe after WW2 (that, and the fact that it served as a form of workfare to keep Americans employed, since Marshall plan dollars had to be spent on American goods).

      Rabid nationalism and prejudice
      have never caused anything more serious than a civil protest or a rally. War is about economics -- period. There are no exceptions. Religion, race, nationalism, and all those things are nothing more than ways to trick people into supporting the war. And people will always be stupid enough to be tricked into suppporting a war by some means. The world wars were caused by economic conditions in Europe (Germany's lack of natural resources / Germany's crippling war reparations), just like the Iraq war is being caused by economic conditions in America (specifically, Halliburton's need for money, and Bush and Cheney's need for kickbacks and benefits from Halliburton).

      You just don't get it -- you think the war in Iraq was caused by Americans hating Iraq or something. That's ludicrous. It's caused by the fact that Americans are a) stupid, b) gullible, and c) religious zealots. So when people like the GOP want to raid the public coffers (in the form of no-bid contracts for reconstruction projects in Iraq), they can always trick the people into supporting them -- particularly by playing to their religion. Even for the most reasonable people, religion creates a chink in their mental armor through which stupidity and irrationality can enter.

    47. Re:America the Great by Mark_MF-WN · · Score: 1
      Nationalist -- it's awfully nationalist. Like, if I suggest that the people living on the reservation outside town are a bunch of jobless gas-huffing losers, I'm not being racist. I'm attacking that society (which is an undeniably shitty one). Most native Canadians don't live on reservations -- they have perfectly normal lives, perfectly normal jobs, confine their addictions to perfectly normal caffeine and confine their gasoline to perfectly normal automobiles. Similarly, if suggest that Iran sucks hairy goat balls, I'm attacking a nation. I love Persians. My college has lots of hot Persian girls, most rabidly atheist on account of their parents being refugees that fled Iran during the revolution. My manager is Persian, and she brings me Iranian pastries just because she's super nice. Persians are great. It's the nation of Iran that teabags the hirsute scrotums of those most notable members of the Capra genus.

      In order to be racist against Americans ... well, let's just say that it would be more work than even the most bigoted asshole could handle. The sheer number of races and mixed races required would be staggering. That would be a level of hatred so extreme that the racist in question would probably collapse into a singularity of bitterness and selfishness so dense that hate speech can not escape its surface.

    48. Re:America the Great by fucksl4shd0t · · Score: 1

      No, you don't get it at all. Damn Canadian thinks he knows everything and is completely unwilling to be swayed. Sounds like a damn Republican to me. Good bye.

      --
      Like what I said? You might like my music
    49. Re:America the Great by jc42 · · Score: 1

      Here's the deal: stop saying that America is the greatest nation on Earth, the most advanced nation on Earth, the home of the free, the home of the brave, or any of that other bullshit, and MAYBE people will stop pointing out that every one of those claims is a baldfaced lie.

      Well, here in the US we still sorta somewhat have this thing called Free Speech. So all those idiots have a legal right to say such things. This doesn't mean that the rest of us believe them.

      The US isn't a monolithic society in which everyone marches in lockstep and believes the nonsense spouted by our "leaders".

      In fact, a fair number of us do compare ourselves to others. But the results in those cases generally come up mixed, like you'd expect. And those who make such comparisons are rarely if ever heard making such extreme claims. If you just follow the big media, you hardly hear about them at all.

      --
      Those who do study history are doomed to stand helplessly by while everyone else repeats it.
    50. Re:America the Great by Mark_MF-WN · · Score: 1
      Most people are idiots, period. But it's quintessentially American to put those retards into positions of great power. Actually, no. I understand the Roman emperor Nero once made a horse his prime minister or something, and I'm pretty sure that Bush is at least as smart as a horse. Reagan, maybe not so much (anyone who consults an astrologer to guide his decisions should NOT be president).

      My country was actually founded by people willing to slaughter cute fluffy animals and sell their skins to rich suckers. To this day, our economy and indeed, most of our society, is based on selling stuff to idiots (mostly Americans now rather than Europeans). Somehow, that works out to being a very pacifist and liberal society that simultaneously embraces capitalism and socialism, balancing them (not always skillfully) as the needs of the moment demand. But I can certainly see how being founded by the puritans, or indeed any group of violent and murderous religious extremists, could have negative reprecussions. It's like if Al'Quaeda got to form their own country and run it however they liked.

    51. Re:America the Great by sumdumass · · Score: 1

      It's odd how, despite the fact that I CLEARLY condemn Iran and other Islamic Theocracies, you seem convinced that I think they're great.
      I made no inference. All i did was stipulate the reasons for the similarities you noted and then condensed the problems America has with them into a couple of one liners. I did however leave an open ended statement posing the question with my response to an certain answer. However, this make no assumptions on you unless you agree with that answer.

      I hate America for the same reason that I hate Iran. So Iran gives explosives to terrorists in Iraq -- that's bad, right? Of course.
      Good, I think we have a confirmed establishment that you are a hater. Something to be proud of i guess. It doesn't really matter though.

      But somehow you can defend America giving explosive to terrorists in Afghanistan so that they can fight the USSR?
      Yes,I can. They used those weapons against an invading military force. Iran's weapons are being used against innocent civilians in an attempt to persuade them into changing government policy. Thats the key difference here. If the targets are strictly military then it would be a war. When the targets are innocent civilians attempting to go about life, it is terrorism. I'm willing to bet that when someone uses a weapon to blow your wife up in a crowded market to make a statement about your government allowing whaling to continue off their coast, you will see the difference too.

      They have the same religious fundamentalism, the same tendency to encourage and support terrorism, the same pointless belligerence
      It would be nice to get it out in the open. You see, it would make the job in Iraq so much easier. Fortunately, Iran has done some stuff to the British that might bring this about. Our president said we don't want to see violence with Iran but will back the UK in anything it asks for. Unfortunatly, this means that we will be taking an active role in any military actions they purpose. The UK has decomisioned most of their fleet of navy ships and it looks like it would take an entire year before they are ready for action with another year or so to train everyone to their former glory. This is paretly the Americans fault because we have tended to stick it out were they didn't have to and it gave them the impression their war machine wasn't needed. But with the US tied up in Iraq, It will reverse this position and possible take a long time before they go back to depending on someone else and then bitching about what they do.

      As for rebuilding Iraq, the vast majority of what we were going to do is considered done. I don't understand what your talking about were you ht8ink it is funny. It doesn't matter though, I think if you scramble an egg, you have to make an omelet of something with that egg. you cannot throw it out for no good reason. If we goto town with Iran, I don't have a problem with rebuilding it. Personally i think it would make the entire region more stable and i would like to see it happen. I only hope this time, we don't think we are doing some good and try to keep civilian casualties to a minimum. I think we should go full blown, get it done, give it away and get back to our business. Of course, if it wasn't for Iran, we would be out of Iraq by now too. Even though there isn't a set date for withdrawl, the intended and stated goal was to get out as Iraq was able to govern and protect itself. It is strange that the resistance knows this, it hasn't ever been a secrete, yet keeps fighting because we haven't left yet.
    52. Re:America the Great by Mark_MF-WN · · Score: 1
      Free speech is great. Those idiots are free to call America the "land of the free", and I'm free to laugh my ass off when they do, and promptly remind of all the ways in which they are substantially less free than the Europeans, the Canadians, the Mexicans, the Australians, the Japanese, etc.

      But to answer your point, the US actually is remarkably lockstep. Individuals may differ, but individuals are not society. In American society as a whole, you'll be shouted down if you suggest that, say, American soldiers who die in Iraq deserve what they get for agreeing to fight in a war that they KNEW was being started based on lies (frankly, they deserve it for having voted for the Brownshirts in the first place). You'll be shouted down if you observe that the American did every single thing in its power to provoke an attack like 9/11, and is still completely unrepentent about its role in making the middle east a horrible place to live. You'll be shouted down if you suggest that maybe, just maybe, voting for a third party is okay, since there's no functional difference between the two principal parties (thanks to the GOP of course, this is no longer true; I'm surprised that more Republicans haven't started trying to take down the GOP for derailing the more legitimate politics of the republican party). American society, thanks to homogenous capitalist media sources and a completely out-of-control political system that fosters and rewards corruption at every turn, is completely in of the hands of the very worst idiots that the American genepool has to offer -- not to mention the most greedy and evil people, the most power hungry, and so on.

    53. Re:America the Great by cyphercell · · Score: 1

      I would say politics is simply asshole management. You want about 40% of Americans (all assholes) to go unemployed, unmanaged, and unable to eat, while they sit on the largest collection of nuclear weapons in all history. You're insane.

      ... I want America to fall -- the benefit to the rest of the world will vastly outweigh the discomfort Americans feel...

      You are insane.

      There are many, many Americans that feel like you do about the war in Iraq (myself included), but the some of the alternatives are not nearly as bright as you make them out to be (some of them are much better, but not all). I don't want America to fall, I want America to make the necessary adjustments to let the rest of the world rise. America has been primarily a war economy since it's involvement in WWII, you say our decision to enter that war was brave, that we had options? Explain to me then what the hell the Cold War was? Our nation's commitment to WWII did not end in 1945, it's still here and finally that commitment is dragging us down, while you're just sitting on the sidelines waiting to go through our pockets when we fall. You're simply proof that nothing in the world has ever changed, never will change, and will always end with someone wanting what someone else has bad enough that they want others to suffer for it. I don't like where America is today, but honestly, I don't really think we did all that bad, if we were staggering like this back in the early eighties before the USSR fell the rest of the free world would have been literally shaking in their boots gearing up for war and buying as much of our weapons as they could. Instead we made economic and geopolitical compromises that would ensure that our war economy would outlast the USSR's. Currently, we have terrorists, as lame an enemy as that is, it's what we have and 9/11 gave our dip shit leader all the impetus he needed to gear up one more time. We have been mopping up after WWII for so long that we don't have a viable economy after the mess is gone, of course we're making mistakes, but you can't on one hand say we're brave and on the other call us cowards for getting beat up. Our pain right now is the price of our bravery, that's what makes it bravery.

      Americans were leaders in industrialization, and practically reinvented the idea of capitalism -- both of which qualify as "great" by most estimations.

      What's the next big thing? Computers? Space? What else? Come on, we don't lead the world in industrialization, we shouldn't be, because we don't have the largest population by any means. The more machines are built that do the work, the less important it will be anyways. We're getting finished cleaning up after the greatest war of all time and we've sparked off the beginning of the information age. Give us another 10 or 20 years to recoup, you'll see that we're not much different than any other industrialized nation, we've just had everything on the line for the past 60 years or so.

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    54. Re:America the Great by Anonymous Coward · · Score: 0

      I find it funny that the post above failed to spell Anti-intellectualism correctly. I also find it funny that the above post even thinks they should be taken seriously for the overblown rhetoric in their post.

    55. Re:America the Great by Mark_MF-WN · · Score: 1
      So you're suggesting that the US is NOT an invading force in Iraq?

      US invades Iraq : Iran gives weapons to Iraqi resistors.

      USSR invades Afghanistan : America gives weapons to Afghani resitors.

      These scenarios are exactly the same. The use gave weapons to the TALIBAN. The Taliban did and still do kill Afghani civilians... not to mention arming and helping out Al'Quaeda.

      Sorry man, but the US is JUST LIKE IRAN on this one. America supported terrorism -- and more specifically, Americans PAID for terrorism through their taxes. And America IS the unprovoked aggressor is the Iraq conflict, and Iran is the one giving weapons to militants to use "against an invading military force". They DO attack American soldiers, and the pupppet government's soldiers. The genocide and murder of civilians pales in comparison to the stuff that the Taliban did. Deal with it. It's precisely this kind of naive stupidity that makes people hate Americans. You don't acknowledge simple truths about what your country has done, and that's why you keep getting stuck with this bullshit. That's why America will just do this again and again, arming terrorists one decade and then fighting them the next. And you'll be stuck paying for it, and you'll have to watch as those terrorists try to attack your country. You'll have to watch as they very effectively turn entire nations of muslims (or whoever else you manage to alienate) against the West. And you'll have to face the fact that you CHOOSE this path, deliberately.

    56. Re:America the Great by Mark_MF-WN · · Score: 1

      Hey, I'd love it if America could clean up it's act. I just accept that it's impossible. It takes a disaster of truly epic proportions to change people. It takes firebombings of their cities, it takes holocaust, it takes the complete collapse of society. America's military is pretty scary NOW, but when the money's all gone? Not so much. The American government doesn't have the fiscal sense to run a popsicle stand without a trillion dollar budget. With a weakened economy, they'll be lucky if they can successfully operate a fleet of inflatable rafts to defend the coastline. And the nukes are irrelevant, since nothing has changed the politics of mutual annihilation. Americans still wont want to be exterminated like ants by a Russian or Chinese nuclear bombardment.

    57. Re:America the Great by cyphercell · · Score: 1

      Call me an optimist, but I think it's possible. Clinton was on the right track until the whole Monika Lewinsky thing was funded as a character assassination. I think the problem with mutually assured destruction is that the US public, hungry enough, and in a temper tantrum may very well become collectively suicidal. Suicidal tendencies have always been a problem with that theory and we are collectively just that melodramatic. Not to mention that all we really need for our war machine is oil. Maybe we drift off like Russia did but not with an asshole like Bush at the helm, in the beginning he garnered support from the rest of the world as well as the US public.

      The American government doesn't have the fiscal sense to run a popsicle stand without a trillion dollar budget.

      That's an awesome statement. I think that if we had a Clintonesque leader playing his saxophone on American Idol everything would collectively fall into place, then a sane fiscal republican in office to get our finances in order without inciting God's word or going to war, then we'd be fine. Like I said another 10-20 years and we should be somewhere sane again.

      Anyways, thanks for the chat it was a lot better than "omgponies" again, and again, and again, and again, oh wait, nope, again and .....

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    58. Re:America the Great by Mark_MF-WN · · Score: 1
      "Fiscal republican"? What an odd turn of phrase ... one who believes that money should be ruled by popular consensus as enacted by representatives? Sounds like a bankers' trade union. :P Seriously though, most of us just call them "fiscal conservatives", and Clinton (or at least his administration) WAS fiscally conservative. They reduced the deficit, cut the size of the beauracracy, and avoided needless new spending. I'm no Clinton fan, but credit where it's due: his government did a better job with the budget than any other American government in the last few decades. And he had the whole neoliberal thing going for him; for all the destructiveness and dehumanization that neoliberalism allows, it DOES make war virtually unthinkable, and the consequences of war are far worse than anything that free, unrestricted trade can cause.

      What I personally think America needs, as an outsider, is the Libertarians. Granted, they're completely insane and their ideas are, like Marxism, based on completely inaccurate views of Human nature that have no applicability to the real world. But when the foundation of a house is bad, sometimes the only choice is to rebuild. Scrapping most of what the government's programs and gradually re-establishing the most important ones according to modern organizational and managerial principles would go a long towards making America a reasonable place to be. People could actually see the programs working, see what they do, and how they benefit society (or fail to do so, as the case may be). Maybe even try to take the separation of state and federal powers seriously this time.

    59. Re:America the Great by Anonymous Coward · · Score: 0

      > Anti-illectualism: almost unheard of outside of the United States and Islamic Theocracies.

      I'm not an American, but I'm willing to bet that "Anti-illectualism" is unheard of inside the United States as well.

    60. Re:America the Great by Mark_MF-WN · · Score: 1
      Who said I'm European? I'm not, trust me. Only Americans could be SO arrogant as to assume that anyone who criticizes them is German, French, or British.

      Incidentally, the French TOLD America that they should stay out of Vietnam, that there was no way they could win without millions of troops and a willingness to massacre a large fraction of the population. You see, the French LEARN from their mistakes. The vietnam war proved that America can't learn from other peoples' mistakes, and the Iraq war (and Bush's re-election) demonstrate that Americans can't even learn from their own mistakes.

      Besides, we're talking about America's behaviour RIGHT NOW. Europe, right now, is NOT holding people without trial and torturing them into giving false confessions. They're NOT planning to deliberately disrupt two of their most important trading links and potentially cause a recession across all of North America. Other than England, they're NOT waging an unwinnable war of attrition against people with nothing to lose. And their heads of state DON'T say that God personally told them to invade other countries and kill certain people. So RIGHT NOW, Europe is looking really good, and America is looking like a nation of insipid bullies with paranoid schizophrenia.

      Once you start looking at other countries like Australia, New Zealand, Canada, Mexico, Japan, and MODERN Europe, you start to see just how good things can be by contrast. Imagine paying nearly the same taxes, and getting a social support network with universal health coverage, instead of thousands flag-draped coffins that the government censors images of (so much for freedom of the press or of expression, loser) and crippled veterans who are denied any kind of disability benefits or medical support after they're discharged (so much for supporting the troops). I know which one I prefer, and it's the one with fewer crippled people rather than more.

    61. Re:America the Great by ikioi · · Score: 1

      The electric light, radio, telephone, television, the car, the airplane, computers, the internet, the sewing machine, vulcanized rubber, the typewriter, the record player, air conditioning, etc, etc, etc... These are things created by the US which have significantly changed the world for the better. This says nothing of the social or cultural impact the US has had. It also says nothing about the US providing the military force which prevented the world from being ruled today by a Hitler or a Stalin.

      "Home of the free" and "home of the brave" are meaningless cliches. When you get down to brass tacks, though, the US has had an absolutely enormous positive impact on the world.

    62. Re:America the Great by sumdumass · · Score: 1

      So you're suggesting that the US is NOT an invading force in Iraq?

      No, I didn't suggest that at all.

      US invades Iraq : Iran gives weapons to Iraqi resistors.

      The Iraqi resisters and Al Qeada are using the weopons against innocent civilians. Not the invading forces. This is a big difference. Also some of the worst uses of these weapons are were they blow up innocent civilians and then blow up the rescue workers who come to administer aid to the victims. I'm at a loss to how any of this can be considered heroic or justifiable.

      Just this weekend some of those weapons went off in a private neighborhood and damaged over 100 homes and killed 152 innocent civilians. Most of them women and children. How this can be compared to attacking a military outpost, I don't know. These are blood thirsty savages who think killing innocent people is more important then going after the military it is trying to defeat. Somehow they think they can force these innocent women and children to take arms and fight the military that they are too scared to fight for fear of death by them if they don't.

      USSR invades Afghanistan : America gives weapons to Afghani resitors.

      And they use them against the military that is invading. Not the civilians who are going about daily life. See a difference here?

      These scenarios are exactly the same. The use gave weapons to the TALIBAN. The Taliban did and still do kill Afghani civilians... not to mention arming and helping out Al'Quaeda.

      The taliban wasn't the same taliban. This is a matter of fact. and we didn't give the weapons directly to the taliban, we gave them to Gulbuddin Hekmatyar which was only an ally to the taliban through the enemy of my enemy doctrine. Very little US money or weapons went to the taliban Osama or any of his terrorists friends. It wasn't until around '96 or so that the Pakistanis started supporting the taliban but then that was along side of some confusion were the area was being torn apart by warlords once the soviets pulled out. The taliban and Bin laden had their own money and most of the Taliban during this time were too young to fight in the timespan we are talking about. The taliban as we know it wasn't the same taliban as it was back them.

      Sorry man, but the US is JUST LIKE IRAN on this one. America supported terrorism -- and more specifically, Americans PAID for terrorism through their taxes. And America IS the unprovoked aggressor is the Iraq conflict, and Iran is the one giving weapons to militants to use "against an invading military force".

      I would love to live in your little world were the weapons are being used against military targets. The last bombing i just talked about and at least two of the chlorine gas bombs wen off were no "invading military" was present. Their entire intent was to attack innocent civilians, nothing else. And as for supporting terrorism? I think you need to look at the facts a little harder. I'm not saying we havn't but I don't think we have in the way you think. It make a big difference. If your going to be pissed about something, at least make sure that something is true.

      But as i said, I welcome the war with Iran. It will level the playing field. I think we can do what we need to do, back out and not worry. The only mistakes we will make is if we attempt to stay and rebuild were we should just hand them to some other country in the area and let them do it. A sort of future trust.

      They DO attack American soldiers, and the pupppet government's soldiers. The genocide and murder of civilians pales in comparison to the stuff that the Taliban did. Deal with it. It's precisely this kind of naive stupidity that makes people hate Americans. You don't acknowledge simple truths about what your country has done, and that's why you keep getting stuck with this bullshit. That's why America wi

    63. Re:America the Great by cyphercell · · Score: 1

      "Fiscal Republican" as apposed to these "Neo-Conservative" assholes. Personally in the US I try not to use the word "conservative" in order to avoid confusion (Americans are dumb), fiscally conservative is exactly what I meant. I was pretty young when Clinton was in office, but I remember three things, he played his saxophone on MTV, he opened international relations as much as possible, and the Monica Lewinsky Scandal, you're right though he did do a lot for our economy. Neo-Liberalism, hadn't heard that one, but I like it, I definitely think it's a good direction for America to go, we need globalization to a certain extent, we need a certain level of cooperation before we can convince the public/politicians that disarmament is possible. I've always been a fan of the "vast right wing conspiracy" theory as far as his problems with the Lewinsky Scandal and aims for disarmament explain our present situation quite well, it just fits. The Bush elections just seem like a "military industrial complex" ticket with icing.

      Libertarianism is as you said insane, but we are moving in different directions, Clinton a liberal working towards capitalist goals and these heartless bastard Neo-Cons. Revolution sounds nice, then again that was written into the constitution before night vision, fully automatic weapons, and bullet proof vests, civilians just don't stand a chance any more. For America to start from scratch we would literally have to fall apart first, I still think that's a pretty risky proposition.

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    64. Re:America the Great by ahodgson · · Score: 1

      What would the world look like if we didn't do the good things we do? (keeping in mind that Canada would stay on the sidelines in that world, too)

      Canada was facing the bully in WW I for 3 years before the US got involved. For over 2 years in WW II. We were in Korea, Gulf War I, Bosnia, and Afghanistan.

      I am grateful that the US was the strongest power to emerge from WW II and kept that strength up during the Cold War. Canada did our part in the Cold War, too. Not as much as I'd like, and our current military is a sad joke, but we've hardly been standing on the sidelines.

      The only big US conflicts we've managed to avoid have been Vietnam and Iraq, and those both look like good places to keep out of, IMO. Since Canada hasn't actually been threatened militarily since 1945, I'd say we're doing OK.

    65. Re:America the Great by jcr · · Score: 1

      Don't you love how Americans can only maintain their delusions of adequacy

      Project much?

      Here's the deal: stop saying that America is the greatest nation on Earth, the most advanced nation on Earth, the home of the free, the home of the brave, or any of that other bullshit

      You're so funny when you seethe with jealousy.

      -jcr

      --
      The only title of honor that a tyrant can grant is "Enemy of the State."
    66. Re:America the Great by Magada · · Score: 1

      There's nothing inherently wrong with blanket statements. They just rarely seem to hold true in the real world.

      The fine article states that close to half of all americans are Christian fundamentalists, so there's at least one "blanket statement" that seems to be true... I am using the wikipedia definition of fundamentalist here.

      --
      Something bad is coming when people are suddenly anxious to tell the truth.
    67. Re:America the Great by Magada · · Score: 1

      "Therefore, a US-only solution isn't just suboptimal, it's useless."
      Self-contradictory. Hilarious. A solution would at least help americans.

      --
      Something bad is coming when people are suddenly anxious to tell the truth.
    68. Re:America the Great by Grishnakh · · Score: 1

      My question for those who follow the word of God is this...
      Did you ever study Greek/Roman mythology in school?
      Do you think they were silly for believing in mythological dieties?
      If you think mythology is so stupid, why is that the core of your life?


      "Because the Greek and Roman gods didn't exist, and Christianity is real!"

      Yes, I've actually heard people say this.

    69. Re:America the Great by Grishnakh · · Score: 1

      Revolution sounds nice, then again that was written into the constitution before night vision, fully automatic weapons, and bullet proof vests, civilians just don't stand a chance any more.

      You actually believe that?

      If the people really wanted a revolution, the military has no real way of stopping them, short of extermination. It's pretty difficult to get soldiers to exterminate their countrymen.

      For another example, look at Iraq. The American military can't get that place under control, and the people there aren't even that well armed. All it takes is a few armed insurgents to screw everything up when you're trying to establish control. Here in the USA, we have the most heavily armed civilian population in the world. There's a few countries (like Switzerland) with more per-capita guns, but their populations are a fraction of ours. Any military force attempting to occupy would have a terrible time with snipers, people carrying concealed handguns and shooting troops in the streets, etc. A foreign military, sufficiently sized and armed, might be able to do it as long as they were inhuman enough (like lining people up in the streets and publicly executing them, bombing cities, etc.). But a military composed of our own people? Good luck with that.

      I think Libertarianism is a great political ideal. However, there's extreme and moderate versions of it, just like any political belief. The extreme version, as you might expect, is just too unrealistic to work. But the moderate version I believe has a lot going for it. I for one am tired of the Republicans trying to tell me what to do in my bedroom, who to worship, and that we need to go to war for bad reasons and that they need my money for that, and that big business should be revered and worshipped and given special treatment. And I'm tired of the Democrats telling me they need my money to give to people who refuse to work for a living, or that I need to give up my weapons and not be allowed to defend myself from "poor, disadvantaged, misunderstood" criminals. In short, I want my freedom and liberty back, the freedom and liberty that was valued by the Framers of the Constitution over 200 years ago, and which these stupid politicians keeping trying to take away. It's true we need to give up some freedom in order to live in a stable society, but only when that freedom hurts everyone (like spewing pollution into the environment because it increases profits); the freedoms that the Dems and Reps want to take away is far beyond that.

    70. Re:America the Great by mfrank · · Score: 1

      WTF? Canada was in WWII from the get-go in 1939, way before the US decided to get involved. They even had their very own beach at Normandy. Australians and New Zealanders did some major fighting too. You do realize you're talking about countries with a small fraction of the population of the US, don't you?

    71. Re:America the Great by Anonymous Coward · · Score: 0

      US invades Iraq : Iran gives weapons to Iraqi resistors.
      The Iraqi resisters and Al Qeada are using the weopons against innocent civilians. Not the invading forces.


      So, all those dead American soldiers were killed by, what, rocks? Moron.
    72. Re:America the Great by CFTM · · Score: 1

      Alright, please let's start with the established point that the entire Cold War was fought by proxy and it was done so for a reason...unless Nuclear Winter sounds nice especially up in Canada.

      The USSR and The United States both did this to each other, and in many ways trained today's terrorist leaders. It is well known, as you reference in your post, that the US trained Osama Bin Ladden and he was a golden boy of the Reagan administration. Also, it's well known that we sold arms to Iran and Iraq to fight each other in order to fund wars in South America against communist regimes that were being supported by the USSR.

      From the perspective of Game Theory, it was far better for the human civilization to have the two superpowers fighting wars by proxy as opposed to openly going at each other. Let me overly simplify things to illustrate my point.

      USA And Russa go Nuke Crazy!
      Russia Uses Nukes but not USA
      USA Uses Nukes not Russia
      Wars Fought by Proxy, niether side uses Nukes

      Hmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm mm which options sounds best to me? Did it have unintended consequences? Damn straight and we'll have to deal with them for quite some time to come by I'll take it any day over nuclear winter. I mean personally, I think the Cuban Missile Crisis sounds like a heck of a good time, hell I'd want to do that every weekend but I'm kinda strange...

    73. Re:America the Great by Mark_MF-WN · · Score: 1

      Well, let's see: the US could have ... NOT supported religious fundamentalists. They could have used OTHER proxies. Somehow during the Korean War and the Vietnam War, the US managed to give money to groups that DON'T murder women who dare to not wear a veil in public, or who are caught flirting with men without their father's permission. I mean, call me crazy, but I'd say those people are significantly worse than Communists. I mean, Communist Afghanistan versus Honour-Killing America-Attacking Afghanistan? I'll take the commies, thanks. But it illustrates again how irrational Americans are. Most of those South American communist states had nothing to do with the USSR (Cuba isn't South American, incidentally). The US just messed with them because Americans don't respect the freedom of other societies to make their own decisions about how to run their economies. Americans got totally wrapped in yet another one of their little paranoid fantasies about enemies lurking in every shadow that they decided that freedom and democracy had no worth next to making sure that everyone on Earth had to pay full price for things.

  283. evolutionists take a lot of things on faith by falconwolf · · Score: 1

    What do they take on faith?

    it is easier to believe than an external being creating life in its full form

    What created that being?

    Falcon
    1. Re:evolutionists take a lot of things on faith by transporter_ii · · Score: 1

      What created that being?

      I don't think it matters. The point is, what is the difference between me believing a UFO "seeded" the earth with lifeforms, or me believing that cells grouped together and formed more advanced cells, which evolved to become life as we know it? Neither one can be proven scientifically, and either stance would take a leap of faith if a person considered either a deeply held belief.

      Kind of amazing how two people can take a leap of faith and one be perceived as absolutely correct, and one be perceived as a nut job, when in fact, they are both pretty much equal as far as their ability to prove either stance "scientifically."

      Transporter_ii

      --
      Doctors destroy health, lawyers destroy justice, universities destroy knowledge, religion destroys spirituality
  284. that is incredibly true by Anonymous Coward · · Score: 0

    yet truth is too often a secret knowledge. like history, truth is written by the winners.

  285. Re:Origin of Life scenarios are Atheistic Fairy Ta by dreamer-of-rules · · Score: 1

    Don't confuse 1) The Theory of Evolution with 2) The Theory of Common Decent and 3) the various theories of the Origin of Life. The first two are well proven with lots of data from many disciplines. They, like Newton's Law, will probably be refined in the years to come. The third has vary little evidence to say one way vs. another.

    Don't confuse evidence with "faith".

    Do you really have a better theory? Supported by the vast amount of evidence already gathered? Able to make useful predictions in bio-genetics and paleontology?

    Darwin started out a Creationist. He stopped being one because Creationism kept making wrong predictions.

    --
    Everyone is entitled to his own opinions, but not his own facts.
  286. factual evidence preferred by wstonestreet · · Score: 1

    The condescending arrogance of your statement is overwhelming. True scientists believe in evidence. If you follow the evidence, leaving out hypothesis and conjecture, you will find the majority of factual evidence does not support evolution. I am not suggesting that the "48%" have arguments based in fact, but in this case the evidence is on their side.

    --
    WStonestreet
  287. Amazing concept for all the religious winers: by a1mint · · Score: 0

    How about that there is both a god *and* evolution? Do we *have* to be "Humans" originally? Does the world *have* to be *just* 6000 years old? Can there *not* be any dinosaurs? Can this "bible" *not* be simply consider an intelligent piece of work by ancient monks? Why are the churchy people so darn close minded and short sighted. Why can't they at least attempt to explore and discuss the possibilities? Woof... I'm glad I can live free of guilt. I can go through a course of a day, without having to "pray" or "worship".

  288. A Creationist's Clarification by PoopDaddy · · Score: 1
    Why was this tagged with "sad" and "idiots?" Why use the term "alarmingly" in the summary? Mmmmmmm-Bias much? Let's make some distictions.


    Religion and Christianity are not in any way against science. In fact there are many Christian institutions that are at the forefront of medical science. Science is about observing, hypothesizing, and testing. It's just a fancy variation of applying logic. Some of the greatest scientific minds of the last several hundreds of years were people of faith. Belief in God does not stifle real scientific progress.

    The theory of evolution does not attempt to explain the origin of the universe, and therefore neither threatens nor is threatened by a belief in a "Creator." There are aspects of the theory such as natural selection that are self-evident. Where the schism begins is with the age of the earth and the origins of species. Faith is not equivalent to stupidity. There is naturally a stubborn aspect to it, but it is not baseless ignorance. Therefore, when people refuse to accept what our current testing methods seem to indicate, it is not out of some mental inferiority, as many high-minded folks love to believe, but rather out of necessity.

    Was it wrong to believe round when everyone said flat? Was it wrong to believe heliocentric when everyone said geocentric? Looking through history, science is never really "right" or "wrong," but more like "as far as we can tell right now." So what is wrong with holding out for better testing methods? It is completely irrelevant for either "side" to flame the other. So try to be the bigger person and stop the hate.

  289. Re:which farm animal represents the "fit" of ameri by Anonymous Coward · · Score: 0

    It's all very well to say survival of the fittest, and to define the fittest as those who survive, but a biology professor of mind said that being it was more likely to be survival of the luckiest, as if a creature is in the wrong place at the wrong time is not going to survive no matter how much better they are. Also note, you're on shaky ground if you presume "fitter" means more likely to be lucky.

    Personally, I prefer the definition "survival of the luckiest."

  290. Re:Origin of Life scenarios are Atheistic Fairy Ta by grolschie · · Score: 1

    Darwin started out a Creationist. He stopped being one because Creationism kept making wrong predictions.
    He most likely stopped because he couldn't handle the fact that his daughter Annie died. His conjectures would have been very likely to have been based on emotion, not scientific evidence.
  291. I wish this we're an April fools joke by dumbnose · · Score: 2, Interesting

    Seriously, these are the kinds of things that embarrass me when I talk with my foreign friends.

  292. How is this a troll? by rohan972 · · Score: 1

    All I did was explain the particular way the bible defines the word "faith", and the relationship of this term to a presupposition common to Christianity?

    Moderate on the quality of discussion, not whether you agree or not. The GP's statement regarding faith is not circular reasoning when the terms are understood in their context, even if the presuppositions are illogical.

    Or perhaps it's my sig you don't like? For the benefit of those without wget, it pulls a few lines from Darwin's "The Descent of Man"
    At some future period, not very distant as measured by centuries, the civilised races of man will almost certainly exterminate, and replace, the savage races throughout the world. At the same time the anthropomorphous apes, as Professor Schaaffhausen has remarked (18. 'Anthropological Review,' April 1867, p. 236.), will no doubt be exterminated. The break between man and his nearest allies will then be wider, for it will intervene between man in a more civilised state, as we may hope, even than the Caucasian, and some ape as low as a baboon, instead of as now between the negro or Australian and the gorilla.

    Darwin's own work proclaims him to be in favour of racial genocide. He was guite clear. You ought have no need to suppress this information.

    1. Re:How is this a troll? by Copid · · Score: 1

      Maybe I can help. First, if you read the quote and the paragraphs surrounding it, Darwin was making more of a detached observation than actually advocating extermination, so that would more or less invalidate the idea that he was "in favor of racial genocide." He did buy into the racism of the day, which just about everybody did. Hell, Darwin was even against slavery. Your sig might more accurately read, "Darwin: Victorian era white guy." But of course, that wouldn't have nearly the emotional impact.

      Basically, people were calling you a troll because you were trolling. That's what we call irrelevant personal attacks designed to stir up controversy--especially ones that aren't totally accurate.

      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
    2. Re:How is this a troll? by rohan972 · · Score: 1

      Whether Darwin was detached or passionate about it is irrelevant. His words explicitly state that he hoped for it to happen: The break between man and his nearest allies will then be wider, for it will intervene between man in a more civilised state, as we may hope, even than the Caucasian, and some ape as low as a baboon, instead of as now between the negro or Australian and the gorilla.
      He predicted it, favoured it and provided the rationale. That's advocating it. The only thing that's contaversial about it is that if this idea were first proposed today, Darwin wouldn't be able to get an audience in any reputable educational institution, so people feel the need to cover it up.

      I've had this sig for months and never been modded troll. It's unpopular but factually correct.

    3. Re:How is this a troll? by Copid · · Score: 1

      Whether Darwin was detached or passionate about it is irrelevant. His words explicitly state that he hoped for it to happen . . . He predicted it, favoured it and provided the rationale. That's advocating it.
      Errr... I'm really not reading that the same way you are. As I read it, the statement is something like, "If the white race takes over, one would hope that the resulting society would be better than the one we have now." How do you square your reading of it with the recorded fact that Darwin was a member of abolitionist organizations and has put out a number of writings that come down squarely against slavery. Those aren't the actions of a person who is particularly disposed toward genocide. Why vocally support the freedom of slaves you'd rather have exterminated? I get the strange idea in all of this that your readings of Darwin are limited to the tasty tidbits pulled out by creationist web sites. I'm surprised you haven't brought up the section about the puppy.

      The only thing that's contaversial about it is that if this idea were first proposed today, Darwin wouldn't be able to get an audience in any reputable educational institution, so people feel the need to cover it up.
      I think that people react poorly to it because it's clearly a misrepresentation of Darwin's positions as a whole, and it's not especially relevant to anything. People generally just tow out the "Darwin was bad man, therefore his ideas are stupid" line when they're trying to get somewhere in a debate or simply get a rise out of people. Certainly, Darwin was a racist. Name a few white male figures of his time who weren't. As mid-19th century wealthy white males went, Darwin was practically a nutty progressive. I could pull out a list of truly racist positions taken by Abraham Lincoln. Thomas Jefferson owned a small army of slaves. I don't think that we lend any of their ideas any less credence or consider them "bad people" on the whole, given the societies they grew up in. If I injected into every conversation, "Abraham Lincoln was a racist! There's a conspiracy to cover it up! Spread the word!" one might think that I was trying to get a rise out of people.

      I've had this sig for months and never been modded troll. It's unpopular but factually correct.
      So you've been trolling with your sig for months and you're complaining about only recently being modded as a troll? Honestly, I'm not a big fan of downmodding anybody who isn't being truly disruptive, but I also don't think that you're too far off of trolling with this one. You're playing fast and loose with the facts to create a misimpression about a historical figure in hopes of inflaming people into a response. Pretty much trolling in my book, and my book ain't that long.
      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
    4. Re:How is this a troll? by rohan972 · · Score: 1

      Errr... I'm really not reading that the same way you are.

      Even if you don't think he favoured it, he predicted it and provided the rationale. It has been partially implemented in the past in my country (Australia) against the aborigines. You don't need to visit a single creationist website to find out about it. A search for "stolen generation" or "aboriginal skull" would likely turn up some interesting results.

      Why vocally support the freedom of slaves you'd rather have exterminated?

      Interesting you brought up Jefferson. Presumably you know he was both an opponent of slavery and a slave owner. His actions say a lot more about his real views on slavery than his words do.

      I don't think that we lend any of their ideas any less credence ...

      It is quite common, when considering an idea, to also consider the source. I think that Darwin's racist views would have influenced his thinking about his observations. I think the generally racist views of the time influenced the acceptance of his theory. I think that if the idea of evolution was presented to a society not rife with racism, it would not likely be accepted. Somehow as we have rejected racism, we have failed to oust evolution with it, not recognising it for what it is. As far as I have seen, the evidence in favour of it is not nearly so convincing as the true believers would like to think.

    5. Re:How is this a troll? by Grishnakh · · Score: 1

      So in the future, we're going to exterminate all the ignorant savages who don't have computers with wget?

    6. Re:How is this a troll? by rohan972 · · Score: 1

      So in the future, we're going to exterminate all the ignorant savages who don't have computers with wget?

      and sed. I forgot sed. :-)

      If they were really curious, they could use the link. Less convenient, but still possible.

    7. Re:How is this a troll? by ChromeAeonium · · Score: 1

      Yep, it was the sig. That happened to me while ago. Mine said 'If you think fundamentalist religion is a cause of suffering, and atheism isn't, eugenics must not be in your vocabulary' for the purpose of stating that, while bad things have been done in the name of various religions, bad things have also been done in the name of evolution, and that the only constant was humans. I was trying to say that people will use anything to justify their actions, and that theohobes who say that religion is the cause of every bad thing under the sun basically being asses. Of course, the average Slashdotter didn't quite make the connection, and I dropped it because I didn't want to start a flamewar every time I posted. Kudos to you for managing to avoid that for six months. On a side note, you might find this of interest.

  293. Re:Origin of Life scenarios are Atheistic Fairy Ta by geoffrobinson · · Score: 1

    I'm not confusing those. But Darwinists need a materialist Origin of Life scenario. And I don't see any. And I'll make a prediction. None will be found. This isn't based on ignorance. This is based on what science knows about about single-celled life.

    Good post, btw.

    --
    Except for ending slavery, the Nazis, communism, & securing American independence, war has never solved anything.
  294. Alarmingly high? by CletusTSJY · · Score: 1

    "An alarmingly high number of individuals responded that they believe the earth is only 10,000 years old, and that a deity created our species in its present form at the start of that period." Why is that alarming? If the same number agreed with the author instead of disagreed with him, I suppose it would cease to be alarming.

  295. # of replies by Anonymous Coward · · Score: 0

    Every other week, there's a topic like this one. Everyone gets all bent out of shape about it. Just look at the relative number of replies.

    How about some open minds, people? The meta-physical ramifications are so great that you can't for one second consider the possibility of what half of people believe in? They believe in micro-evolution (small changes in the same species to aide adaptability). Remember Darwin's finches changed back when the climate warmed up. They just don't believe in macro-evolution. The mechanism for small changes in a species fundamentally can not change one species into another. Also, as we learn more about Carbon 14 dating, there are so many things wrong with it that I can't believe it's still used.

    Just check it out, RTF research, and don't freak it if it implies that there's a superior being and you may start feeling guilty about all the porn.

  296. the decline of scientific knowledge in this nation by Anonymous Coward · · Score: 0

    What a fine example of the decline of scientific knowledge in this country.


    neutralizes any remaining urine in the urethra.


    She gets some neutralized urine in her mouth; which is still pretty dirty. If you disagree, I'll pee in a cup, neutralize it with baking soda, and will give it to you. Would you drink it? No.

    The urine is NEUTRALIZED (e.g. it becomes LESS ACIDIC) to increase the survival rate of your sperm; it has nothing to do with God's wish for oral sex. In evolutionary terms, males with neutralized urine are more likely to pass on their genes, and will outbreed the males withOUT neutralized urine.


    So, when your FW performs OS on you, rest assured that she will not be getting any urine in her mouth!


    What the fuck kind of twisted Christianity is that? Do you really think that God designed the human body so that you get oral sex? Gee, that's some God.

  297. Oh no! People believe in God!!??!? by Aceheaton · · Score: 0, Redundant

    This is crap. People believe in God, get over it. An "alarmingly" high number of people believe in religion!! Oh no... We are all uneducated buffoons, please help us understand our ignorance. If you have ever written a program over 100 lines of code you know what it takes to organize and make things work and how many little things go wrong. Do you really think this earth wasn't organized by some greater being?!?! It just popped into existence one day?? To me that sounds so silly, almost as silly as someone believing in religion...

  298. it is not fittest that survive by MikePlacid · · Score: 1

    Actually it is not the fittest that survive. DNA + procreation + "survival of the survived" is the correct formula.

  299. Creation 'Science' class at Nebraska college by Anonymous Coward · · Score: 1, Insightful
    Speaking of American's ignorance of science, an instructor at McCook Community College in Nebraska is offering a creation "science" course this fall. No, he's not offering it as a religious studies class, but as a physics class. 'Physics 2990: Creation Science' will cover such important topics as:
    • The age of the earth, the earth's beginning, and where the earth is heading
    • The Garden of Eden and life on earth before the flood and the major changes which have taken place since that time
    • Dinosaurs in the past as well as in the present
    • The flood, ice ages, mountain formation, coal and oil formation, and the Grand Canyon


    Why don't we just get Kent Hovind out of jail and make him Secretary of Education and get it over with? I mean, the way scientific ignorance is celebrated, hell even encouraged, in America you might as well.
  300. Re:More news...slashdotters don't RTFA by Harmonious+Botch · · Score: 1

    Correction on the news: Americans are ok at math, but slashdotters don't RTFA.
    From RTFA: 48% don't believe in evolution, and 82% consider themselves christians.
    48% is, of course, not a majority, but 82% is.

  301. I'm stupid, so what? by PontifexPrimus · · Score: 1

    *sigh* Of course you're right. That's what you get from posting very very late at night..
    I hereby retract all my earlier statements and claim the exact opposite. All previous mistakes must now be considered null and void, and the universe must shape itself to accommodate this new reality.

    --
    -- Language is a virus from outer space.
  302. Re:Infrequently used refutation of 10,000 year the by tomblag · · Score: 1

    I think you should change your post or maybe you read quickly or something.. or maybe I am bad at math, could you explain how 6+2 = more than 10? A millennia is 1k years not 1 million.

  303. an infinite number of chimpanzees... by Anonymous Coward · · Score: 0

    remember also, to follow richard dawkins line of reason, life only needs to start once, so on top of the millions of years of random chemical reactions that might cause life to start you can multiply that by the billions of different planets that those reactions can take place. that gives you a massive probability that even an improbable event such as the formation of self replicating molecules, is going to happen somewhere and given the fact that we are here debating about it gives a pretty good clue that somewhere is here

    on a seperate point, those that are saying we can neither prove or disprove gods existence: this may be true (or may not) but this does not mean that each is equally likely, we can make judgements based on the evidence as to the relative probabilities of there being a god and the chances are hugely against there being a god and should stop pandering to the religious apologists and affording religion advantages with offer no other belief.

    may you be touched by his noodly appendage

  304. This explains a number of mysteries by OriginalArlen · · Score: 2, Insightful

    Mystery #1: how on earth Americans can have been fooled by Bush, not just once but twice, the second time ignoring four years' worth of evidence of what an evil fuck he is...

    --

    Everything I needed to know about life, I learnt from Blake's Seven
  305. FSM Believers..... by tempest69 · · Score: 1
    There are quite a few Flying spaghetti monster believers out there.... and If you know anything about the religion, it rejects evolution. Most of the proponents of the religion arent blind to the ways of science.. And debating their stance is harder to do with classical logic, as their model for Intelligent Design is quite sound. Where as other sects your best bet is to talk louder.

    Storm

    1. Re:FSM Believers..... by jcr · · Score: 1

      There are quite a few Flying spaghetti monster believers out there.

      If you can find even one person who actually believes in the FSM, then that person missed the point of the FSM.

      -jcr

      --
      The only title of honor that a tyrant can grant is "Enemy of the State."
  306. The Atheist Label by Kelson · · Score: 1

    Ok, so 6% do not believe in God, "People who don't believe in God are called atheists", and only 3% are willing to say they are atheist. WTF is up with the other 3% who do not believe in God?

    IIRC, the article brought that up. They figured that there's still a social stigma attached to the term atheist, and those 3% might be willing to admit to not believing, but not willing to accept the label. It could also include people who have religious beliefs that aren't focused on a discrete supreme being, in which case atheist might be technically correct (i.e. someone doesn't believe in any sort of god), but wrong in connotation, since atheist is usually interpreted to mean that one has no religious beliefs whatsoever.

    On a related note, NPR has a long-running series called "This, I Believe," in which people (some famous, some not) submit brief essays about some belief (religious, philosophical, or otherwise) and, if selected, read their essay on the air. Penn Gillette (of Penn & Teller) spoke about not just being an atheist -- atheists just don't believe in God -- but going beyond atheism, and specifically believing that there is no God. It's a subtle difference, but his view on it is that this is our only shot, so you'd better do things right in this life, because you don't get another chance to fix it after you die.

  307. Re:Alarming? Consider this... by misanthrope101 · · Score: 1
    Yes, I've read Lee Strobel, as well as Josh McDowell. There are plenty of responses to their arguments, and frankly their books are only persuasive if you already have faith in God. If you look around and see no reason to believe in God/providence/divine whatever, then the arguments fall a bit flat.

    I think a large part of the misunderstanding, if it can be called that, is that the way your proposition is phrased begs the question. To say that I "believe that a diety did not create human life" presupposes that I believe in a diety, which I don't. It also shifts the burden of proof to someone (me) who is not making a claim. I am not making an assertion that a diety did not create human life. You can always assert the hand of God, evolution or no. Saying "God did it" or for that matter "God did not do it" are not, strictly speaking, provable claims, and I am not making either one of them.

    And before you say "So you're saying atheism is logically untenable?" let me clarify by saying that the statement "God does not exist" is just as logically untenable as saying "Ghosts do not exist," or similar statements about Bigfoot, UFOs, whatever. In any case, I am not making the assertion that God doesn't exist, only saying that I have no faith that he does. Similarly, I am not making the bold assertion that there are no ghosts, anywhere in the universe, but I can honestly say that I see no reason to think that they exist. Stricly speaking, saying "there is no ESP" is logically unprovable, but we know that what people mean when they say that is that they see no reason to believe in the phenomenon. I don't believe in God in the same way I don't believe in leprechauns.

    It's just that, to me, the existence of life does not prove God, I don't find Christian theology convincing, and science is known to be a productive, useful way of looking at the world, at least so far as explaining, predicting, and exploiting physical phenomenon. Science doesn't tell you why you should be a good person, but that isn't what it's for.

    Anyway, back to your point, I've read much on the "it takes more faith to be an atheist" line of argument, and though it may be convincing to those who already have faith in God, it doesn't map well to what atheists actually believe. Usually when I encounter a person using that argument, most of their effort is spent in building up this edifice of belief they think I must have to be an atheist, and trying to get me to admit to it so they can use their canned arguments to knock it down. I don't think the outlooks are easy to reconcile, and they never really understand me. To them, I must by definition have a creed (though a wrong one) and it's that creed they are trying to pin down. But I don't have a creed per se, and atheism is not a belief system. I defer to science because it works where other mental models have failed. Science seeks to explain the natural world in terms of the natural world, which to me seems to make a bit of sense. What's more, evolutionary theory is profitably used in a variety of fields, including that of antibiotic research.

    Regardless on our views on man's ultimate origins, the science behind evolutionary theory is so sound that it has practical applications today. The fight against AIDs, H5N1 (avian flu), and other diseases would be impossible without the mental model of evolutionary theory. It works. Deferring to what works doesn't somehow become blind faith in a non-god solution just because (some!) religious people are uncomfortable with evolutionary theory.

  308. Time mate, it is all about time by SmallFurryCreature · · Score: 1

    You say that if evolution is a linear process then ....

    And that is where you go wrong. It ain't a process. Human beings need to think that way but evolution isn't some kind of system that you can analyse, it is just a name for observed data.

    But ultimately it is random, claiming you should see evolution every two hundred years because of the law of averages is such complete and utter nonsense because that just ain't how it works. It would be like saying that if you flip a coin 100 times it should land on its side 2 times. While you can calculate this in theory, in practice the flipped coin may not land on its side if you flip it from now until the sun blows up. Then again, it may land on its side every single time.

    But we are seeing evolution, humans with less and less hair. Bacteria that are resistent to drugs. Bacteria that thrive in human created toxic enviroments that never existed before.

    But you go right on believing that some magic dude created it all. That explains it all, except, were did HE come from?

    And then there is another thing, if you were a god, would you hand design everything, try to figure it all out in advance how all those species would live together in a changing world OR would you just "create" evolution and plant a tiny seed and sit back and what happens.

    Evolution does NOT deny the existence of a god.

    --

    MMO Quests are like orgasms:

    You may solo them, I prefer them in a group.

  309. Well? by thisNameNotTaken · · Score: 1

    I know the earth is flat because the National Geographic has a map showing the same. You can go off the edge!

    "Praise the lord, pass the ammo."

    NOT

  310. proof that evolution is false by houghi · · Score: 0, Troll
    --
    Don't fight for your country, if your country does not fight for you.
  311. Unbelievable, yet... by Anonymous Coward · · Score: 0

    ...true. I'm horrified at the ignorance of Americans.

  312. Before you complain too much... by Kadin2048 · · Score: 1

    America rather consistently loses wars against third-world countries. Very impressive, and definitely great. Then they criticize the rest of the world for not being stupid enough to get on board for the big defeat. So America is simultaneously weak (for losing), stupid (for going to war in the first place), and petty (for getting mad at nations run by rational, literate people).

    I think you're ignoring a rather important point here. America tends to "lose" wars to seemingly inferior opponents, because America (by which I mean the American public, collectively), for better or worse, doesn't really want to do the kind of nastiness that would be required to win decisively.

    E.g., it's a lot easier to win wars if you don't care about what you do to the enemy civilian population. In the extreme case, you just kill everyone and take over an empty country. (This is pretty feasible, without anything so uncouth as actual death squads, with biological weapons, some chemical weapons, or certain types of nuclear weapons.)

    I'm not sure that I would poke fun at the U.S. for "losing" per se; that's sort of like complaining that a truck full of guys with machine guns get over-run by a mob, because they're unwilling to just start shooting into the crowd. It's less a "loss" in the military sense than it is a quasi-surrender; an admission that victory cannot be attained without doing things that are considered beyond the pale.

    So while there's certainly ample room to criticize the U.S.'s military adventures (but before you do -- realize it's not new; the U.S. has a long history of going on bloody little expeditions every once in a while when there isn't a 'real' war going on), the U.S. "losses" in battle are more reflective of the limits on U.S. commitment and conduct than they are on any actual military factors.

    --
    "Ladies and gentlemen, my killbot features Lotus Notes and a machine gun. It is the finest available."
    1. Re:Before you complain too much... by Anonymous Coward · · Score: 0

      I agree that about your definition of "loss" in a military sense. But what about the political view? How many "bloody little expeditions" have had a positive effect on the "cause". After WW2, most of the unilateral military actions of USA made things worse.

      1. Don't you question why allies such as Germany and France helps you in Afghanistan but doesn't agree with your war in Iraq? Since they are already helping you in Afghanistan, it isn't because they are "cowards", like most Americans believe. If you are going to war just because a country is lead by an evil dictator, there are other countries you should attack first.

      2. The reason behind the dislike of American politics (not hate against Americans as Fox would have you think) is caused by your military and political actions. The world doesn't hate your freedom, they dislike your political and military actions. What goes around comes around.

    2. Re:Before you complain too much... by Mark_MF-WN · · Score: 1
      I'd say that your point actually exemplifies what I'm talking about -- if you're not mad enough to firebomb densely-populated cities (a la Berlin and Tokyo), then you're not mad enough to be at war in the first place.

      The whole concept of "just warfare" exists solely to dupe the public into supporting a neverending series of stupid, indecisive, wasteful wars; ultimately it's a way for a group of politicians to take YOUR tax money and hand it over to the industrialists that supported those politicians' campaigns.

      Ultimately, that's how you can tell whether a wrong is a mistake or not. If a war is truly necessary -- if that nation's interests are truly on the line -- then there is no such thing as a noncombatant. Every single man is a potential soldier, or a potential weapons-maker; every woman is a potential spy, a potential factory-worker, and a producer of new soldiers; and every child is a soldier-to-be. They all support their government. They all pay taxes that make the war effort possible. They all do the work that keeps the enemy's military infrastructure running. And every single one of them is a valid target.

      Hence: Dresden, Hiroshima, Nagasaki, the countless other civilian massacres during WW2. Even the American civil war was ultimately won largely because once the Union adopted the Scorched Earth doctrine -- hardly a "just" way to wage to war.

      I've said it before, and I'll no doubt have to say it many more times, but here it is: if the matter isn't serious enough to warrant a million civilian casualties on both sides, it's not worth waging war over. Because that what it takes to win in most cases. Only that level of annihilation can truly humble a people, and prove to them that they are the losers, and that if they don't surrender completely and totally, they'll be exterminated to the last man.

    3. Re:Before you complain too much... by sumdumass · · Score: 1

      Don't you question why allies such as Germany and France helps you in Afghanistan but doesn't agree with your war in Iraq?
      Umm this is because of the oil deals that they made with Iraq that they lost out on. And BTW, these oil deals were against UN sanction that were in place as the timing of them. This isn't anything new either. And it is why they were saying war for oil. They wanted their oil that they wouldn't get if we invaded. And as far as i know, they aren't getting it now because it was against the UN sanctions.

      The world doesn't hate your freedom, they dislike your political and military actions. What goes around comes around.
      I'm not sure what they like and dislike counts for much. Iraq could have been avoided if France didn't get itself into a position of having to defends Saddam while we were pushing for UN actions. And yes, France had to protect him to receive their oil from the deals they made under the table of the UN sanctions. If France wouldn't have stood up and declared they opposed anything then writing nasty letters, Saddam would have continued his co-operation that he started when he thought something was going to happen. If this somehow make the US evil, then I don't care. The vast majority of other US citizens don't either.
    4. Re:Before you complain too much... by CFTM · · Score: 1

      To be exact, 50% of the oil contracts were awarded to French countries by Iraq...Germany is still owed billions of dollars for bunker construction. So the governments just got on the popular people's bandwagons and said that they opposed invading Iraq for some nonsense but really....PAYCHECK BABY PAYCHECK.

      Doesn't matter who it is, where it is, what the religions or outside factors are, if there's a war going on someone is getting PAAAAAAAAAAAAAAAID.

  313. 48% is pretty scarey. by dalesc · · Score: 0

    Throughout history, improved education has caused a decline in superstitious beliefs. Is the reverse happening in the US?

  314. no evidence by epine · · Score: 1

    The problem with your remark is that there is no evidence to the contrary. God might have created the world 10,000 years ago exactly in accordance of our present scientific view of what the world was like 10,000 years ago. Or five minutes ago, or five seconds ago, or five seconds from now. There is no scientific evidence that the world has existed for any specified length of time. What we actually have with the theory of evolution is a least-complexity explanation of the various phenomena we observe. This least-complexity explanation posits a multi-billion year timeline to the effect that the universe presently appears as if such a time frame unfolded. This claim does not stand in contradiction to the claim that God created the earth 10,000 years ago in exact accordance to what our least-complexity explanation (the theory of evolution) suggests the world looked like at that time.

    Amusingly, to me at least, the average scientist is more in the wrong on this point than the average creationist. A least-complexity explanation is not equivalent to an assertion that the explanation actually took place. If God happens to have an extremely solopsistic sense of humor, it still wouldn't make evolution incorrect as the least-complexity reduction of God's little fit of wool-pulling on humanity at large to create a world complete with fossils, hypothetical genetic lineages, and receding galaxies.

    After all, the super rich can't stand to own anything that looks really new. It's like that in universes everywhere. Hey, Slarty, I need a universe ASAP, 10,000 years tops, but make it look old, really old. Fossils, major extinctions, contintents that mesh together, all that shit. And pay attention to detail this time. Those mice are smarter than you think.

  315. Life on earth was an accident by Z00L00K · · Score: 1

    triggered by the dumping of waste by the individuals Fod and Gather. They were later punished by seeing their only son being nailed to a wooden structure.

    Evolution may otherwise be described as "survival of the fittest". In reality this means that being fit for one environment probably makes you unfit for another. Place a polar bear in Africa and it will perish from heat, place a lion on Greenland and it will die from the cold.

    And being fit for survival may also be represented by adaptability. Many animals aren't able to adapt themselves to large variations in climate. Humans are adapting very well, especially since we are the only animal that actually both build our own dwellings to keep out the worst parts of the climate and also are able to construct clothing that allows us to endure climate that we wouldn't have been able to survive otherwise.

    The human body is in it's unprotected state only fit to survive in regions around the equator.

    Evolution is otherwise best studied through bacteria. They are able to adapt themselves to the various poisons we throw at them. Several strands of bacteria that earlier were killed off with most drugs have today developed a resistance to most. A more cruel study has to be the black death that actually occured several times from the middle ages up to the 18th century. The first time it occured it was very bad and killed a large number of people. However those who got sick and survived or never got sick even though they were exposed there was a gene that prospered and resulted in the fact that the coming generations were less likely to get infected. Since not everyone got exposed to the black death there were survivors that lacked the gene. It may also be that the gene were a dominant gene, which means that only one copy of it was needed to provide sufficient protection. That resulted in the ability of the plauge to strike again, but with lesser effect each time since the gene were protecting a larger part of the population.

    An interesting fact is that humans are likely to be the first speices of Earth that actually is able to propagate beyond the realms of the earth. Unfortunately we are at the same time wasting resources on things that aren't actually profitable in the long run.

    Since we still don't know everything about everything (and probably never will) there is always some room left for religion. Most religions are based on part fiction and part reality. Most stories in the Bible (and other scripts) have a reality base, the problematic thing is to know how it has been edited. What has been added and what has been removed? Is the story describing a real event or is it a fiction thrown in to tell the listener/reader some good moral lesson?

    From the bible it is known that the new testament comes in four variations, each with a different angle. This is all and well, but it also shows us that even if the basic story is the same it also proves to us that there are information losses and alternations on the way. It is also known that there are other scripts that didn't make it into the bible. Who was to decide what was the right script to enter the bible? Is that decision valid today? The victorious writes the history, so there is always the risk that Judas wasn't the traitor that he was written to be.

    Another thing is that a lot of the stories in the old testament may have been passing from mouth to mouth before they were written down. This in turn means that they slowly has changed content before they were written on paper. Even translations from earlier versions of a language using modern references can cause loss of information or misconceptions. There is a translation that were saying that it was hard to put a camel through the eye of a needle. Later language analysis has revealed that the translation shouldn't have been a 'camel' but a 'rope'. In the end it really didn't matter since both translations still works for the goal of proving something hard. What this really indicates is that it is likely that there

    --
    If builders built buildings the way programmers wrote programs, then the first woodpecker would destroy civilization.
  316. Cell Principle by conman90 · · Score: 1
    What's really quite odd though is that even thought evolution is so widely accepted, the cell prinicple is still viewed as a scientific law (which I believe it is) and no one is trying to disprove it.

    For all those non-sience majors, the cell principle simply states that:
    1. The cell is the fundamental unit of life
    2. All living organisms are made up of cells
    3. All cells come from pre-exisitng cells

    According to the cell principle, evolution is scientifcally and biologically impossible.

    1. Re:Cell Principle by JustNiz · · Score: 1

      >> All cells come from pre-exisitng cells

      Well thats just not true. Evidently you're not aware that cells subdivide.

    2. Re:Cell Principle by conman90 · · Score: 1
      Well thats just not true. Evidently you're not aware that cells subdivide.

      I don't think you understand how cells divide. A cell will split in half producing another cell through either mitoisis or meiosis. Cell division only occurs from a pre-exisitng living cell.

  317. Spinoza's god by Anonymous Coward · · Score: 0

    Please correct me if I'm wrong, but I wouldn't call Spinoza's god a creative force. As far as I can tell it is almost fully compatible with philosophical materialism and atheism.

  318. Origin of Life scenarios are beside the point by dreamer-of-rules · · Score: 1

    Care to define your terms? If you mean that "Darwinists need an Origin of Life that excludes all non-physical influences", I'd dispute that. I'm living with one.

    I definitely agree that finding the definitive source of life will be nigh impossible (unless someone took pictures). Single celled life don't leave much in the way of fossils. Bacteria swap genes and have a high mutation rate which makes it harder to determine ancestry billions of years ago.

    However, it's much easier to demonstrate a common ancestry for complex life on Earth. Mutations in highly conserved DNA sequences, plus fossil records that show that species change over time, geographic distribution of species, and shared "mistakes" in the "designs" of species, all support the Theories of Common Descent and (Macro) Evolution.

    Unfortunately, people conflate the theories, (I used to, but not saying you do) and justify their belief in the Creation as done by Jesus Christ, simply because scientists haven't proven it all the way back to the big bang. Which is utterly foolish. Since their religious belief is centered on the Bible being 100% accurate, they incorrectly believe that all of the Theory of Evolution etc. falls apart if scientists can't prove the Origin of Life.

    --
    Everyone is entitled to his own opinions, but not his own facts.
    1. Re:Origin of Life scenarios are beside the point by geoffrobinson · · Score: 1

      I understand what you are saying. Many in the ID movement, like Behe, believe in common descent. Some don't.

      When I use "Darwinism" I am trying to say "atheistic materialism." If you ask an atheistic materialist "can you have life begin by something other than purely naturalistic means?" the answer will be no.

      There is more to say in regards to all the other elements you raised.

      --
      Except for ending slavery, the Nazis, communism, & securing American independence, war has never solved anything.
  319. Re:Alarming? Consider this... by dvdrsmth · · Score: 1

    You're obviously well educated on this subject. I have to admit that as a former atheist, and a relatively new Christian, I still struggle with many of the issues in these threads. However, I do try to "keep the faith" and I believe that God honors that commitment. I'm not going to tell you that God literally speaks to me, because quite frankly he doesn't, that's just not how it works. Perhaps my testimony can shed some more light on my perspective: http://dvdrsmth.blogspot.com/ I've neglected the content for quite some time, but hope you find it worthwhile.

  320. Re:Origin of Life scenarios are Atheistic Fairy Ta by dreamer-of-rules · · Score: 1

    His conjectures and studies (late 1830's) began long before his daughter died (early 1851), but his daughter's death undoubtedly affected his perception of God. Thanks for the link.

    --
    Everyone is entitled to his own opinions, but not his own facts.
  321. HaHaHa by Britz · · Score: 1, Interesting

    I am from Germany, and as many Europeans we love to laugh at stupid (or obese, or warmongering, or undemocratic, ...) Americans. But when you look at us, we are not far behind in all of those fields. And the EU itself could actually be called less democratic than Washington (I don't know of any studies for comparison, but trust me, Brussels is VERY undemocratic). Stupid people is an international problem!

    1. Re:HaHaHa by LittleLebowskiUrbanA · · Score: 1

      Imagine the irony, a German calling Americans warmongering!

          He's right but it's still funny.

  322. I'm not a monkey's nephew by G1975a · · Score: 0, Troll

    Both evolution and creationism are considered THEORIES in the scientific definition.

    Neither are scientific LAWS and therefore has not been proven without a doubt, unlike something like gravity, which is a scientific LAW. Most people believe in micro evolution, basically, within our own species (ie humans have changed slightly over the years: height, etc) but do not believe in macro evolution (ie we have evolved from some organic soup in a process that started a gazillion years ago).

    As much as people want to discredit either theory, none of us were around 10,000 years ago or 100 gazillion years ago. Science is using infallible science to try and prove their theory and religion is using their infallible, God-inspired Bible to prove their theory. Infallibility is in the eyes of the beholder. There is no first-hand, human recorded knowledge of either process.

    My subject explains my feelings on it all and I'm leaving it at that. Politics, Religion and sports will always start a flame-war and heated discussion.

  323. I think Mythbusters should do something... by Moisteri · · Score: 1

    "I reject the reality and substitute my own."

  324. What do you think happened by CelticPirate · · Score: 0, Troll

    I know this whole article is the start of a giant flame war, but I feel that I needed to chime in. Think about the computer you are using right now, was it not designed and manufactured by a sentient being? Or the building you are in? How can these things be deliberate acts but something as complex as a human and well existence be hap-hazard. My biggest argument for creationism would be to ask "and where did that come from" an infinite number of times. So you believe that life was created by a big bang huh, who created the materials that banged, something has to have proceeded that right? Why not accept that some higher power that we might not be able to comprehend exists, or are we so arrogant as to think that we are the top tier of existence? I could spend my whole life trying to teach a dog how to use the bash shell, but that dog is simply not going to comprehend it, I know IT guys that have a hard enough time with permissions! Why is it not reasonable that if we can not understand creation that maybe it was done at a higher level than we can understand.

    1. Re:What do you think happened by loxosceles · · Score: 1

      Why not accept that some higher power that we might not be able to comprehend exists, or are we so arrogant as to think that we are the top tier of existence?

      As opposed to the supreme arrogance of believing we're God's favorite creature?

      You can view atheism as arrogance, but that says more about you than about atheism. Most regard it as humbling to be a cousin of both chimpanzees and drosophila, all of us children of stardust and chaos rather than children of God.

      And no scientist should ever tell you that we're the top tier of existence, because that presumes we're the only and/or most advanced civilization in the universe/multiverse, which is far from certain.

  325. Re:Since when do you get to decide who is Christia by exp(pi*sqrt(163)) · · Score: 1
    > if someone says, "I am Christian," the only person they have to answer to is themselves

    If you allow people to say I am X, for any X, you're devaluing the English language in the sense that you strip all meaning from "I am". You can agree to disagree in the sense that it's your choice if you want to accept debased coin. But I think language is more useful if when someone says "I am a Christian" I now actually know more about that person than the fact that they've just said "I am a Christian".

    > how do you know whether someone else is "truly" or "actually" Christian?

    On a case-by-case basis. If someone claims to believe in an omniscient God then I'd expect them to act like they're being watched, even when they believe no person is watching them. If they claim to believe in eternal damnation for sinners, I'd expect them never to sin. If they claim to believe good people go to heaven I'd expect them to be cheerful about the death of loved ones. If they believe that human blastocysts are individual people I'd expect them to risk the life of a child on order to save a dozen such embryos on a petri dish. And so on.

    But remember I am 'agreeing to disagree'. You seem to have a higher tolerance for hypocrisy than me but I can't really claim that you are incorrect to be so tolerant.

    --
    Doesn't it make you feel good to know that our freedoms are protected by politicans, lawyers and journalists.
  326. Hmn, your description seems to work by Anonymous Coward · · Score: 0

    Funny, in the process of trying to expound on how counter-intuitive and defying simple explanation evolution is, you seem to have created a simple intutive description. Makes sense, seems robust.

  327. These surveys don't tell the whole story. by hey! · · Score: 1

    Nor do they even tell the right story.

    Lurking underneath these things is the literacy metaphor. Actual literacy is a fundamental skill needed to function in our society. People backing various forms of "literacy" use this as a metaphor, and then proceed to abuse the metaphor by conflating a fundamental skill with being able to repeat a bunch of facts.

    It's not that facts are unimportant -- far from it. But the reason that creationism is able to take hold is that while people know the basic facts of evolution they lack the epistemological skills to understand, use, or criticize those facts. So the situation is actually worse than the numbers suggest, because it is not enough to believe in evolution because you are told it is so. That is not "literacy". You have to understand it and see how the theory applies.

    It is tempting to brand creationists as idiots and crackpots, but really they aren't worse than people who believe in evolution, but without any better reason than somebody told them that that's the way it is.

    All theories, scientific or otherwise, explain. The power of scientific theories lies specifically in their limited ability to explain. By working with theories that do not automatically explain everything, science is forced over and over to try to disprove each theory in special cases. Scientific theories are like bones: the way the body creates strong bones is that bones that are stressed form micro fractures. The body repairs those fractures with material that is stronger. Likewise a paper that says, "natural selection predicts such and so and by golly we saw it" has less value than one in which the unexpected is found, especially at this point where evolution represents scientific consensus. It's not that anybody expects natural selection to be disproven given its current track record. But its power to spur advances in knowledge would be crippled if the facts always looked consistent with the theory.

    One thing we are not taught in school until college (or possibly graduate school) is how to deal with ideas sufficiently complex that they aren't automatically obviously consistent with every observation we can make. Even where we believe in something that is well tested and reasonably certain, like natural selection or democracy, it is possible to believe the theory in a simplistic way. Such superficial belief in a strong theory doesn't empower a person more than if he accepted an inferior theory like creationism or theocracy.

    --
    Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
  328. Civ4 by Prien715 · · Score: 1

    Did you remember that quote from Civ IV or am I the only one.

    Though I believe their translation of the quote (used for discovering fascism) was, "The great masses of the people will more easily for a big lie, than for a small one"

    --
    -- Political fascism requires a Fuhrer.
    1. Re:Civ4 by Bastard+of+Subhumani · · Score: 1

      "The great masses of the people will more easily for a big lie, than for a small one"
      You a mistaken; they more easily a sentence that no verb.
      --
      Only three things are certain; death, taxes, and apocryphal quotations - Ben Franklin.
    2. Re:Civ4 by CodeBuster · · Score: 1

      The quote was indeed used in the computer game Civilization IV for the fascism civic, but it originates from Hitler's book, Mein Kampf, and has been associated with fascism in general and Nazism in particular ever since the German defeat that ended World War II in Europe and the subsequent revelations of the discrepancies between what the German people were told and what actually occurred. Although, some have argued that they (the German people) knew or should have known what was really going on and that they chose to do nothing out of apathy, general despair, and fear. The quote is still important today because it serves as both a reminder of the past and a warning to future generations that it could all happen again if we do not remain vigilant. I was aware of the quote before I ever played Civilization IV and I suspect that many others were as well since the quote is often repeated in biographical and historical information concerning World War II.

  329. wow by spankey51 · · Score: 1

    I honestly thought this was an April Fools post...

    --
    -ubuntu others as you would have others ubuntu you.
  330. Calling a spade a spade by Laser+Lou · · Score: 1

    Look, instead of talking about how evolution MUST be true just CREATE LIFE IN THE LAB and that will fix it. I am sure that since evolution has to be true and happens all the time that ANY one of you Darwinists can create life in the lab, right??

    Creating life in a lab would not support evolution, but creationism, correct? Instead, observing life evolve from one form to another would support evolution, and that is done all of the time.

    --
    No data, no cry
    1. Re:Calling a spade a spade by democratssuck · · Score: 0

      No life form has EVER been observed to change from one form into another. They have been poisoning and radiating fruit flies for nearly 100 years and they cannot even produce a horsefly, much less a horse! All they have done is produce retarded fruit flies. Flies without wings, flies with 6 legs that are so heavy they cannot fly. Nearly all of them are sterile because of the mutations.

      BUt I don't want it to stop. Every day they do this they PROVE the existence of God.

  331. Re:Great web site raising questions about evolutio by IL-CSIXTY4 · · Score: 1

    I'll see your URL with this one... http://tinyurl.com/23vr4y I'd raise ya, but my last few hands have been pretty crummy.

  332. This is ridiculous by Anonymous Coward · · Score: 0

    Everyone should know that our species is a result of alien-monkey DNA experiments. Prove me wrong. It is written here so it must be true.

    How anyone can believe the far-out notions (such as the Bible saying God says eating shrimp is an abomination) is beyond my wildest imagination. BTW, eating shrimp is not an abomination and it really tastes good with cocktail sauce.

    Equally ridiculous is how people pick & choose one particular sentence from the Bible and claim that is the MOST IMPORTANT one. Why not the one about shrimp? Clearly, they are choosing to ignore the famous sentence in which Jesus himself begins, "This above all else, ..." For example, many fundamentalists choose "for God gave his only begotten son,..." over the one that Jesus said was above all else. Do they think themselves to be wiser than Jesus?

    It is reasonable to believe or no believe in the existence of God. But it seems that people smarter than me, such as the prominent founding fathers of America, etc. had some interesting things to say which is rarely taught in American public schools.

    Quotes:

    "I cannot imagine a God who rewards and punishes the objects of his creation, whose purposes are modelled after our own - a God, in short, who is but a reflection of human frailty. It is enough for me to contemplate the mystery of conscious life perpetuating itself through all eternity, to reflect upon the marvelous structure of the universe which we can dimly perceive and to try humbly to comprehend even an infinitesimal part of the intelligence manifested in Nature."
    --Albert Einstein

    "Science is the true theology."
    --Thomas Paine

    "The creation is the Bible of the Deist. He there reads, in the handwriting of the Creator himself, the certainty of His existence and the immutability of His power, and all other Bibles and Testaments are to him forgeries."
    --Thomas Paine

    "Some books against Deism fell into my hands; they were said to be the substance of sermons preached at Boyle's lectures. It happened that they wrought an effect on me quite contrary to what was intended by them; for the arguments of the deists, which were quoted to be refuted, appeared to me much stronger than the refutations; in short, I soon became a thorough deist."
    --Ben Franklin (in his autobiography)

    "Original sin was as ridiculous as imputed righteousness."
    --Ben Franklin

    "I cannot conceive otherwise than that He, the Infinite Father, expects or requires no worship or praise from us, but that He is even infinitely above it."
    --Ben Franklin

    I do not feel obliged to believe that the same God who has endowed us with sense, reason, and intellect has intended us to forgo their use.
    --Galileo Galilei

  333. Not only the US by WindSword · · Score: 0

    I heard on Radio 4 (BBC) that 6 out of 10 Britons doubts evolution as well. See this for more http://news.bbc.co.uk/1/hi/magazine/4398345.stm/. The Lord moves in mysterious ways...

  334. Rapture Bumper Stickers by mantissa128 · · Score: 1

    Do you think they've manufactured more than 144,000 stickers?

  335. Schools should teach Hindu Creationist by ZoOnI · · Score: 1

    I am all for the school system teaching creationism as the real truth. Within the diverse traditions of Hinduism, creation of the universe and life itself is generally believed to have occurred due to the will of a supreme consciousness or intelligence, often referred to as Brahman.

    --
    "Never say Never."
  336. Re:Great web site raising questions about evolutio by ColdWetDog · · Score: 1
    My eyes! The goggles, they do nothing! That wasn't very nice. Now I have a headache.

    Please, the fact that Pasteur figured out that spontaneous generation was wrong does nothing to refute evolutionary theory. One reoccurring theme amongst these fools is that just because you can take quotes out of context from the bible and thrash them about, they believe that's an appropriate response to anything.

    They understand less about the scientific method than a cow understands about the inside of church.

    --
    Faster! Faster! Faster would be better!
  337. Sampling error by brianeisley · · Score: 1

    Let's see. They say (buried at the end) that "In conducting the poll, Princeton Survey Research Associates International interviewed 1,004 adults aged 18 and older." They don't say how the poll was conducted, but it was probably by phone. They don't say where these people were, though if they were spread evenly geographically, it's easy to miss the cities, which is where the majority of the population is (and where the majority of liberals are).

    Also, they claim the poll "has a margin of error of plus or minus 4 percentage points for questions based on all registered voters and plus or minus 6 percentage points for results based on registered Republicans and Republican leaners." 4% is pretty big as it is, but if it's greater for Republicans, that implies that there's some sort of bias based on political affiliation. An intentionally skewed sample would account for this.

    This poll is meaningless. But that won't stop Newsweek from trumpeting it all over the SCLM.

  338. science: a candle in the dark by N3wsByt3 · · Score: 1

    "Might I ask, is that necessary for science? Because if so, it sort of contradicts what you've said."

    Yes, it is necessary for science to accept there is a reality. It doesn't have a preconceived idea about how that reality is or should be, however. Nor does it claim to have found the ultimate reality; science only postulates the closest approximation of observational reality, nothing more, nothing less.

    I don't see how that contradicts anything he said.

    People arguing against science on the grounds that all things are based on those beliefs of the scientists, effectively deny that there would be a reality outside what which people believe. Thus, they argue, belief in god or belief in science is on equal grounds.

    This reasoning is solipsistic in nature; all reality is only part of ones' one mind (or belief). Two counterarguments can be given for this reasoning:

    The first one is, that people who say that, don't actually follow what they preach, and thus show a high degree of hypocrisy within the context of their worldview. Even you (or posters of the same ilk before) do not really act as if no reality outside yourself exist (well, maybe if you're a particlar case of a sociopath). You *argument* as if you do (like with your speedometer example), but in a practical sense, you are well aware that if you see a wall, there is a reality of that wall, and that wall is not something you just happen to believe in. (If you truelly belief there is no wall where observation tells you there is one; please run through it, and thus prove that it was only imaginary).

    The second point is, that using that defense, it is impossible to explain how science would make any progress - nay - have ANY change not conforming to the 'general wisdom' at all. If science is just about 'believing' stuff, just like believing in God, then how do you explain that science proved the earth wasn't flat, while, during that time, the general belief was that it WAS flat. Or that the Earth wasn't the center of our solarsystem, when all people during that time (including the majority of the scientists) believed it was.

    If science couldn't observe something what constitutes a reality, outside ones' belief, then science would have concluded that Earth was the center, because that was the general accepted belief during that time.

    Both points indicate a severe weakness in the claim that science is just what scientists 'believe'. In contrast, the 'belief' in God (as described in the bible) has no means of establishing anything about the reality outside ones' (the believers') belief.

    --
    --- "To pee or not to pee, that is the question." ---
  339. APRIL FOOLS by Anonymous Coward · · Score: 0

    APRIL FOOLS

  340. No. This poll is in error. by Lord+Ender · · Score: 1

    I worked at a research company that did polls like this. I had to do the cold calls, myself. The dirty secret that polling companies don't want anyone to know about is this:

    Nobody responds to polls but lonely old ladies!

    And guess what? In the 1920s, hardly any women got good educations. Almost everyone was ignorant the world outside their towns.

    This poll does not represent America. It represents only our most lonely and senile citizens.

    --
    A slashdotter who didn't build his own computer is like a Jedi who didn't build his own lightsaber.
  341. How About This For Evolution by Anonymous Coward · · Score: 0
  342. The Difficulty of Having a Real Consensus. by Anonymous Coward · · Score: 0

    Agreed, but I suspect that the issue is much bigger than a "Religion vs Evolution". Rather it's a "Religion vs rejection of religion".* You saw this in the stem cell debate. You also saw it in the abortion debate, and you'll be seeing plenty more of it as mans knowledge and control over nature expands.

    *Religion itself is partially responsable for that outcome. Someone made the observation that atheism rises when religion becomes too full of itself.

  343. So? by hisstory+student · · Score: 1

    I can't believe this little article has pulled so many slashdotter's chain. What difference does it make what people believe? AFAIC this article has no business on a tech forum. These kinds of polls can get different results on any given day in any given place. Give it a rest!

    --
    Heard any good sigs lately?
  344. The word "adaptation" in evolution by Xarok · · Score: 1

    Personally if I was teaching a class on evolution I would never use this word "adapt", becasue it is misleading.

    A better way to explain evolution:

    -Organism's DNA can randomly change into most anything.
    -What's good, survived, and is only a small fraction of what DNA can mutate into.

    Let's say one of your sperm's DNA was altered in a way that when you produced a child, he or she was sexually attracted to rocks.

    This child goes around humping rocks of course, but more importantly they are not have sex with other people and are not passing on their genes. Their liniage dies out right away.

    Another way to explain evolution of life would be to say:

    Think of a factory that takes random raw materials and puts them together. 99.9% or more of the time you get random blobs of shit that are useless, but very rarely now and then you get something in a shape of a spoon or something that's actually useful.

    I think the way people exlpain evolution is usually not very strait forward and is the reason why so many people don't get it.

    -

    On another note, I think a lot of people just want to believe in a higher power and afterlife despite the fact that they thoroughly understand evolution.

    This could be because it's comforting or because it's merely genetic and the reason so many people are religious is because the religious mind has an evolutionary advantage.

    1. Re:The word "adaptation" in evolution by Anonymous Coward · · Score: 0

      you are half right. "evolution" is like quality control. A rock-humper would go in the trash bin (i.e. not reproduce). A useful being (probably none of the 52% that responded that they believe in evolutionism... ha) reproduces and lives on. So called evolution only throws out the trash, it doesn't create new KINDS of organisms. Example: a bananna, no matter how many bad ones get thrown out, can't just evolve into a horse. The whole species thing is garbage because "scientists" can could call any animal a different species when in fact it is just a minor variation. Example: asians are different from norwegians, but they are both people, a scientist could make them each their own species, but they could still never breed to produce a dolphin.

  345. I be sfmart cuz ah gotta BS in BS fum uh US skool! by Paracelcus · · Score: 1

    Ah gotta go bak to mah trailer now ur mah still's gonna blow up!

    --
    I killed da wabbit -Elmer Fudd
  346. Re:Fortunately, It Doesn't Matter What You "Believ by pommiekiwifruit · · Score: 1
    Facts -- like gravity, and the sphereoid shape of the planet -- exist whether or not people "believe" in them.

    Tell that to Wile E. Coyote!

  347. Typical by Orig_Club_Soda · · Score: 0

    ... calling someone an idiot just because they disagree with you.

    Dont forget, Evolution is a theory. There's strong evidence, but huge gaps. People who believe Evolution is a fact are also making a leap of faith - not a scientific deduction.

  348. The Real Question is Hydrogen vs CO2 by Anonymous Coward · · Score: 0

    The big debate about the early atmosphere is whether the atmosphere was reducing (hydrogen rich) or not, and the fundamental question was how quickly light gases like hydrogen and helium escaped into space. While Miller-Urey used a hydrogen, methane, ammonia mixture, modern experiments using our modern concept of an early atmosphere being a hydrogen, CO2 mixture produce organic molecules effeciently too. While there was Helium in there too, there's still enough H and CO2 to produce organics.

    1. Re:The Real Question is Hydrogen vs CO2 by Anonymous Coward · · Score: 0

      What organic molecules? Amino acids? Or cyanide?

      Lots of compounds have Carbon, not all are needed for building cells.

  349. Miller-Urey was not a fake by Anonymous Coward · · Score: 0

    And that "experiment" has been proven to be a fake and does not work if you try to re-create it.

    If you're referring to the Miller-Urey experiment, you're wrong. They did not fake it, and it has been replicated. Perhaps you've heard that more recent research has shown that the composition of the early Earth's atmosphere was different than what they used and distorted that idea into the claim that they faked the experiment. Being mistaken is different from faking an experiment.

    However, the fact that Miller-Urey's atmospheric composition was wrong doesn't disprove abiogenesis, as similar experiments using what current research shows the early atmosphere consisted of (H2 and CO2 dominated instead of the H2, CH4 dominated atmosphere Milley-Urey used) also produce organic molecules efficiently.

  350. Re:Great web site raising questions about evolutio by rad1836 · · Score: 0

    Evolutionists agree that you need long periods of time (hunderds of millions of years) for the statistics to play out to produce the proper mutations to produce the many species that we observe today. The article about radiometric dating alone clearly brings into question the age of the universe that is required to hold a belief in evolution. Enough question to require a belief in evolution to be a matter of faith. See URL:. Taunt on...I can take it.

  351. Re:Great web site raising questions about evolutio by rad1836 · · Score: 0

    I botched the URL in the previous message. See http://www.answersingenesis.org/docs2002/carbon_da ting.asp That's worth a taunt, isn't it?

  352. Statistical Impossibility by Anonymous Coward · · Score: 0

    I have no religious bias keeping me from believing in macro-evolution. All I want is some solid evidence. Evolution is statistically impossible. Sure, there may be that .00000000001% chance or whatever that is did happen, but it takes WAY more blind faith to think that the dice might've rolled JUST RIGHT trillions of times than it does to believe in the FSM.

    You've got trillions of cells in your body and there are billions of humans on the planet, whose total mass and number of cells is dwarfed by the mass of other animals, plants, fungi, and even bacteria. Bacteria can go through multiple generations in an hour, thus allowing for over 10,000 generations a year for billions of years, which is trillions of generations over the history of the planet. A probability of 1 in trillions isn't so rare when you're dealing with trillions of generations of time and trillions of trillions of entities per generation, and that's just looking at evolution on the whole organism level.

  353. Survery questions as flame bait by OraAllan · · Score: 1

    I find this thread and the commentary on it amusing. First the survey question "Is evolution well-supported by evidence and widely accepted within the scientific community?" If that was really the survey question then all you can really conclude is that Newsweak has a really lousy survey designer working with them. Here's a better way to do it. Question 1) Is evolution well-supported by evidence? Question 2) Is evolution widely accepted with the scientific community? It is perfectly feasible to answer no to question 1 and yes to question 2. All it requires is a belief that the evidence does not support evolution very well and that most scientists are wrong about believing it. I'm surprised that the self-congratulatory people that frequent Slashdot missed this elementary error on Newsweak's part. Or perhaps it wasn't an error. Maybe they were after circulation rather than a deep probe of the issue.

  354. Not the home of the free.. by StikyPad · · Score: 1

    The LAND of the free. Like the Land Before Time, only without the dinosaurs, and with more restrictions on everything (including, but not limited to, eating each other).

  355. 300 million identical people? by gabecubbage · · Score: 2, Insightful

    I don't mind my country of origin getting called out for being the home of millions of people who lazily and habitually defer to the loudest voice in the room, rather than take a moment to form their own opinion.

    And I don't mind the actions of my government being loudly decried as arrogant, clumsy, and in some cases: motivated by genuine corruption.

    Nor do I mind when religious zealots of any nation are criticized for allowing a narrow set of dogma and ritual dictate their entire world view.

    What I DO mind:

    I resent statements that begin with "Americans are...", "Americans believe...", and "America thinks..."

    The United States consists of roughly THREE HUNDRED MILLION PEOPLE spread (thinly!) from one North American coast to another. I live in the northeastern USA. I have more in common with my friends in Quebec than I do with Texans, Floridians, or even West Virginians. And I guarantee you there are plenty of Austin, Texas residents who take issue with being lumped in with the entire state. Or even their neighbors.

    The U.S. is a very big place, brimming with brilliant, vibrant and insightful individuals whose eyes are pointed right out into the big bright world outside. It's a country born out of a vast cultural confluence -- constantly in flux not only as one moves across state lines, but year to year, as well.

    Please keep in mind that there are many of us in the U.S. who DO understand the significance of an established peer-approved scientific theory, who DON'T believe that might always makes right, and -- believe it or not -- even hold onto a thick immutable optimism that our homeland might one day come around.

    1. Re:300 million identical people? by Mark_MF-WN · · Score: 1
      Every country has some "brilliant, vibrant and insightful individuals". In some countries, they are the leaders. In some, they are highly respected. In places like Iran, America, Syria, and Saudi Arabia, they are considered degenerate liberal elitists by most people. Your government is outspokenly hateful of those people, but at least America doesn't execute them.

      Interestingly, getting pissy about generalizations is an almost uniquely American quality. In most other cultures, people understand that generalizations have exceptions, and that those exceptions don't detract from the quality of the generalization. I can say that Humans have livers in their chests, without hassled about the very small number of people that don't. I can say that Humans prefer to not be murdered, and that's a perfectly okay analogy despite the very small number of people that want to be killed by someone else. I can say that Americans live in America, without any bitching about a few expats residing here and there. And I can generalize about Americans being dull, irrational, stupid, cowards, without having to get guff about the handful Mark Twains, Truman Capotes, Brian Warners, and other exceptional people. The whole point, in fact, is that those people are exceptional -- they're not normal, and they don't represent their society at all.

    2. Re:300 million identical people? by gabecubbage · · Score: 1

      I know far more bright people than I do liverless ultra-masochists. Taking it as given that a generalization can have worthwhile utility doesn't negate the clumsiness of statements clearly meant to suggest that all but a tiny percentage of marginalized Americans stumble fearfully from cheeseburger to church to the couch to watch Fox News.

    3. Re:300 million identical people? by Mark_MF-WN · · Score: 1

      I know far more bright people
      It stands to reason that the bright people would congregate into groups, doesn't it? Presuming that you are one of the aforementioned bright people, your associates are not exactly representative sampling of the American population. I might as well try to claim that most Canadians want to be doctors, based on the fact that most of the people I associate with regularly are on the medical-school track in college. I could even claim that most Canadians are immigrants, since most of the people I associate with are from other countries.

      Deep down, you know that people who "fearfully from cheeseburger to church to the couch to watch Fox News" are the vast majority. After all, if you shaved a chimpanzee and gave it the capacity to ignore reality in favour of delusional beliefs, that's what it would be doing, right? And most people are no better than paranoid, delusional, shaved chimpanzees. Luckily, most people live somewhere that has folks who know how to take care of chimpanzees and keep them relatively calm and safe. Those shaved chimpanzees have the sense to allow whichever of the keepers does the best job to be the one that they allow to manage them. America is the place where the shaved chimpanzees killed the keepers and started letting the chimp with the loudest howl to lead. And predictable, most Americans behave -- both individually and en-masse -- precisely the way you would expect 300 million paranoid shaved schizoid chimpanzees to behave.

    4. Re:300 million identical people? by gabecubbage · · Score: 1

      I could just as easily have said "I observe far more bright people randomly in the grocery store than I do liverless ultra-masochists." But I appreciate the thrust of your argument. I CAN'T say "I've randomly plucked 1,000 Americans from throughout the nation and engaged each of them in extensive conversation about life, the universe and everything". But then, I said from the start that there are some pretty dramatic regional variations in American perspective. And I'm also a big fan of cynicism, as are you, based on your "most people are no better than paranoid, delusional, shaved chimpanzees" statement. At this point, however, it seems like we're not talking so much about Americans and their inherent capacities, but human beings and their relationships with their organizational leaders. You won't get any argument from me about the inmates having successfully taken over the asylum (or the perhaps the zoo) in the United States.

    5. Re:300 million identical people? by Mark_MF-WN · · Score: 1

      But that's my whole point -- the dysfunction starts with Americans being incapable of selecting their leaders sanely. Nearly every other democratic nation does better in this regard. The exceptions are particularly quite notable since most of them subsequently ceased to be democratic, and the most prominent two later became known as the "Axis". Another one of the major gaffs in leader selection led to a formerly strong nation ending up a backwards third-world nation rules by Clerics who are still patting themselves on the back for successfully ridding their land of educated women and people that think freedom is something other than a sin against Allah.

    6. Re:300 million identical people? by gabecubbage · · Score: 1

      I'll be the first to condemn the national-level political will of this country. National leaders here are elected less for their leadership ability or ideas than for their skill at remaining non-offensive without crossing the line into appearing weak. It's the epitome of bland irresponsibility, and I can't possibly defend it. I expect you and I would agree more than we'd disagree on many peripheral subjects. The sticking point for me on the topic is simply this blithe assumption that seems lately more and more prevalent in the world that a walk down every street in every town in the U.S. is actually a swim through a sea of nonstop ignorance and fundamentalist fog-vision. It's simply not the concrete reality, and smacks of the same kind of ignorance "Americans are" purported to all exercise. The government is the result of elections, yes. But not consensus. And the dissenters are not a small minority by any measure.

  356. You know what... by JeremieRyan · · Score: 1

    This is what is wrong with this country. People with no respect for other peoples beliefs. What does it matter if you believe in evolution or not. Those who do believe shouldn't be labeled as atheists and the ones that don't believe shouldn't be labeled as ignorant. I believe in natural selection, but only to a point where the species doesn't change from a rabbit to a prarie dog or vice versa or that there was a prarie rabbit common ancestor that they share. The concept is ridiculous to me at best. My faith in that all time number one best selling book whose name is forbidden around here because of its ability to incite flame wars among the most docile of posters tells me that evolution is wrong. That is my belief, and anyone who wishes to challenge my belief, come on, i'm willing to die for what I believe. How about you?

  357. Either way it's a fairy tale. by jpellino · · Score: 1

    Not that that's a bad thing, as long as you understand it is in fact a fairy tale.

    I'm Roman Catholic, and a scientist. I was trained in Catholic educational institutions by (largely Catholic) scientists. Those two things do not need be at odds. The Benedictines didn't take us aside and say "You know, nice job on the genetics final, but just between us marines, we all know Darwin and Mendel are patently evil and full of it."

    Once we got it straight that much of the religion is a set of myths that do serve explain the character of deeper truths, we're cool with that. I don't believe in Kronos, but I do understand that his story explains something about the behaviour and nature of time on a nuanced level that is not to be taken literally, but deepens and broadens your understanding of it.

    Believing in the values the church espouses (and by the church I mean the church at large, not the simply bureaucracy) is hardly a bad thing. I don't believe Adam and Eve and Cain and Abel were historical figures, but that their stories explain a lot about who we are as humans. I don't worship John Steinbeck, but East of Eden was inspiring and easily a better read than Genesis.

    I can't prove one way or the other if we have a life after death. It doesn't matter while we're here. We're here to make the most of what we can do in this world. People who truly understand what religion tells us aren't doing it out of a fear of what comes next or promise of a reward. They're doing it because it makes the world work.

    It is not necessary to invent a particular afterlife in order to feel good even about Pascal's wager, as Pascal's wager was never necessary, it was merely a way to counter the extreme positions some can take about the existence of God.

    In my tradition, the agreed mythology is that we'll be on clouds, withe white robes and halos, barefoot, harps and all. My aunt Alice will get to meet Jimmy Stewart, and I can play harmonica to Einstein's fiddle. But I'm not living my life in expectation that that's what will or must or needs to happen. It would be peachy if does.

    It would be equally peachy if what remains after I go is simply the effect of my life on this earth. That's all I'll ever ask or expect.

    --
    "Win treats sysadmins better than users. Mac treats users better than sysadmins. Linux treats everyone like sysadmins."
  358. As an example.. by EmbeddedJanitor · · Score: 1

    Land of the free. Guaranteed freedom of speech. Press freedom. US 23rd (beats Jamaca Woooohooo!) http://www.rsf.org/article.php3?id_article=11715

    --
    Engineering is the art of compromise.
  359. What is the evidence for evolution by JustinY2K · · Score: 0

    Everyone keeps mentioning this "evidence" for evolution all the time. "How can these people believe (Creationism/the Bible/anything other than evolution)?" I'm curious, what is this evidence? I'll go over a little of what people would probably say, then point out a few problems. I realize that some if not all of this may have been said already, but frankly, I'm a college student; I don't have time to go through each post. Carbon dating: people always throw out carbon dating as a reason that evolution is true. First off, if you throw out carbon dating, then you clearly aren't aware of what you are talking about anyway. No one who is trying to find the age of something older than about 60k years will use carbon dating. They will probably be using uranium-lead or some other method. The point is that they are going to use the dating method that will give them a number that they are looking for. This strikes me as stacking the cards in your favor. "Well, this thing must be about this old. Which of these will give us a number in that range?" After experimentation, "Aha, look! It's as old as we thought that it was!" This is ridiculous. Also, the numbers can be way off anyway. We can't even date things correctly that we know the age of. For instance, I think it was Etna that erupted about a thousand years ago. When potassium-argon dated, the date came out to be 100-200k years. You can carbon date a live clam to 3000 years old. If we have a system that doesn't work on stuff that we know the age of, and then assume it to be correct when applied to things that we don't know the age of, that's also ridiculous. Dating methods are not a good argument for evolution. Survival of the fittest: This is not an evolutionary theory. Charles Darwin didn't come up with this, and even if he did, it doesn't make a difference. It's just the method that he chose as the vehicle for his theory. natural selection: Also not an evolutionary theory. We can see this in nature. People have extreme difficulty disassociating the two. Natural selection does not equal evolution. The fossil record: The fossil record proves one thing: stuff died. I have met people who think that when God created the world, He created it with the the fossils already in the bedrock and that the animals never actually existed. I think this is ridiculous. However, I also think that it's foolish to assume that it proves anything other than my first point. Relative depth doesn't mean that something is older, and more and more index fossils are being found to still be alive. There are huge holes in the fossil record all over the place. It doesn't support much of anything. Biology: There are a few things that we learn in biology pretty early on. One of them is that life doesn't come from non-life. Evolution necessitates this. Evolutionary scientists have no idea how it happened. The Miller experiment in the middle of the century didn't prove anything. He made amino acids. That's pretty much the same as saying he made a hunk of metal, but a hunk of metal is phenomenally different than an engine or a clock or a building. Besides, his simulated atmosphere wasn't correct anyway. The actual atmosphere that would have existed would have made two organic compounds: cyanide and formaldehyde. I don't think that I need to tell any of you how conducive they are to life. Regardless, the probability of a long string of amino acids coming together in a specific manner to form a single protein, and then that happening a bunch more times in a small area so that the correct proteins come together in the correct manner to make a single living cell are laughable. Not only this, but the cell would have to be able to consume food and reproduce. It wouldn't have either of those abilities automatically just because it was alive, and the probability of them all happening at the same time make it impossible. Your response to this could be "Well, I know it was unlikely, but we're here, so it must have happened." That argument works for me as a Creationist

    1. Re:What is the evidence for evolution by JustinY2K · · Score: 1

      You know, when I was typing all that into the text box, I had it formatted by point and paragraph, but apparently I haven't figured out how to use the text editor thing yet...

    2. Re:What is the evidence for evolution by Copid · · Score: 1

      Macroevolution: This doesn't happen. We haven't ever seen it happen, and it's scientifically impossible anyway. To say otherwise flies in the face of the second law of thermodynamics, information theory, and a bunch of other scientific ideas.
      I'm afraid I can't sift through the litany of complaints you're bringing up, and I tend to like to focus on the quantifiable, so I'm very interested in how you apply thermodynamics and information theory evolutionary theory. How do you measure "information" in an organism? You're venturing into an area that's essentially purely mathematical, so I think that you should be able to put up some numbers, or at least a model.

      I bring this up because a lot of creationists seem to like to shroud their ideas in the rigor of mathematics without bothering to define their terms or even explain how the inherently mathematical models they're using apply to the situation. I'll generally chalk it up to ignorance on the parts of most of the people who bring up statements that they've read on the Internet like "Evolution violates the second law of thermodynamics!" but I know that there are a few people out there like Dembski who are educated enough to know better who are clearly bringing up scary-sounding math in order to lend their ideas a bit of undeserved credibility. I just haven't found a better way of dealing with it than simply taking people to task over it. So please, if you can, venture a little bit into this topic. Challenge #1: I plant a seed. It grows into a tree. Violation of the laws of thermodynamics? If not, please explain how the mechanisms in evolution differ.

      Well, if there are indeed only two possibilities, evolution and Creation, and I can discredit evolution to the point of making it seem impossible, then I have succeeded in providing evidence for Creation.
      That's an awfully big if. What makes you think that you're not simply presenting a false dilemma?
      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
    3. Re:What is the evidence for evolution by JustinY2K · · Score: 1

      Evolution, in the sense of molecules to man, requires an input of information. When you make an amoeba, that thing has a lot of information stored in it. When you give that amoeba the ability to consume food, that's more information. When you give it the ability to reproduce by dividing, there is a lot more information that has to be input. DNA and RNA are really little more than information on how the cell, and the organism overall, is supposed to act. Information theory basically says that the information of a system can not increase without an outside influence, and the second law of thermodynamics says that as time goes on, order tends towards disorder. Evolution, however, requires the opposite on both counts. That is what I mean when I say that macroevolution flies in the face of those two theories. The reason that the seed acts like it does is that the information for that tree is already in the seed. The seed effectively runs on a program that says "Do this, then do this, then do this." That's information. The cells are programmed to divide like that. Actually, I think it isn't a big if. There are inherently two choices: 1. We got here through some method that doesn't involve outside influence. 2. Some intelligent entity made us. There really aren't any other choices. Therefore, the 'if' isn't very big. It's going to be one or the other.

    4. Re:What is the evidence for evolution by Copid · · Score: 1

      Evolution, in the sense of molecules to man, requires an input of information. When you make an amoeba, that thing has a lot of information stored in it. When you give that amoeba the ability to consume food, that's more information. When you give it the ability to reproduce by dividing, there is a lot more information that has to be input. DNA and RNA are really little more than information on how the cell, and the organism overall, is supposed to act.

      So far so good.

      Information theory basically says that the information of a system can not increase without an outside influence, and the second law of thermodynamics says that as time goes on, order tends towards disorder. Evolution, however, requires the opposite on both counts. That is what I mean when I say that macroevolution flies in the face of those two theories

      Let's pretend I know something about information theory. Can you show your work on this? I think you're missing a very important variable: energy. Before coming back to this, you may want to reread the second law of thermodynamics. You've presented a very touchy-feely version of it, but not a complete or entirely accurate one. It's great for giving people a basic understanding of how thermodynamics works, but it falls flat on its face for what you're trying to do.

      The reason that the seed acts like it does is that the information for that tree is already in the seed. The seed effectively runs on a program that says "Do this, then do this, then do this." That's information. The cells are programmed to divide like that.

      Let's try another exercise: We start with a bowl of salt water sitting in the sun. A week later later, the water has evaporated and the salt has formed lovely crystals in the bottom of the pot. Those salt crystals are highly ordered. What happened, thermodynamically speaking?

      The point here is that given a flow of energy it's possible to separate systems into high and low entropy parts. That's how life does its thing. That's how living things keep from dissolving into disorderly piles of goo. It's also what allows DNA to accumulate information and complexity. Any system that takes energy as an input and is capable of reproducing itself with modification can very easily accumulate new information. For example, which strand of pseudo-DNA contains more information:

      1) ACTGTGTATCGGGC
      2) ACTGTGTATCGGGCCGGGCA

      Clearly, version 2 does. There are known mechanisms for this type of change to happen in DNA, so clearly that sort of change doesn't violate the laws of thermodynamics. So, what gives?

      Fundamentally what gives is, evolution violates the popular science version of the second law of thermodynamics, and it violates the hand waving versions of "information theory" people put up on web sites, but it doesn't cause any trouble for actual thermodynamics or actual information theory. If you think otherwise, I strongly suggest running the numbers. Any argument that uses thermodynamics and or information theory should be expressible mathematically. The problem is, creationist web tracts tend not to want to define their terms, because if they did, it would be obvious that they were equivocating by using words like "information" fast and loose and not according to the rules of the formal systems they're invoking.

      Actually, I think it isn't a big if. There are inherently two choices: 1. We got here through some method that doesn't involve outside influence. 2. Some intelligent entity made us. There really aren't any other choices. Therefore, the 'if' isn't very big. It's going to be one or the other.

      So essentially you're suggesting the "evolution or magic" dilemma. I'm suggesting that even if evolutionary theory as it stands is wrong, there may be any number of other naturalistic explanations that still explain our observations and don't involve intelligent action. Cer

      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
    5. Re:What is the evidence for evolution by JustinY2K · · Score: 1

      Apparently there was a bit of ignorance on my part of where the information on information theory that I was referring to came from. It falls under information theory, but is more specifically called the 'law of conservation of information.' It was coined by a man named Medawar "to describe the weaker claim that deterministic laws cannot produce novel information." A man named Tellgren claims that it is mathematically invalid, Dembski disagrees, and the mathematical proofs thereof are all above and beyond my capacity for understanding. It basically states that in a closed system, there can be no increase in information without an outside influence. According to Rudolf Clausius, "The entropy of an isolated system not in equilibrium will tend to increase over time, approaching a maximum value at equilibrium." What definition of the second law are you using that gives my point trouble? As far as energy is concerned: energy is only useful when it is focused. You can put a bull in a china shop and generate a ton of energy, but nothing good can come of it. I've seen people in pools expend huge amounts of energy to get to shore and fail because they didn't know how to focus it (they made it out ok). You can take the pieces of a clock, put them in a bag and shake it for eternity and it'll never actually come together to make the clock. You can put a frog in a blender and expose it to a lot of energy, but no life will come of it. With the salt crystals: That's how salt comes together; it just won't happen any other way in normal circumstances. However, the same is not so for DNA. There is no particular order that the 4 nucleotides have to go in. The fact that they do go the way they do for whatever animal or organism we're talking about is just because that's how they're programmed to form, not because there's any particular force that makes them form that way. Besides, although the sequence AGCAGCAGCAGCAGC is very ordered, there's really nothing that you can do with it. You need a huge amount of variety to make DNA that will accomplish anything, and if even a few nucleotides are in the wrong place, the results could very well be disastrous. If I'm defining my terms incorrectly or being less than forthcoming, please be aware that it is not intentional. However, as opposed to just telling me that I'm using them incorrectly, show me the right way and why. Nowhere in my two choices did I mention evolution. I specifically made it in the form of whether or not there is an outside influence of any kind, as would exist in the presence of a deity of some kind. I also object that you refer to the second of the two forms as "magic." I don't think evolution is possible, but I'm not going to insult your intelligence by calling it magic or stupid or retarded or anything like that. I've been saying that I disagree with it for X reason. As far as other things instead of evolution: why is it so offensive to you that a deity created the world? If he did, then he couldn't possibly have violated the laws of physics or thermodynamics. He created them. He is outside of them, not subject to them. If you are fundamentally different from what you create, you aren't subject to it. I hypothesize this: Around 6,000 years ago, God created the world and everything in it. He created it with the appearance of age, although I don't think He created it with the appearance of millions or billions of years. He created it in six literal days, with the light being created before the earth, which is why we can see stars that are so far away. Most fossils were formed during the flood, as well as a lot of major land-masses. As far as the big bang: Scientists view the universe as a big clock that is slowly winding down. As they rewind it to see how it formed, they reach the point where it actually started but don't know it and drive on to where it becomes this little infinitely dense point. The point never existed, but they don't know that they rewound farther than they should have.

    6. Re:What is the evidence for evolution by Copid · · Score: 1

      Apparently there was a bit of ignorance on my part of where the information on information theory that I was referring to came from. It falls under information theory, but is more specifically called the 'law of conservation of information.' It was coined by a man named Medawar "to describe the weaker claim that deterministic laws cannot produce novel information." A man named Tellgren claims that it is mathematically invalid, Dembski disagrees, and the mathematical proofs thereof are all above and beyond my capacity for understanding.

      The point here is that while selection could be called deterministic, the input to it is random. Even if deterministic systems can't create new information (and I suppose I'll tend to agree barring somebody pointing out where I'm wrong), the random mutations that drive much of natural selection are decidedly not deterministic. I suppose that one could say, philosophically, that the entire universe is predetermined and pre-loaded with all the information we need, but I'm excluding that point for the moment. I know that if I say that too loudly, MarxistHacker42 will show up. Natural selection is essentially a filter for a huge amount of information being pumped in into it in the form of mutated and crossed over genetic material.

      According to Rudolf Clausius, "The entropy of an isolated system not in equilibrium will tend to increase over time, approaching a maximum value at equilibrium." What definition of the second law are you using that gives my point trouble?

      That's a much better definition. The part you're missing is the phrase isolated system. Life is not, by any stretch, an isolated system. It constantly takes in energy and keeps its localized entropy low. Once you start doing that, all bets are off and the whole thermodynamics argument goes out the window. Self-replicating systems are essentially machines whose job it is to take in energy and high-entropy inputs and create low-entropy output. It is also worth remembering that the second law is probabilistic in nature. It's possible to violate the second law on very small scales (cold regions of molecules allowing a net flow of heat to warmer regions of molecules), although extremely unlikely for macroscopic violations to happen. In short, tiny violations of the second law can and do occur on the molecular level.

      You can put a bull in a china shop and generate a ton of energy, but nothing good can come of it. I've seen people in pools expend huge amounts of energy to get to shore and fail because they didn't know how to focus it (they made it out ok). You can take the pieces of a clock, put them in a bag and shake it for eternity and it'll never actually come together to make the clock. You can put a frog in a blender and expose it to a lot of energy, but no life will come of it.

      These are all fine aphorisms, but they really don't address the topic at hand. Natural selection is the focusing mechanism. When one mutates DNA (or produces novel sequences through sexual reproduction), one is throwing your proverbial clock parts into a bag. The difference here is that natural selection filters those results and can actually end up with a clock. Let's modify the experiment for the moment: Imagine you shake that bag around and there's a little person inside. Whenever two pieces hit one another, that person decides whether they've gone into useful positions or not. If they have, he holds them together. If not, they go on shaking. Eventually, you'll find gears meshing and find some interesting mechanical mini-contraptions in your bag. All you put in was raw material and random shaking, but a simple filter ("if the pieces fit together, keep them") ends up producing interesting results.

      Likewise, if some DNA randomly gets copied (and this happens very regularly), the environment will filter the results. Many times, it does so by killing the mutant. More often, nothing noti

      --
      An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
  360. America vs EU, moderated view by N3wsByt3 · · Score: 1

    "There's no reason not to provide child molestors with psychiatric treatment."

    True in principle, in as far as people who commit crimes due to mental illnesses deserve treatement.

    "After all, they are quite clearly mentally ill."

    Well, that would actually depend on the historical context (and the society in which it happens). I know it's not a popular thing to say, but it just so happens I recently read in a scientific magazine about homosexuality (including what we now would call pedophilia) which actually shows that it was rather common, accepted and often seen as beneficial (also for and by the youngster) in ancient times and in different cultures (ancient -greek, -roman, -japanese culture, etc.) Just to show that 'quite clearly mentally ill' is not quite as clear; it's rather a fairly recent view we have of it (which, according to the article, started only in the 17th century in Europe), which has primarily to do with how our current society views it, not (inherently) on the behaviour itself. I'm not debating the value (or lack thereof) of those other viewpoints, but the least one should acknowledge is, that 'quite clearly', in different times or in other cultures it wasn't considered a mental illness at all.

    Just to caution you about making broad statements which would imply a universal truth which isn't universal at all.

    "Half the problem with western criminal justice systems is that they think punishment is enough, and never try to actually correct the behaviour."

    True. Though in all honesty, I don't think the Russian/chinese/japanese/etc. justice systems do much better, and, in fact, often are worse.

    "And I suggest hanging George Bush in order to protect the Iraqi people."

    I'm actually hoping you use hyperbole, here. At the point where the USA/Iraq is at now, and without knowing who would replace Bush, it is doubtful anything drastic would change for the iraqi people. In any case, it's highly unlikely that it would actually protect Iraqis, if you look at it in a practical sense.

    "World War 2 was caused by the fact that Germany was imposed with crippling war reparations after World War 1, and suffered under terms of surrender that were destroying their entire society. That's why the US had the sense to help rebuild Germany and the rest of Europe after WW2 (that, and the fact that it served as a form of workfare to keep Americans employed, since Marshall plan dollars had to be spent on American goods). "

    Largely true. And, of course, because they feared the growing influence of communism in europe, and thought this would also be a way to combat it. That said, the marshallplan did help europe back then, we should acknowledge that too, whatever the reasons were. (Not that it serves as an excuse to try to quench EU-criticism of the USA today).

    "Rabid nationalism and prejudice have never caused anything more serious than a civil protest or a rally. War is about economics -- period."

    I have to disagree with that one. Certainly, in most wars, economics have played a part, but it's certainly not the only cause or reason why countries fought eachother. For instance, I think it has as much to do with simply the ego's of monarchs (and later on, dictators) which ruled the european countries for the majority of warridden times in Europe. Also, there have been wars where whole tribes were exterminated as an act of revenge (or the showing of supremacy), where, after the victory, they just went back, and did no effort to economically benefit from that victory.

    Ofcourse, most of the time, there is an economical aspect in it, and one would be a fool to claim otherwise. However, rabid nationalism (or chauvinism) is much more dangerous in getting countries to fight eachother than you seem to imply.

    "It's caused by the fact that Americans are a) stupid, b) gullible, and c) religious zealots."

    This is, again, a rather dubious claim, because it's too broad a statement. Americans are just like any other people, at least in essence. Yo

    --
    --- "To pee or not to pee, that is the question." ---
  361. Re:Alarming? Consider this... by dvdrsmth · · Score: 0, Troll

    I asked a dear friend who's much smarter than I on the subject of evolution to help articulate my perspective: Paradigms shift all of the time. Hundreds of years ago, it was the common consensus that the solar system revolved around the earth. The science textbooks changed and a new paradigm entered the scene. The beliefs of science are in constant flux. If the world lasts, a thousand years from now, our progeny will scorn our shallow understanding of the world. Compared to eternity future, we are but still at the beginning, playing with the dust and pebbles of the universe while thinking we are doing something grand. Evolution is a paradigm that is in grievous trouble. Fred Hoyle of the British Academy of Science and mathematician Chandra Wickramasinghe decided to calculate the probability of life coming into existence anywhere in the universe. Their results? Utterly impossible. They gave it all the time in the universe, but time plus chance produces nothing! Francis Crick, Noble Prize winner for his discovery of DNA, also attempted to calculate the probability that life sprang into existence spontaneously. His results? Utter impossible. Instead of jumping into the arms of God, Crick decided to propagate the theory of genetic panspermia. In sum, his theory propounded that life on earth was seeded by benevolent and mighty aliens. Their work made life possible through the path of evolution. The problem? Crick merely delayed the impossible, casting it back on a continuous regression of aliens. Stephen J. Gould, one of the greatest defenders of evolution, was also troubled by issues that he saw within evolution. As a result, he came up with the theory of punctuated equilibrium. He postulated that there were sudden leaps in evolution that left no transitional forms. If only he had made one massive leap, he would have ended up where theists are today. Are these the actions of men that believe that the evolutionary paradigm is secure? While the defenders of evolution are resorting to new and stunning conjecture to cover the nakedness of evolution, intelligent design has been seeking to topple the entire infrastructure. The simple design of a mousetrap is irreducibly complex, no one part of the mousetrap makes sense without all of the other pieces. The evolution of a species or a single organ is also irreducibly complex. Take for example the eye. The eye is composed of mechanisms that are entirely reliant upon one another for the eye to function at all. If evolution is true, each part of the eye evolved over time and accrued in aggregate form. Unfortunately, the individual parts of the eye do not promote the survivability of the animal. They may actually impede its survivability. Over millions of years, the evolutionist would have us believe that the portions of the eye accrued until we had a complete and functional organ. Another stake in the heart of evolution is the absence of transitional forms. Darwin predicted that this would be the downfall of his theory. Nothing has been found. Frauds have been created such as Piltdown man, Java man and a host of other oddities found to be made out of bits of extinct pigs, apes, etc., but nothing definitive has been offered to support the claims of evolution. If nothing else, our excavations should lead us to conclude that life was more complex and varied in the past than it is at present. This concurs with the concept of entropy. The third law of thermodynamics is at odds with evolution. Time and chance lead to a loss of genetic information, the accretion of deleterious and deadly mutations. Per the evolutionary model, the very environment that may have produced the earliest protein chain is the same environment that would wipe it out in the next second. Life and entropy teach us that life is fragile. The fossil record has yielded no evidence for evolution. Fossil beds contain a mixture of species and life forms from supposedly different evolutionary eras all at the same level of excavation. The geological column, which is purported to have

  362. Re:Alarming? Consider this... by dvdrsmth · · Score: 1

    I asked a dear friend who's much smarter than I on the subject of evolution to help articulate my perspective (sorry this got posted 2x, the first was basically unreadable without proper formatting):

    Paradigms shift all of the time. Hundreds of years ago, it was the common consensus that the solar system revolved around the earth. The science textbooks changed and a new paradigm entered the scene. The beliefs of science are in constant flux. If the world lasts, a thousand years from now, our progeny will scorn our shallow understanding of the world. Compared to eternity future, we are but still at the beginning, playing with the dust and pebbles of the universe while thinking we are doing something grand.

    Evolution is a paradigm that is in grievous trouble.

    Fred Hoyle of the British Academy of Science and mathematician Chandra Wickramasinghe decided to calculate the probability of life coming into existence anywhere in the universe. Their results? Utterly impossible. They gave it all the time in the universe, but time plus chance produces nothing!

    Francis Crick, Noble Prize winner for his discovery of DNA, also attempted to calculate the probability that life sprang into existence spontaneously. His results? Utter impossible. Instead of jumping into the arms of God, Crick decided to propagate the theory of genetic panspermia. In sum, his theory propounded that life on earth was seeded by benevolent and mighty aliens. Their work made life possible through the path of evolution. The problem? Crick merely delayed the impossible, casting it back on a continuous regression of aliens.

    Stephen J. Gould, one of the greatest defenders of evolution, was also troubled by issues that he saw within evolution. As a result, he came up with the theory of punctuated equilibrium. He postulated that there were sudden leaps in evolution that left no transitional forms. If only he had made one massive leap, he would have ended up where theists are today.

    Are these the actions of men that believe that the evolutionary paradigm is secure?

    While the defenders of evolution are resorting to new and stunning conjecture to cover the nakedness of evolution, intelligent design has been seeking to topple the entire infrastructure.

    The simple design of a mousetrap is irreducibly complex, no one part of the mousetrap makes sense without all of the other pieces. The evolution of a species or a single organ is also irreducibly complex. Take for example the eye. The eye is composed of mechanisms that are entirely reliant upon one another for the eye to function at all. If evolution is true, each part of the eye evolved over time and accrued in aggregate form. Unfortunately, the individual parts of the eye do not promote the survivability of the animal. They may actually impede its survivability. Over millions of years, the evolutionist would have us believe that the portions of the eye accrued until we had a complete and functional organ.

    Another stake in the heart of evolution is the absence of transitional forms. Darwin predicted that this would be the downfall of his theory. Nothing has been found. Frauds have been created such as Piltdown man, Java man and a host of other oddities found to be made out of bits of extinct pigs, apes, etc., but nothing definitive has been offered to support the claims of evolution. If nothing else, our excavations should lead us to conclude that life was more complex and varied in the past than it is at present. This concurs with the concept of entropy.

    The third law of thermodynamics is at odds with evolution. Time and chance lead to a loss of genetic information, the accretion of deleterious and deadly mutations. Per the evolutionary model, the very environment that may have produced the earliest protein chain is the same environment that would wipe it out in the next second. Life and entropy teach us that life is fragile.

    The fossil record has yielded no evidence for evolution. Fossil beds contain a mixture of

  363. Post by Mark_MF-WN · · Score: 1
    You didn't even read my post: the key term here is "had" -- as in "the US had HAD an absolutely enormous positive impact on the world". The US now has an absolutely enormous negative impact on the world. The USA spreads war and conflict, it strips other nations of their sovereignty, it assassinates democratically elected leaders simply because their economic policies conflict with America's, it gives weapons to both sides during wars in the middle east, it holds foreign nationals without trial and tortures them for suspected crimes, ... and that's not even getting into what America does to its own citizens.

    Everyone respects the Americans of the 18th and 19th centuries, and the half of twentieth century. Nowadays though, you'd have trouble finding enough honesty, compassion, integrity, intelligence, honour, creativity, or even basic human decency in the entire nation to fill a thimble. Americans produce very little of worth (most Americans work in the service industry or in management, both fields that produce no value of any kind), and what they do produce is grossly overshadowed by the destruction that America wreaks all over the world.

    When you get down to brass tacks, the US is little better than places like Iran and Syria -- full of irrational, violent, stupid, cowardly, close-minded religious zealots. And the handful of good people that America has left are despised by the rest for being "liberal elitists" (no matter how humble or conservative they might actually be).

  364. Read the poll question lately? by FrameRotBlues · · Score: 1

    No, I didn't RTFA (although I've seen enough excerpts in people's posts), BUT doesn't the poll question ask about evolution theory being accepted "... in the scientific community"? The poll doesn't say anything about what you believe about evolution theory, it asks what you think scientists think about evolution theory, and whether the theory of evolution is well supported by scientists. It would be pretty judgmental to think that all Americans are part of the scientific community. It's a poor poll, no matter which way you slice it. However, it looks bad when nobody actually reads the question and instead rant and rave about how Americans don't believe in evolution, and we're all going to hell, and our children are going to grow up stupid...

  365. problem: red color by r00t · · Score: 1

    Red is difficult. Nearly all red dyes fade. Red also tends to be unhealthful; ever notice that we're up to #40 on red food color in the US?

    Black is best. Blue tends to be better than green. Red is terrible.

  366. Re:Alarming? Consider this... by Copid · · Score: 1

    The third law of thermodynamics is at odds with evolution. Time and chance lead to a loss of genetic information, the accretion of deleterious and deadly mutations.
    In the spirit of "not attempting to be exhaustive with this list of problems" I'll start here. Please define "genetic information" in such a way that we can quantify it. Nobody on the creationism side of things has ever been able to do this in a meaningful way, so I'm tempted to ignore the thermodynamic and information theory based arguments entirely. Here's a thought experiment: I plant a seed and it grows into a tree. Did I violate any laws of thermodynamic? If so, how? If not, please explain how evolution differs from this process.
    --
    An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
  367. It's not about Evolution by alexo · · Score: 3, Insightful

    Rather, it's about Revolution.

    Ignorant people are easier to manipulate.
    They are less likely to question the acts of their government.
    They are less likely to cause problems.

  368. It's a Myth by Askmum · · Score: 1

    It made me think immediately of Adam from the Mythbusters:
    "I reject reality and substitute my own."

    So do 48% of Americans.

  369. A Biologist's take... by Anonymous Coward · · Score: 0

    As a biologist I find these comments to all be amusing...for one, the figures being given concerning how many people do/not believe in evolution are a intriguing...where are these coming from? One thing about science these days is that we often teach things we don't believe in and among ourselves we'll admit to it. It's also unwise to say much in disagreement to something held so sacred in the field even if it's challenged or not, and no, there is no mountain for evolution: numbers can be made to say anything, and we do this. On the one hand this is a candid admission, think of yourselves as "initiated" if only on such a small scale that you'll likely never know what exactly I'm talking about. On the other hand, I'd highy suggest that any comments about biology be better informed than the information from crappy textbooks or the literati, ego-driven, self-declared "geniuses" who parade as scientists but are laughable inept to discern between fact and theory...if you really want to get some insight you'll have to study the changing definitions, and you might want to read the candid admissions on the subject: even Lewonski admits not to objectivity, but to biased preference. That is his priority, and I respect his honesty, if rare. I'm won't give credence to either side here, just play advocate for the under-represented voice, but it is a riot to see a lot of nit-wits who find their own genius to be so very appealing when they know only a bit of simple math and how to tell something as silly and simple as a computer to roll-over and do tricks trying to discuss something like biology, which, you ought to know few "biologists" are really not quite qualified to practice since they seem to have little knowledge of genetics, cascades, or the many implications and intricacies: maybe it is tunnel-vision they get on a subject of study so that they do not cross disciplines: we tend to focus on our own interests rather than really getting to know the other fields: but don't dare mock statistics as blind as 600+ to one when most scientists can't say anything...they'd be blacklisted: I know colleagues in dissent of the theory and they are quite respectable, and their counterparts would say the same: unfortunately many scientists would set-out to ruin them, and this happens, but hey, everbody is religious in one way or another: some just have more zeal to spot witches.

    "Anonymous Coward"

    (P.S. I have to admit that I did not read every post: too many, but man, what I did see seemed so one-sided and self-sure that, well, it was laughable: a big problem in science is the dogmatism and do get twisted...one biologist said he'd prefer to go into an field with more honesty, "the used car business"; anyone inside often knows a lot of these things, and we do use weasel words and such to keep out of trouble, but I've decided to take a stand and keep all options open and let the debate continue: so please, don't let your own brilliance or opinions clog-up your minds so that you get to ridicule people who may well know something that you don't.) ...support cancer research, especially the recent developments concerning dichloroacetate: it's a simple and unpatentable drug which is cheap and has killed many squemous-epithelial cancers (most cancers are derived from epithelium), thoughbe warned, if you've read about it, that it's not completely safe as the news has portrayed, as far as we know, but it's highy interesting. For a quick summation: http://info.cancerresearchuk.org/news/behindthehea dlines/dca/

  370. on the origin of observations by N3wsByt3 · · Score: 1

    "Observations are trivial truths, and such truth only exists for the observing individual."

    I don't think this is actually true, as it would dispute the notion that there is any reality outside that which an individual observes. It's just that we can't say anything about it, unless it is observed (which is where the xians get it wrong)...but on itself, it's not dependend on the observation of an individual. 'Observing' is a dual concept: for it to do so, you need an observer and something to observe. Clearly, you are (half) right: if you don't have the observer, there can't be an observation. But, clearly there has to be a reality to be observed too, because if there was nothing to observe, no observation would be possible neither.

    Say, in its simplest form, I see a wall. When I try to go through it, I bump my head. Does that mean the truth of the existance of that wall only exist to me, as an indivual, who observed it? If so, it would be difficult to argue how that would be the case, if all other individuals (even blindfolded) would hit that wall (which is supposed to be only there by *my* observation of it).

    Since they are all (other) individuals, some of which can't even observe the wall untill they hit it, one would statistically expect that at least some didn't hit anything if the wall was only there through my personal observation.

    Unless ofcourse, one would claim the wall didn't start to be truelly there untill the moment I observed it, but it was a reality from that moment on. Such a reasoning is solipsistic in nature however, and leads to a lot of other contradictions.

    In any pragmatical sense, I think we all know there *is* a reality out there, which exist independend of the observer. The *form* in which it is observed may vary, the explanation/interpretation of the observation may vary, the question what is the best approximation of that observable truth may vary... but the fact that there IS a 'truth out there' ;-) can hardly be disputed (well, unless purely philosophically).

    --
    --- "To pee or not to pee, that is the question." ---
    1. Re:on the origin of observations by servognome · · Score: 1

      I don't think this is actually true, as it would dispute the notion that there is any reality outside that which an individual observes. It's just that we can't say anything about it, unless it is observed (which is where the xians get it wrong)...but on itself, it's not dependend on the observation of an individual. Observing' is a dual concept: for it to do so, you need an observer and something to observe. Clearly, you are (half) right: if you don't have the observer, there can't be an observation. But, clearly there has to be a reality to be observed too, because if there was nothing to observe, no observation would be possible neither.
      I believe there is a greater truth, however, the limitations we have in our ability to observe and understand the universe means that it is unknowable. There is always that possibility that we are just the dream of some superior being, which cannot be proven or disproven by any means we have.

      Say, in its simplest form, I see a wall. When I try to go through it, I bump my head. Does that mean the truth of the existance of that wall only exist to me, as an indivual, who observed it? If so, it would be difficult to argue how that would be the case, if all other individuals (even blindfolded) would hit that wall (which is supposed to be only there by *my* observation of it).
      What is hitting your head? An electromagnetic force that gets translated into electrical signals by your nerves and processed through your brain. What if the wall was an illusion and the force was caused by something else. It doesn't deny the "truth" that you observed yourself hitting a wall, but at the same time your observation doesn't make hitting the wall true (you hit something else).

      The *form* in which it is observed may vary, the explanation/interpretation of the observation may vary, the question what is the best approximation of that observable truth may vary... but the fact that there IS a 'truth out there' ;-) can hardly be disputed (well, unless purely philosophically).
      Truth exists only philosophically. :)
      --
      D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
    2. Re:on the origin of observations by N3wsByt3 · · Score: 1

      "What is hitting your head? An electromagnetic force that gets translated into electrical signals by your nerves and processed through your brain. What if the wall was an illusion and the force was caused by something else. It doesn't deny the "truth" that you observed yourself hitting a wall, but at the same time your observation doesn't make hitting the wall true (you hit something else)."

      Yes, but that doesn't really matter. for two reasons. First, the semantic one: you ask 'what if the if the wall was an illusion, and the force was caused by something else'. Well, I feel a force which comes from something else, and it has all the characteristics of a wall...does it matter if I call it a 'wall' which I bumped at, or 'something that looks exactly like a wall but is another force'? the truth remains the same: that you observed something which looks and feels like a wall. I could as well call that 'unknown force that looks like a wall'...wall. Or whatever. It wouldn't change the fact I oberved it.

      The second thing is, it doesn't matter in the context I used it; namely as an example of why a theory that says something only exists when an individual observes it, if there is no external reality to which it refers (be it a wall or a force, or whatever we call it). The wall (/force) doesn't exist only because I observe it as an indicidual, otherwise, other indivduals wouldn't experience that wall/force when I'm not observing it anymore.

      Meh. All this is getting too much into a philosophical debate, instead of a scientific debate.

      Anway, I think we both agree there is 'some' external reality which we observe, not that that external reality creates itself when an individual tries to observe it.

      --
      --- "To pee or not to pee, that is the question." ---
  371. Great insight there. by jotaeleemeese · · Score: 1

    The Holly Inquisition ideas resonated with Keppler and Galileo, that is why they researched and presented idease based in observed evidence.

    Er....

    Wait a minute ....

    --
    IANAL but write like a drunk one.
  372. falling hammers by N3wsByt3 · · Score: 1

    "To demonstrate the difference, I'll make a theory that all objects have a tendency to move towards their natural position in space, which in the hammers case happens to be Earth's center; the hammer falling fits this theory, but does it prove it ?"

    If your theory would have fitted every observation thusfar (and better then any other theory), you would actually have a claim that it is 'proven' (with the notion that no theory is ever *absolutely* proven, ofcourse, but that would be more of a semantic interpretation about what constitutes 'proof'. No (absolute) proof of *anything* can be given, not even Descartes' "I think, therefor I am". The concept 'proof', thus, must be viewed in a pragmatic sense, as most humans understand and use it. Much like legal terms, it would be more like 'proof beyond reasonable doubt' rather than absolute proof - which is a purely imaginary, philosophical concept).

    But, well, actually, it doesn't fit the theory, because, if you take that same hammer to the moon, it falls towards the center of the moon. If the natural tendency of a hammer is to move to its 'natural position in space', and Earth's center is that natural position for hammers (dixit yourself), the hammer should 'fall' away from the moon towards Earth.

    I believe an astronaut already did that actual thing (releasing a feather and a hammer), and since the hammer did not fall towards earth, your theory does not fit the observed reality. :-)

    --
    --- "To pee or not to pee, that is the question." ---
    1. Re:falling hammers by ultranova · · Score: 1

      I believe an astronaut already did that actual thing (releasing a feather and a hammer), and since the hammer did not fall towards earth, your theory does not fit the observed reality. :-)

      Since my point was that a theory fitting a single observation (or a thousand or a googleplex observations, for that matter) does not prove the theory correct, I'd say that you've just proven my point :).

      --

      Forget magic. Any technology distinguishable from divine power is insufficiently advanced.

    2. Re:falling hammers by N3wsbyte · · Score: 1

      hmmm...while I know you were just making that theory up to make a point, I'm having difficuties understanding how *I* would have made your point, by showing your theory false. "Since my point was that a theory fitting a single observation does not prove the theory correct," But your theory DID NOT fit even a single observation, so it DOES prove it was *incorrect*. While you imply that this means no theories are correct untill disproven, I think it's equally valid to claim all theories are correct untill disproven. Thus, rather than what you claim, one could say a theory fitting even a single observation proves the theory correct, untill the moment an observation shows it to be incorrect.

  373. UK's incredible diversity? by jotaeleemeese · · Score: 1

    10% are classiied as ethnic minorities.

    You get out of London or other major mixed areas and see nothing but natives.

    --
    IANAL but write like a drunk one.
  374. The role of religion in those countries is minimal by jotaeleemeese · · Score: 1

    And decreassing.

    Most people in Europe do not go to church at all (only 25% do in the UK) and according to a study done a couple of years ago, the more "atheist" countries in the world where South Korea, Japan and the UK (countries where curiously the bio sicences are porgressing quite fast).

    And so on.

    You really leave in a fantasy world if you think the UE and the US are very similar.

    They share some comon traits, but in most others the difference could not be starker.

    --
    IANAL but write like a drunk one.
  375. What he is saying.... by jotaeleemeese · · Score: 2

    .... is that religious people are ordered to conform with authority.

    And many do, as evidencied by the painful lack of accountability demanded by the religiou right in the US when they get their man in office.

    --
    IANAL but write like a drunk one.
  376. Uncertainity principle. by jotaeleemeese · · Score: 1

    Some randomness in the physics of the Univers ensures that not everything id pre-determined, not even when the Universe exploded.

    But still, your statemnt is mostly correct, life has no intrinsinc meaning and we have to make the best out of this turth instead of deluding ourselves with religious nonsense.

    --
    IANAL but write like a drunk one.
  377. Evolution is observable. by jotaeleemeese · · Score: 1

    Biological labs all around the world make a living out of it actually.

    And what about selective breeding?

    The history of the AIDS virus is well known and the reports of how th virus has evolved is well documented.

    Resistence to killer agents (insecticide, antibiotics) is a well known pehomenon, firmly rooted in evolution theory.

    --
    IANAL but write like a drunk one.
  378. adaptation by N3wsByt3 · · Score: 1

    "An animal does not adapt."

    This too, is subtly wrong. An animal can (in varying degrees) adapt to it's surroundings, but that adaptive behaviour on itself isn't hereditary (well, unless one is still a believer of Lamarckism ;-)

    "and the different ones either are already adapted or are not already adapted at the moment they're born"

    This too is subtly wrong. The term 'adapted' makes only sense if you're talking about an organism in relation to its environment. Since the environments in which an organism lives can change, it is not necessarily true that an organism is adapted or not the moment they are born.

    To give an example: say, a bird on an island gets born with a bigger beak. That beak makes it more difficult to catch flies, but easier to eat seeds. Now, is that bird (more) adapted, or not? The question can not be answered without knowing the environment in which it lives, but even then it is possible that, due to drought, for instance, the environment changes. So the bird may be born in an environment which makes it a disadvantage to have a big (or small) beak, but live (and prosper) in the changed environment where he lives his life.

    There is no such thing as a predetermined 'adapted or not', since adaptation has always to be seen in relation to the (changing) environment in which the organism will live.

    All by all, you made good points, though. It shows why ID is extremely unlikely, unless 'the creator' didn't know anything about what he was doing and his work isn't anything better then what a blind force like evolution would come at.

    --
    --- "To pee or not to pee, that is the question." ---
  379. Finally: Hard proof Americans are nucking futs by stylemessiah · · Score: 1

    Now you just have the cold hard truth.

    48% Are basically ignorant fundamentalist christian wankers who deserve all the hatred us non-ignorant right minded people have for you, and the problems your insane belief systems cause in the rest of the world.

    The world would be a better place isf the 48% were removed from existence. Ill then happily buy the remaining (semi)sane 52% a beer.

    Greetings from Australia, an ally that now grows to hate you ever more as you elect wankers into your government. Of course, you did let the current one steal the job, and the reason he got away with it was because of these knuckledragging creationists and all their money.
    Of course the same type of fundamentalist christian arseholes got a foot in the door of our government as well.

    I reckon we get them all in a tower, ive got a pilots license, and God knos (he's my God)they should be the ones who cop the end result of their hatred from the Eastern faiths, not us normal people, or as turn out to be when they go hate mongering, their "buffer".

    Death to 48% of America

    p.s. im a reformed catholic, i woke up to the fact its all about money, power and abusing small children.

  380. Laugh it up while you can, unbelievers by kalirion · · Score: 1

    We'll see who gets the last laugh once Xenu returns!

  381. The Prostate of God by N3wsByt3 · · Score: 1

    "The point the parent was so logically trying to make is that we cannot possibly know the purpose of omnipotent, omniscient God."

    The point of the parent poster was, that this doesn't matter. *Omnipotent* actually wants to say he is completely ALL powerful, he can do ANYTHING, he has an INFINITE number of possibilities to arive to whatever goal he wants to arrive.

    Therefor, whatever purpose God wanted to achieve, he could have achieved it by other means, without involving any suffering - unless the suffering was the endgoal itself, in which case the proclaimed 'love' he has for us is either false, or is a very sadistic, twisted kind of love.

    Now, one could argue that when god said 'love' he meant something like 'hate' or 'spite', but that's only semantic wordplay. If he really meant the reverse of what he said, being omnipotent, he should have known how humans interpreted those terms, and thus he could as wel have chosen the right terms. If he intentionally didn't use the right terms, he was already proving he wasn't all that benevolent and good in the sense that we think about being benevolent and good. And if He isn't benevolent and good, why would anyone want to believe in him, unless out of fear, perhaps?

    "Parents often cause "pain" on the part of their children to re-inforce a behavioral standard. This does not need to constitute spanking, because even a "time-out" can be considered very "painful" to a young child. However, you would not consider a parent who is trying to guide their child toward adulthood as not loving their child. Rather, the parent who never disciplines their child and never re-directs their immaturity is the one who hates their child because they do not want them to grow up to be well-adjusted adults who are mentally prepared to face the world."

    This is all a very interesting analogy, with one major difference: parents are no omnipotent beings. In fact, you actually make the case that God isn't either omnipotent, or isn't loving/caring. Say, using your example, parents are omnipotent and love their children. Being omnipotent, they can choose whatever they want to guide their child, including options where the child is guided, WITHOUT hurting it, or - to counter any further semantics about the term 'hurt' - where the child does not experience the guidence as hurtfull or painful.

    Now, if a parent had those oportunities, but STILL went for the option to guide his child in a way that it hurts the child, would you call those parents 'loving'? If the guidance can be arrived at with or without causing pain (which an omnipotent being would be able to), then obviously, a parent not wanting to cause pain to their child would with the latter option.

    "Who are you to tell God that His way is the wrong way or that He is not loving? Can we even be totally sure that we completely understand what love really is?"

    As said before, this doesn't matter. Whatever his goals or intentions or reasonings are, if he's omnipotent and omniscient he should know how WE feel about things, also in regard to what we consider love and pain. He still had the choice to not let us suffer in the sense that WE experience suffering. A god as you would have it, lacks anything what *we* would consider empathy, love, pain, suffering, etc. If he lacks those feelings - even in the presumed 'limited' manner as we experience them - he can't be omnipotent and omniscient.

    All this would also lead to another contradiction, since another important tenent in christian belief is that 'we were created in his image'. In that case, it is difficult to believe he has no understanding about what love/pain/suffering/caring means to us. That, or he doesn't care about it.

    Your mistake is trying to point out that we can't possibly know what an omnipotent being has in store for us, while the point rather is that it doesn't matter what he has in store for us (or what the endgoal is); as an *omnipotent* being, he could have chosen a way to reach that goal in a way we didn't need to suffer as

    --
    --- "To pee or not to pee, that is the question." ---
    1. Re:The Prostate of God by Khomar · · Score: 1

      Consider this: God created a world with pain and suffering with the full knowledge that He Himself would enter that world as a man, endure that same suffering we do and die one of the most painful deaths man would ever invent so that we would turn back to him. The universe was created to demonstrate God's glory. Pain and suffering were created so that He could demonstrate His love.

      --

      I believe in de-evolution. God made the world perfect, man fell, and its been going downhill ever since!

  382. Clarifications by jbeaupre · · Score: 1

    Something that may help your understanding of America: it's rather heterogeneous. The 48% result is a perfect example. Taking what one group says or does and extrapolating to the entire population just doesn't work well. That goes for education, beliefs, fears, diet, etc. With that in mind, I'd like to address your points (and often make the same dumb generalizations). Your biblical quotes really are taken literally by some, but they are ignoring the context and metaphor just as you are. Same mistake, different conclusions. I agree Americans are a fearful lot. Sad, really. Humans biologically cannot assess risk very well (tons of studies on that). Americans have avoided real tragedy for so long, we have developed an allergic reaction to dangers that are trivial. On the other hand, we aren't scared to fail. From our lack of social programs (healthcare, etc) to the wars we get burned by, we take risks seen as insane by others. So I'll accept irrational, but not always cowards. Generally, Islam has not concerned itself with evolution until very recently for unrelated reasons. A comparison there is rather silly. Frequent disbelief of scientists is real, and also rather silly. However, there are several instances that disbelief is even worse in Europe. Take GM foods for example. Or labor economics. Our murder rate is unforgivable. However, extrapolating the actions of a few to call us all monsters is rather poor logic. We are a diverse bunch, and that includes having wide distribution with a statistical tail with too many violent, amoral people. It also includes a large number of overly moralistic people on the other end (who seem to overlap the anti-evolutionary crowd). It sucks. But we prefer it to making everyone act and think the same way. There are two parts to war: smashing and holding. Smashing we can do. We can level countries very easily. Holding, we have a bit more trouble. Ironically, it's because we place limits on the smashing. Any civilian loss of life is unacceptable. But historically, one you'd smashed your way into a territory, they rule was you devastate (or threaten to devastate) the population. Kill a soldier and an entire village would be killed. Now that's against policy. So the result is a guerrilla war. Eventually America will get tired and go home and everyone knows it. If winning were the only thing that matters, as you seem to think, America could do it. If we are too cowardly, it's being to cowardly to level cities (thank goodness). Oh, we do a pretty good job of messing up the neighborhood while we are there, but nothing of the systematic of scale of wars historically. I worry about anti-intellectualism (notice I at least spelled it correctly). Drives me crazy. But we don't have a monopoly. But your faux-intellectualism isn't much better. And finally, there is a lot in common between America and Iran. If it weren't for historical screw-ups, I believe we could actually be quite friendly. As it is, we are genuine enemies of each other (for silly reasons, but enemies none the less). Unlike your obsession with imagining America as your enemy.

    --
    The world is made by those who show up for the job.
    1. Re:Clarifications by Mark_MF-WN · · Score: 1

      Your biblical quotes really are taken literally by some, but they are ignoring the context and metaphor just as you are.

      That's exactly the problem with the bible. If you don't take it literally, then it becomes meaningless, and you can simply ascribe ANY set of morals and ethics to christianity. There are enough contradictions and disparities in the bible to support both sides of almost any issue. And if people are just using their own ideas about what morality to determine how they interpret the bible, why bother with the bible at all? People in our society now accept homosexuals, so we focus on the "love thy neighbour" stuff and not on the stuff about stoning women who lie with each other. Many people are uncomfortable with pornography, so everyone ignores the fact that an entire chapter of sex stories was deemed important enough to put into the bible. The bible even says that to add or remove from the bible is an unforgivable sin; yet how many "Children's Bibles" include the violent massacres of Numbers or sexuality of The Song of Solomon?

      The reverse is even worse of course. If you want to know what happens to someone who actually reads the bible and takes every single word to heart, just look at the Westboro Baptist Church. Other Christians hate those people even more than homosexuals do, because deep down they know that they can't argue with them. Those psychos know the bible backwards and forwards. They know every word, and they believe it all. Their behaviour is the direct result of that.

      There is no way around it -- Christianity itself is fundamentally stupid. It's either meaningless and little more than a weak way to justify one's beliefs, or it's a source of hatred, bigotry, and violence.

      On the other hand, we aren't scared to fail.

      This poor risk analysis by Americans at the heart of why Americans are so destructive and horrible. The rest of us look at the world, identify real threats, and try to resolve them. The flu is one of the biggest killers in any society. So we give seniors and children free flu shots. Car accidents are right up there, so we pass seatbelt laws and have strict driver's license requirements (which will actually become meaningful once all the seniors who got their licenses back in the 50s finally die). And the thing is, once we've done that, we don't need to worry. We're actually safe, or relatively so.

      Americans identify minor risks that can't be prevented. Then they waste their time and money trying to prevent them. Naturally they fail, and remain afraid. Then they need to stock their house with guns, form militias, vote for a Republican police-state, go to war, etc, all because they need some way to address their imaginary threats. I mean, that's half the problem right there. The rest of the problem is that the government (particularly Republican governments) go to extraordinary lengths to increase those fears. "Threat Level"? "We don't know what the terrorists are doin', but they're doin' something!" It's called fearmongering, and most nations would try to recall any government official that engaged in it. Americans just assume that their leaders are telling the truth ... which is so stupid that it staggers the imagination. I mean, they're politicians -- anyone who trusts a politician is doomed.

      Take GM foods for example. Or labor economics.

      Typical American misconceptions. Europeans don't want GM foods banned, they want them LABELLED. So that they can make free, informed choices. They want to KNOW what they are buying, rather than simply getting mysterious chunks of edible material that could healthy, or could be a mixture of mercury-laden corn protien and mad-cow bone-grindings. Only an American could be so psychotically evil and stupid as to think that knowing what you are buying is a bad thing.

      As for labour economi

    2. Re:Clarifications by jbeaupre · · Score: 1

      Seems you have a lot of pre-conceptions based on a mix of truth and misinformation. It's those same traits you seem to be most upset about with America. Pretty funny actually. You'd fit in quite well here.

      --
      The world is made by those who show up for the job.
    3. Re:Clarifications by Mark_MF-WN · · Score: 1

      Not really. I don't have a gun or an SUV, I like being able to buy Cuban goods, I don't hold intellectuals in contempt, I don't watch reality television, I hate religion, I have difficulty pretending that certain portions of history didn't happen, and I refuse to vote for a Fascist political party just to ensure that some other Fascist political party doesn't win. Conversely, I like having socialized healthcare, I like not having to support a bunch murderers (AKA: the troops), I like having a low mercury content in the air and water, I like having history books that don't mysteriously omit the Vietnam war or the Bay of Pigs, and I like having a relatively low chance of being murdered. I wouldn't fit in very well at all in America at all.

    4. Re:Clarifications by jbeaupre · · Score: 1

      Yup, you'd do just fine. You sound just like about a dozen friends and family members of mine. They are generally very successful (I'm not not talking money, but some have that too) and rather happy. I enjoy arguing with them, and with my right wing friends and family. Same with you. You'd be surprised to know I agree with half of what you say. But the stereotyping and references to Americans being monsters I can't justify.

      I keep trying to tell you, we've got an extremely diverse population. The result is that we have every bad behavior you can imagine, but we also have every good one. It's normal to focus on the bad, but it's not correct.

      Thanks for the lively conversation though.

      --
      The world is made by those who show up for the job.
  383. Oh crap by Zaharazod · · Score: 1

    ...this was posted before 4/1, wasn't it..

  384. Statistics.. Lies and Damned Lies by Anonymous Coward · · Score: 0

    They polled 1,004 people.. You can't base your opion of some 300 millon people on a polling of 0.00033 percent of those people.. Those with bad opinions of USA, visit some other part of it.. The big cities are usually full of jerks, so don't expect much in the way of grace or humility there. There's a lot more to this country than New York and California..

  385. Why Stop There? by Hoi+Polloi · · Score: 1

    I just wish these people would also reject the science behind internal combustion so they'd stay the off the road when I'm driving.

    Fellow true believers, there are no cars in the Bible, stop using the tools of the devil!

    --
    It is by the juice of the coffee bean that thoughts acquire speed, the teeth acquire stains. The stains become a warning
  386. As an atheist raised as a catholic .... by jotaeleemeese · · Score: 1

    ... I have to object to such moronic, uninformed and insiduous statement.

    The catholic church is far more complex than what you think you know about it. In many countries around the world it is the only organization that brings some hope and help to the poorest of the poorest, the most ardent Catholics normally have very little to give to the Church, so your idiotic portrayal can be debunked with ease.

    Having said that many people in the hierarchy make the best out of it for personal gain, but when I compare the unashamed money making activities of other "churches" (for lack of better name) in the US, the Catholic church is quite a decent institution in comparision, the people making money out of it at least pretend to be pious, all the preachers of markeeting one sees in the US in the other hand, oh dear me.

    --
    IANAL but write like a drunk one.
    1. Re:As an atheist raised as a catholic .... by hobo+sapiens · · Score: 1

      In many countries around the world it is the only organization that brings some hope and help to the poorest of the poorest, the most ardent Catholics normally have very little to give to the Church, so your idiotic portrayal can be debunked with ease.


      Not saying they don't do some good. The problem is that they make a bunch of rice Christians who have no real founding in their faith. Get a history lesson and read up on Rwanda, and find out how that was a Catholic country. Read how priests and nuns participated in the slaughter. They do good, but the good is outweighed by the bad.

      In the US, who is leading the trend of child molestation? And when a priest is accused of these crimes, they have been moved to another parish. Yes, they have a shortage of priests, so they need to keep what they have. If they obeyed the scriptures and allowed priests to marry then perhaps they would have more priests and they could lop off the ones who are abject perverts. A decent institution indeed. They are just as crooked as the protestants.

      You call my argument idiotic, but yours is blind to the facts.

      --
      blah blah blah
  387. That is a vulgar lie. by jotaeleemeese · · Score: 1

    YOu don't have to pay for any of the services offered by the Catholic church.

    If you do, then you are in the presence of a corrupt priest who should be reported to his superiors.

    If you want to speak your mind do so informed. Tha catholic church, like any human institution, hast its share of good and bad people, but institutionally speaking it is not geared towards collecting money, as so many US religious institutions seem to be (perhaps because it is based nowadays mostly in poor countries, where people have little or nothing to give).

      Speaking your mind based in misinformation and misunderstading is the worst kind of abuse of such freedom.

    --
    IANAL but write like a drunk one.
    1. Re:That is a vulgar lie. by hobo+sapiens · · Score: 1

      Tha catholic church, like any human institution

      You said it. They should stop masquerading as a religious institution. They give God and the Bible a bad name.

      I have personally talked to several people, including my father, who is a funeral director, who have confirmed my story. My father has been a funeral director for 25 years, and he tells me that when a minister, protestant or catholic shows up, all they care about is who is going to pay. They won't do a thing without a check.

      I talked to another couple who wanted a marriage annulled, and the priest wanted an exorbitant amount of money to perform the service. I mean, what is that? The Bible says marriage is forever, so annullment should not be an option. But if you pay enough, guess what?

      When you start hearing anecdote after anecdote it starts to become empirical.

      If there is one who is misinformed, it's you.
      --
      blah blah blah
    2. Re:That is a vulgar lie. by Dirk+Pitt · · Score: 1

      Hobo, I've read most of your comments on this thread and am intrigued enough to comment.

      I'll preface this by saying I was raised Catholic, but am no longer a religious person. Not for any reason specific to Catholicism or any other organized religion, but my beliefs have just drifted elsewhere.

      I was educated in Catholic schools for 13 years, and I never witnessed abuse and none - so far - has been uncovered in the schools I attended or my former parish.

      Our family has had numerous encounters with church leaders in births, deaths, marriages, and divorces. Never have we been charged what would be considered and exorbidant fee by a priest or other church official. Yes, fees are charged as parishes must survive - and in modest communities churches *barely* make enough to survive.

      Indulgences were banned by the Council of Trent some time ago. People do not pay to lessen their time in purgatory. I've never heard of someone paying for reconciliation, nor communinion. Marriages and funerals are usually indulgent affairs, and a small fee is expected. If you can't afford it (and you're not having an extravagent wedding), you won't pay. Take a look at the enrollment of an average Catholic highschool sometime - you might be shocked at the number of students that pay no ($0) tuition.

      It's interesting that you say, and what bothers me most, in one post that the church should 'listen to scripture', and allow priests to marry, and this would somehow alleviate the child abuse problem. But in another post you say they're a business and they do whatever makes them popular and makes people give them money. Let's face it - these are contradictory statements if ever there were any. The church is famous for sticking to its guns, no matter the marketing woes it might endure. The church has been bleeding members for years, particularly in America. Imagine if it allowed priests to marry and women to be ordained, condoms to be used, and it rejected the idea of original sin - these four things would probably lead to millions of returned worshipers and billions in revenue - so why don't they?

      They don't because the church maintains its dogma regardless of the popular desire of the masses. Again, I do not believe what Catholics believe, but I do greatly admire the organization for its steadfast refusal to submit just for popularity's sake.

      The church's work in Africa is unmatched, from what I've seen (firsthand). In Central and South America, and Eastern Europe, it is beacon of hope in lives of millions that live in misery.

      That being said, there certainly is abuse, corruption, and foul play in the church. As is there in *any* large organization, and every culture. That does not mean that the organization itself is evil or invalid - it simply suffers from common human weakness. If you tend to think that in all large organizations the evil outweighs the good, you sir are a pessimist. I'll keep to my optimism, and keep it based on my experience with hundreds of good women and men who work for the church.

    3. Re:That is a vulgar lie. by hobo+sapiens · · Score: 1

      "It's interesting that you say, and what bothers me most, in one post that the church should 'listen to scripture', and allow priests to marry, and this would somehow alleviate the child abuse problem. But in another post you say they're a business and they do whatever makes them popular and makes people give them money. Let's face it - these are contradictory statements if ever there were any"

      I didn't say that they *should* be run like a business. I said that because according to my perception that's what they are. The two statements do not contradict. If they followed scripture, they wouldn't be a business and priests could marry.

      --
      blah blah blah
    4. Re:That is a vulgar lie. by hobo+sapiens · · Score: 1

      Oh, I forgot to add...in response to your last three paragraphs...

      If the Church were a secular organization, I'd applaud them for their work. Please note that the basis of my criticism is the fact that they claim to represent the Bible, which, if you cannot tell, I respect. When an organization claims to be a religious organization, they will be and should be held to a higher standard.

      Anyhow, thanks for the nice reply. Like I said, I am not trying to offend anyone. I nowhere used hate speech, or implied that catholics are bad people, I am just pointing out what I believe to facts based on what I have seen, heard, and read. I was raised Catholic as well, and I never witnessed abuse by priests. Yet, it happens, even if in just a very small percentage of cases. That is a problem, yes, but the real problem has been the church's response.

      --
      blah blah blah
  388. Invest money in "Young Earth" theories then... by Dr.+Manhattan · · Score: 1

    There actually is quite a bit of evidence for a young earth.

    Well, actually, no there isn't. On the other hand, here's a bit of evidence to consider for conventional geology:

    Take oil companies. Finding oil is a very important and high-stakes issue for them. Literally hundreds of billions of dollars are riding on it. When the chips are down and they need to find the most likely spots to drill - what kind of geology do they use? Flood geology, or mainstream? Which one actually delivers the goods?

    Let's assume the Earth is only a few thousand years old. Where did the oil come from? Was it created in the ground with the rest of the Earth? If so, is there a way to predict where it might be found? Or perhaps it really did form from dinosaurs, but about 10,000 times faster than any chemist believes it could? Either way you look at it, a young Earth would imply some very interesting scientific questions to ask, some interesting (and potentially extremely valuable) research programs to start. How come nobody's actually pursuing such research programs?

    If "Young Earth" geology actually fits the facts better, how about some of the believers pool their money and invest in looking for oil or valuable minerals? They don't have to do all the development and extraction themselves, they can settle for a percentage of the gross. It'd still be a wonderful investment. How about you start such a venture?

    --
    PHEM - party like it's 1997-2003!
  389. 48% .... by Sproggit · · Score: 1

    Would that be the same 48% that voted for Bush?

  390. A Push Question that Pushed back by Anonymous Coward · · Score: 0

    This is a typical question used by pollsters to get the answer they want. But Americans are getting wise so they choose to carefully and logically interpet the question, based on their beliefs. (They were asked the question. So the pollster is asking for their opinion.) " Is evolution well-supported by evidence {AND} widely accepted within the scientific community?" To answer yes you would have to agree that both statements are true. Without qualifications you would also have to believe that all versions of evolution theory are well supported. Only a little research will show that except for micro-evolution( which in the common sense might not be considered evolution at all) all the evolution theorys have large holes and contrary evidence.
    Theorys that are "well supported" are waiting to be disproved. A good theory doesn't depend on "wide acceptance" or even a body of evidence, but on lack of contrary evidence. A theory can fit 99.9% of the facts but still it can be 100% wrong. Only one contrary example is required to dispose of a bad theory in good science. Not true of bad/junk science where the theory takes on a flavor of politics, and those who disagree are "idiots".

    1. Re:A Push Question that Pushed back by singingjim1 · · Score: 1

      Well, if one disagrees that evolution is a much more likely, and in turn harder to disprove, theory, as opposed to creationism, then by all rights one WOULD BE an idiot! There is a lot of solid science out there that points in the direction of evolution as the most likely explanation for the origin of species. The amount of faith that I have to have in comprehending the gist of what evolutionists are trying to prove is almost nil. A lot of it is just common sense applied to an observable phenomenon. Compare that to the hate and fear-mongering religious wackos who are just trying to protect their source of income by keeping the wool pulled over their flock's (sheep) eyes. Is it any wonder that atheist intellectuals who view the world through thought and reason scoff at the religious addicts and their superstitions? Go sell your snake oil somewhere else Sister Christian. Just because some of us are too smart and level headed to buy your elixir doesn't mean we don't have the cajones to stand up and fight for what we don't believe in.

  391. Re:Alarming? Consider this... by misanthrope101 · · Score: 1
    The main problem I see here is that your points are taken straight from creationist and ID literature and web-pages. These sources are great for building up and tearing down a caricature of evolution, but not so good for understanding actual evolutionary theory.

    Fred Hoyle of the British Academy of Science and mathematician Chandra Wickramasinghe decided to calculate the probability of life coming into existence anywhere in the universe. Their results? Utterly impossible.

    Evolutionary theory does not address how life itself came about. Abiogenesis is a distinctly different field. But even so, life exists--we know that already. It's a bit odd to posit that something that has already happened is impossible. We may not know the agency (Hoyle was a fan of panspermia, for example) but that life exists indicates that life can come into existence.

    ...also attempted to calculate the probability that life sprang into existence spontaneously. His results? Utter impossible.

    Again, life exists, so I'd temper the "utter impossible" assessments. Considering that we, along with the men whose assessments you're trumpeting, don't know exactly how life came about, I'd take their calculations with an ounce of salt. You might be overestimating how impossible something is when it's actually just improbable. Shuffle one deck of cards, and the probability of coming out with any particular arrangement is one over a 68-digit number. Two decks of cards? One over a 166-digit number. It is trivially easy to do things at your dining-room table that are mind-staggeringly improbable. That's the problem with trying to assess the probability of something that already happened--it may have been improbable, but now it's a fait accompli, so it no longer makes sense to say it's impossible.

    Stephen J. Gould, one of the greatest defenders of evolution, was also troubled by issues that he saw within evolution. As a result, he came up with the theory of punctuated equilibrium. He postulated that there were sudden leaps in evolution that left no transitional forms.

    This is false, and is a deliberate mischaracterization by creationists of what Gould wrote. I'm sorry you were duped by this, but you might want to do an internet search for creationism and quote-mining. Here is a good link where you can read what Gould actually thought about those transitional fossils that you've been told he thought didn't exist. Again, I'm sorry you were lied to. It's hard enough to have a conversation about this complex of a subject without some creationist authors basically lying about what some scientist did or didn't say.

    Take for example the eye.

    I'd love to, primarily because it's one of the most frequently explained examples of how complex structures can evolve piece by piece. Wikipedia has a good article on the subject, and if you search around there are others. I've read good explanations by Dawkins, and others. Even PBS has a decent article. Basically any light-sensetive cell would give an organism an advantage over his competitors, and over time any further advantages would accrue as they develop. You are underestimating the power of accumulated changes.

    Another stake in the heart of evolution is the absence of transitional forms.

    There are many articles covering transitional fossils. They are real, we have thousands of them, and they can be easily viewe

  392. Abiogensis. Not impossible, just highly unlikey... by burnttoy · · Score: 1

    Given the totality of time and space surely such an event as the combination of millions of proteins becomes statistically probable e.g. above 0 (although not much) unless there is some process that would actually prevent this from happening (like magnets repelling each other). Just like monkeys and typewriters... which, incidentally, doesn't seem to work with real monkeys http://www.wired.com/culture/lifestyle/news/2003/0 5/58790

    --
    Time flies like an arrow. Fruit flies like a banana.
  393. Flu shots by Viking+Coder · · Score: 1

    If there was justice in the world, doctors would refuse to give flu shots to people who don't believe in evolution. They'd let those who don't believe in evolution suffer the awful consequences of their ignorance.

    (Note: this is comedy, not my actual opinion.)

    Honestly, though, I detest the lack of gratitude. That people will simultaneously reap the benefits of scientific thought and attack science and scientists.

    --
    Education is the silver bullet.
  394. evolution of hive-insects? Any biologist present? by N3wsByt3 · · Score: 1

    "A mutation for an improved organ is also present in cells for other organs."

    Yes, but that's because the DNA for that improved organ has its origin in the spermcel or eggcell (well, the mutation of their DNA, that is), comming from a parent organism. In the case of hive-insects, where the egg of the mutated-and-better-adapted worker-ant comes out, there is no way that infertile worker could be the parent to transmit his mutation throughout any other offspring. Thus, there is no parent - which is different with the analogy of the organs you gave. The right analogy would be, that a sudden mutation hits the organ (say, the heart) itself, and it starts working better (and thus, is beneficial).

    But then the same problem arises; it's not possible for the mutation of the heart-organ, beneficial as it might be for the whole organism, to pass the mutation to any offspring, because it's *only a mutation happening in sperm and eggcells* which can provide the mechanism of transmitting a mutuation to any offspring. The mutation of the heart doesn't suddenly transfer, nor does it infuse itself into the DNA of the spermcell.

    So, the main problem remains. To give a clear example of what I mean; let's say the ancestors of those ants were more simple, less specialised. At a certain moment, in the DNA of a queen-egg, there occurs a mutation; this mutuation turns out to be beneficial - say, the worker-ant develops an enzym which is far more efficient in providing digestable nutrients from raw food, for instance. Now, that ant lives its life, then dies...since workers are unfertile, they don't mate with the queen, and they don't pass on their beneficial mutation.

    So how the heck did those specialised ants come to be, and how do they (the next generation) keep existing in the next hive(s)?

    --
    --- "To pee or not to pee, that is the question." ---
  395. What "Troll" means by Z1NG · · Score: 1

    Troll -- A Troll is similar to Flamebait, but slightly more refined. This is a prank comment intended to provoke indignant (or just confused) responses. A Troll might mix up vital facts or otherwise distort reality, to make other readers react with helpful "corrections." Trolling is the online equivalent of intentionally dialing wrong numbers just to waste other people's time.
    The parent post clearly didn't fit these requirements. Sure, the parent's opinions and beliefs may be different from many here at /., but that doesn't mean you should moderate it as "troll" or "flaimbait".
  396. Re:evolution of hive-insects? Any biologist presen by DavidApi · · Score: 1

    Well, I guess we have to go from first principles. There are two scenarios here:

    1/ One of the eggs that a Queen lays contains a mutation that provides some benefit. The egg hatches, and the resultant worker - or soldier or whatever, scurries away being more efficient or capable at doing something. It would need to be highly beneficial because it needs to have the direct affect of keeping the Queen alive. However, a single individual (in a hive) has little overall effect on an entire hive. Unless it did something like produce a digested bit of food that, when fed to the Queen, made her lay more eggs per volume of food intake, or something. Eventually, this worker dies, and the hive is back to where it was.

    2/ The mutation occurs in an egg that is destined to be a Queen. Now here is the trick. The mutation gives cause for the new Queen to on-lay eggs of her own, and these eggs develop into a new type of individual. It's a subtle thing you see. The mutation may be such that every 3rd egg develops into a soldier (rather than all eggs developing into workers). A soldier may simply be a worker with a bigger set of mandibles. This then leads the hive to be successful - and perhaps more successful than neighbouring hives without the mutation.

    The Queen then lays an egg that develops into a new Queen, and so the mutation will be passed onto subsequent hives.

    In summary, the mutation (in such a situation), has to occur in an egg that develops into a Queen. The Queen's offspring are the ones that will determine the success of the mutation. The Queen is therefore simply a delivery device.

    Of course, there may be mutations that give the Queen added benefits, such as egg laying ability, or whatever.

  397. this finding explains... by DriveDog · · Score: 0, Flamebait

    why the current administration almost won two elections.

  398. Re:Great web site raising questions about evolutio by Alsee · · Score: 1

    They have already decided that Christians aren't smart and could not possibly have a competing idea or the ability to debate evolution in a credible way

    Wow are you out of touch with reality.

    The majority of Christians *are* smart, reasonable, generally rational people. And the majority of Christians in the world are on the evolution side. And (at least in the western world) the overwhelming majority of "evolutionists" are Christians.

    So you are making this bizarre delusional statement that the MAJORITY of Christians in the world (evolutionists) "have already decided that Christians aren't smart".

    Who the hell do you think these "Christian hating evolutionists" are? Almost all of them ARE Christians!

    There is public controversy over evolution. There is political controversy over evolution. But there is no genuine scientific controversy over evolution. According to Newsweek magazine figures there are approximately 480,000 degreed earth and life scientists in the US on the evolution side, and approximately 700 against. 99.85% or so. For all practical purposed EVERYONE who has bothered to study the subject and get a degree is absolutely convinced by the overwheling absolutely conclusive evidence. And that includes extremely bright dedicated deeply religious devout Christian students who went into the field to tear down this "evolution nonsense"... virtually 100% of them who actually study the subject are convinced. Optics is the mechanism that produces rainbows, nuclear fusion is the mechanism for the sun to produce light for the earth, evolution is the mechanism that produces the diversity of life on earth, a rotating moving earth orbiting the sun is the mechanism for dividing the light from the dark (day from night) and the seasons on earth, and NONE of those mechanisms in any way denies or conflicts with God. Gos does not cease to exist because optics explains the mechanism of rainbows. God does not cease to exist because the earth moves. Yet there are and were people with the hubris to tell God how He is and is not permitted to run His Creation. People who had the hubris to tell God He was forbidden to have chosen the earth orbiting the sun as His mechanism for the solar system. The very same kind of people today the hubris to tell God He is forbidden to have chosen evolution as His mechanism for the diversity of life. The majority of Christians on earth accept God and evolution.

    The US is pretty much the only developed country where that percentage dips much below 50%. The only developed country ranking below the US is accepting evolution is Turkey... and Turkey isn't even a Christian country. All of the major developed Christian countries have higher acceptance of evolution than the US. It really *IS* the majority of Christians on earth who have obtained a at least a minimally adaquate biology education to understand and accept evolution. There is no genuine scientific challenge or doubt over evolution. It's just that far far too many US highschools provide a pathetic-to-nonexistant education in biology to avoid the hassle of some damn ignorant Yahoo throwing a hissyfit disruption over evolution education.

    The average member of the general public does not need to understand or even believe element theory in chemistry to get by in general life, and the average member of the general public does not need to understand or even believe evolution theory in biology to get by in general life, but any minimally educated highschool graduate damn well better know the FACT that elements are considered the very foundation of the entire field of chemistry and for all work by all professionals in the field of chemistry and that those professionals EFFECTIVELY UNANIMOUSLY consider it to be supported by overwhelming irrefutable evidence, and any minimally educated highschool graduate damn well better know the FACT that evolution is considered the very foundation of the entire field of biology and for all work by all professionals in the field of biology and that those prof

    --
    - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
  399. Belief!=Fact by Foofoobar · · Score: 1

    A fact is in fact just that: What the majority of people believe as truth.
    Belief is not fact. I can convince everyone on this planet that they can fly and then march them off the edge of a 20 story tall cliff but the FACT is they will all plummet to their deaths... at least until the bodies pile up high enough to walk down. Regardless, still not flying.
    --
    This is my sig. There are many like it but this one is mine.
    1. Re:Belief!=Fact by Opportunist · · Score: 1

      If they believe you and test your theory, they will soon find out that it is not true.

      Facts, in a scientific view, are by their very definition never really proven. You can't prove that man cannot fly. Maybe we can and just didn't figure out yet how, but that's no proof that we can't. You can prove easily that we can't fly by flapping our arms, just try it. Is there another way that would require us to stick our nose into our rear? Dunno.

      So what we accept as facts today might just be as wrong as the 'fact' that the sun revolves around the earth. It's true until proven false.

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    2. Re:Belief!=Fact by Foofoobar · · Score: 1

      If they believe you and test your theory, they will soon find out that it is not true.
      And so you prove my point. Belief is not fact. However you then go to turn around your point to say that facts change and hence change your argument to say that 'the big picture has a big piture beyond even that'. For instance, Newtonian physics was correct but Quantum physics proved it wrong. Newtonian physics is still applicable so within context, it is factual. In a quantum sense, it would be less factual.

      So try to stay on target with your argument. Belief is an opinion minus physical or applicable evidence such as love or god. Fact is reproducable and often observable. Regardless of your new argument (that facts change outside of context) which still holds mine true, belief still does not equal facts.
      --
      This is my sig. There are many like it but this one is mine.