Slashdot Mirror


User: MortimerK

MortimerK's activity in the archive.

Stories
0
Comments
41
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 41

  1. more links on Resources For The OpenSSL/SSLeay API? · · Score: 1
  2. Re:Better use of funds on United Nations Brings You ... A Telescope · · Score: 1
    ***META-RANT***
    I'm so sick of textbook responses like yours to the mind-numbingly obvious point brought up by the original poster.
    In this case I feel it is a little different to the usual space-exploration-vs-third-world-help because this is the U.N. we're talking about. In this case, *surely* they have better things to spend their money on (disclaimer: I have not read enough to know where the U.N. SETI funds are coming from, flame away).
    A few dignitaries read some Carl Sagan and now they're suddenly ready to set up some pricey 'scopes and start watching "My Favorite Earthling". Bah, it's late, I don't care

  3. roles on Sir Alec Guinness Dies · · Score: 1
    Apart from Obi-wan, he also played:
    • Hitler
    • Dr. Zhivago
    • Fagin
    • Julius Caesar
    • A Pope
    • Sigmund Freud
    • King Charles I
    • Marcus Aurelius
    • Spanky, the mechanical dancing horse
  4. Re:SERIOUS Flame bait on Slashback: Retroaction, Breakeven, Kansas · · Score: 1
    It is impossible to prove that God does not exist

    Big deal. It's also impossible to prove that a -1 dimensional bunny rabbit named Carl doesn't exist either. Word on the street is that he helps god out with some administrative duties every now and then.

    Uh-oh, this doesn't have anything to do with that Sufficiently Reasonable Principle thing, does it? Damn, made a fool of myself :(

  5. CommentBack on Slashback: Retroaction, Breakeven, Kansas · · Score: 5

    I think that Stephen King should have voted for the set-top PowerMac to stay on the island, despite its theological heresay.

  6. Re:Island? on Australia To Consider Licensing Streamed Content · · Score: 1
    I though Australia was a continent. When did it get downgraded to an island?

    It's both.

    World's largest island.

    World's smallest continent.

  7. "640k" nitpick [OT] on Two Scoops Of Wearable Computers · · Score: 2
    The Man never said it. It's (most probably) an urban legend: http://www.urbanlegends.com/celebrities/bill.gates /gates_memory.html

    Of course, he could just be covering his ass, but have you ever seen an actual source of the quote?

  8. Re:Icon nitpick on NetBSD Support From Wasabi Systems, Inc. · · Score: 2

    The one-icon(and topic)-per-story system is quite flawed. Just look at the GNOME & KDE integration rumour the other day - since having both the GNOME and KDE icons wasn't possible, it had the X Window System icon. ??

  9. There may also be Martian mud! on Evidence Of Water On Mars · · Score: 1

    Martians may have submarines but if the water isn't too deep they may only have galoshes which is good for us because then they won't be able to sneak up on us without making a slosh-slosh sound and we will go "A-ha!" and shoot them with a high-powered particle beam gun which I am designing for NASA only to be denied further funding after 30 years of my life have been put into it, oh the futility, perhaps I could become an astroswimmer and dart through the Martian river system like a trout, Martian trout.

  10. It's been done. on Linux BIOS · · Score: 2

    Slashdot already has a rather large Linux BIAS.

  11. Re:Air Force Story on When Background Checks Go Wrong... · · Score: 1
    ...I have tried twice to see my adoption records...
    ...have been trying to get my hands on for 20 years.

    Lazy bastard ;-)

  12. Intergalactic? on 'Robonaut' Designed To Perform Spacewalk · · Score: 1

    IANASWG but I'd say Boba Fett was more "interstellar".
    But then, I'm just a picky git who's probably wrong. As this is slashdot, I'm sure I will be corrected by the time I depress the Submit button.

  13. Sidebar tabs on Latest Eazel Screenshots · · Score: 1
    ewww...what's up with those tabs at the bottom of the sidebar? Are they for the sidebar itself? Shouldn't they be "connected" by the top of the tab rather than the bottom? I've grown very used to looking for relevant options at the top of the control I'm focussed on, not the bottom. Guess I can always turn my monitor upside-down, invert my peepers, mod the source myself, or - by golly - stop whinging and get used to it!

    If this is answered on the site, just mod me down to (-1, Australian) - I'm your regular "ask questions first, read site later" sorta guy.

  14. Re:Slashdot Paradox on Too Old To Code? · · Score: 1
    Now, keep in mind the obvious results of this poll

    Don't keep them in mind, just look at them.

  15. Re:Wolfenstein on Hasbro And Game-Design Lawsuits · · Score: 5

    The people that made Wolfenstein 3D must be jumping for joy.

    Yeah! They could sue the makers of Doom, and then the makers of Quake and make a fortune!
    Boy, I wouldn't like to be in those rip-off merchants shoes right now!

  16. Here it is on Celera Maps Entire Fruit Fly Genome · · Score: 5

    -----BEGIN FRUITFLY-----
    GATCGATCGATGCTAGCTACGATCTGATCGATCGATCGTAGCTAGCTA
    ATCGTAGCTAGCTGACTATCGTAGCTAGCTAGCGTATCGTAGCGATCG
    GCATCGTAGCTAGCTAGCTACGTAGCTAGCTAGCGATCGTACGATCGA
    CGTAGCATCGTAGCTAGCTACGTACGATCGATCGATCGTAGCTAGCTA
    GACTAGCTAGCTAGCTAGCTAGCTACGTAGCGCGATCGATTCGATCGC
    AGCTTGACTGATCGGATCGTGCTACGGACTGTACGATCGTACGATCGC
    ------END FRUITFLY------