I think it would still be more convenient to simply plug the laptop into the wall, a car outlet, or even a solar array for a recharge. If you're in the absolute middle of nowhere, you could carry an extra battery or two and it probably wouldn't be much more volume/weight than a pack of methanol containers. On top of that, hotel rooms, conference rooms, coffee shops and other places I use my laptop don't have methanol dispensers, but almost all of them have plenty of free electricity.
Besides, 8 hours is not that huge of an improvement over batteries. Fuel cells seem to have promise, but I won't be switching until I can run a laptop for days at a time.
...now have essentially Stalinist control over ALL of Disney's creative...
Uhhh - Lasseter and Catmull are in charge of the animation studio. They have creative control over any animated movies produced by Disney and they have an influence on theme parks that use the movies as the basis for attractions.
Disney, however, is a LOT more than just the animation studio. They do live action, television, sports, etc... Lasseter and Catmull do not control ABC, ESPN, live action films, or any of the many other creative entities owned by Disney.
I have a friend who takes the plastic lenses out of jewelers loupes and puts them into old Nikon lens mounts just to get that Holga camera effect on his high end Nikon DSLR. It's called being creative, and you can be just as creative with digial as you can with film.
I doubt a rogue state would use missiles. Why spend a few billion on a fancy missile system when you can drive the nuke over the border, fly it over in a cargo jet, or float it over in a shipping container?
Besides, missiles are very visible and give away the country of origin. If North Korea fires a nuclear tipped missile, we'll know exactly where it took off and respond accordingly. If it comes over quietly, we really won't know exactly who sent it.
A year passes, and then there's a purge. I don't think there will be any Pixar people left at Disney after 1 year, and Jobs will leave in 18 months: substantially richer, but disgusted.
You have a point, but Disney has already gone through a huge purge - most notably the sacking of Eisner. I think there's a bit of a power vacuum. Jobs personality seems large enough to fill that vacuum, and the Pixar crew seems to have enough talent and experience to back it up with profitable films. Seems like a good formula, but only time will tell.
in Disney's acquisiton of Pixar, John Lasseter is the more significant...
Don't forget Ed Catmull, who will be President of the Disney animation studio. Catmull has a PhD in computer science and is one of the founding fathers of computer graphics. In other words - he's one of us.
No... Brad is an accomplished 2D director (Iron Giant, for one) and an amazing artist. Give him a crew of 2D Disney animators, add Lasseter's support and he'll make a film that makes drawn animation hip once again.
I hear he's been wanting to turn Wil Eisner's "Spirit" into a feature for years. I think that would be an amazing film.
I guess the one true complaint, at least in Disney's case, is that they've seemed to be so busy milking old franchises that they haven't bothered to create any new ones. But I really don't see any reason why those two have to be linked.
I think they are linked, simply because putting resources into crap like that cheapens the whole studio as well as the franchise. The Disney name should stand for quality.
I'm not saying sequels are bad. Aardman does a terific job with the Wallace and Gromit franchise. The difference there is that Nick Park is still in charge, and his love for the characters shines through. Every single short (and the feature) is a quality product - and 15 years after the first one was made, Wallace and Gromit are still doing great.
Along similar lines, if there ever is a Toy Story 3 it should be directed by Lasseter. I think that was actually one of the points Jobs made at the press conference - that sequels should be directed by the people who made the original.
John Lasseter and Ed Catmull truly understand how to make good, original films -- and with Jobs riding shotgun upstairs as the biggest shareholder, they can actually get things done. This decision is proof that they are firmly in control. I think Lasseter, Catmull, and the terrific artists over in Burnbank are going to create some great films - and I'm sure some of them will be 2D as well (Brad Bird - here's your chance)
There's some great quotes from Disney artists about the managements change over at Cartoon Brew ( http://www.cartoonbrew.com/ ) Here's one from Floyd Norman (story artist who started at Disney in the 50's and has worked at many other places as well)
Not too many guys can say they've worked for both Walt Disney and John Lasseter, so I can offer a unique perspective.
Different cultures at Disney and Pixar? Naw, it's the same culture. Eisner's managers simply choked all the creative life out of Disney. The Disney culture is finally returning to Disney. Ed Catmull, Steve Jobs and John Lasseter will be returning it shortly. This is good news for all of us who love animation, and the Disney legacy in particular.
If George Bush hired him, he can do whatever he damn well pleases with the reports. But as long as my tax dollars are in there, this guy is welcome to speak the truth.
The problem is that George Bush seems to have the notion that the government exists solely for his benefit, but not the people's. This is why people in the government are being silenced when they speak about things that upset George Bush and/or his friends.
I know very little about the specifics of DNA sequencing, but everything I've read says that the genes that make individual humans different are less than 1% of the total.
So... you don't sequence the known quantity and just sequence the 1% that is different.
"The scientific genius who grew up in grinding poverty is an exceedingly rare bird," he said. "If it seems there was a great flowering of scientific genius out of Eastern Europe beginning in the late nineteenth century, it was due in large part to a developing middle class, a stable family life, and secular opportunities for both men and women."
So, less povery will produce more geniuses. I think that's a really good argument for creating a stronger social safety net.
The words "Intel Dual Core" tell me it's probably a Pentium D of some sort. But, is it just a commercial chip or are the chips made specially for Apple with additional doodads? How fast is it?
Seriously... a huge number of this nation's problems have arisen from it's need for Middle East oil. Biodiesel cuts the Middle East out of the equation and gives that business to US farmers and agriculture.
Biodiesel also is much better for the environment because it recycles carbon already in the atmosphere rather than releasing new carbon buried inside the earth.
First of all, Maya is a vector graphics program (not raster)! Second of all, vector graphics can do textures, and in fact is (IMHO) better suited to a "paper cutout" style of animation than raster is.
Last time I looked, Comedy Central does not broadcast in "vector."
You're going to have to rasterize someplace in the pipeline (hopefully before you get it into the Avid)
When a character turns around in the show, the animators have keyframed the characters poses, so they have all their characters in 3D which can be place in any position, any perspective, etc within their scenes.
You know absolutely nothing about how South Park is set up. It is done in a 3D package, but the characters are by no means "3D" in the traditional sense -- they are simply flat parts assembled in 3D space, much like the Oxberry camera stand used for the original shorts.
Characters are built "flat" using NURBS curves and surfaced using the "make planar" function, which trims a plane to the outline of the curve. The characters are simply an assemblage flat bits of geometry - the digital equivalent of a cutout bit of paper. These flat bits are textured using scans of actual construction paper.
Animation is done using set driven keys on the visibility tracks of these parts. These keys are tied to the action of a software slider. Running the head turn slider, for example, would turn off visibility on the "right" head and turn it on for the "front" head (I'm simplifying here, but you get the point)
The original decision in 1997 to go with Alias Power Animator 7 was because of the ability to render accurate textures and shadows, as well as the ability to tie sliders to visibility. Back then the sliders were driven by expressions, but Maya allowed the switch to set driven keys, which are more eficient. Flash really wasn't an option back then but 2D software such as After Effects actually were considered - AE could do the textures, but shadows were difficult as were sliders. Thus the decision to go with a 3D package to essentially do a 2D show.
(If you haven't figured it out - I used to work there)
Slashdot Mirror
For a government that is deep in the pocket of credit card companies, the bankruptcy bill was the first step....
Intimidating people who pay off their debt early is the next step.
After that... jail time?
I think it would still be more convenient to simply plug the laptop into the wall, a car outlet, or even a solar array for a recharge. If you're in the absolute middle of nowhere, you could carry an extra battery or two and it probably wouldn't be much more volume/weight than a pack of methanol containers. On top of that, hotel rooms, conference rooms, coffee shops and other places I use my laptop don't have methanol dispensers, but almost all of them have plenty of free electricity.
Besides, 8 hours is not that huge of an improvement over batteries. Fuel cells seem to have promise, but I won't be switching until I can run a laptop for days at a time.
...now have essentially Stalinist control over ALL of Disney's creative...
Uhhh - Lasseter and Catmull are in charge of the animation studio. They have creative control over any animated movies produced by Disney and they have an influence on theme parks that use the movies as the basis for attractions.
Disney, however, is a LOT more than just the animation studio. They do live action, television, sports, etc... Lasseter and Catmull do not control ABC, ESPN, live action films, or any of the many other creative entities owned by Disney.
Hardly Stalinist.
My dad worked for the company and we had a teletype in the den. Learned GECOS and MULTICS and learned how to program in Basic.
My first job was programing the Altair 8800 to handle inventory control.
(yes, I'm an old-timer)
Tilt shift lenses for digital SLR: http://www.lensbabies.com/
e x.shtml
Pinhole lenses : http://www.camerahacker.com/EOS_Pin-Hole_Lens/ind
I have a friend who takes the plastic lenses out of jewelers loupes and puts them into old Nikon lens mounts just to get that Holga camera effect on his high end Nikon DSLR. It's called being creative, and you can be just as creative with digial as you can with film.
I doubt a rogue state would use missiles. Why spend a few billion on a fancy missile system when you can drive the nuke over the border, fly it over in a cargo jet, or float it over in a shipping container?
Besides, missiles are very visible and give away the country of origin. If North Korea fires a nuclear tipped missile, we'll know exactly where it took off and respond accordingly. If it comes over quietly, we really won't know exactly who sent it.
A year passes, and then there's a purge. I don't think there will be any Pixar people left at Disney after 1 year, and Jobs will leave in 18 months: substantially richer, but disgusted.
You have a point, but Disney has already gone through a huge purge - most notably the sacking of Eisner. I think there's a bit of a power vacuum. Jobs personality seems large enough to fill that vacuum, and the Pixar crew seems to have enough talent and experience to back it up with profitable films. Seems like a good formula, but only time will tell.
I wonder if Disney will go from a three fingered to a one fingered mouse.
in Disney's acquisiton of Pixar, John Lasseter is the more significant...
Don't forget Ed Catmull, who will be President of the Disney animation studio. Catmull has a PhD in computer science and is one of the founding fathers of computer graphics. In other words - he's one of us.
The geeks have taken over.
No... Brad is an accomplished 2D director (Iron Giant, for one) and an amazing artist. Give him a crew of 2D Disney animators, add Lasseter's support and he'll make a film that makes drawn animation hip once again.
I hear he's been wanting to turn Wil Eisner's "Spirit" into a feature for years. I think that would be an amazing film.
Very similar to how Apple 'bought' Next... and AOL 'bought' Time Warner.
The next few years should be very interesting.
I guess the one true complaint, at least in Disney's case, is that they've seemed to be so busy milking old franchises that they haven't bothered to create any new ones. But I really don't see any reason why those two have to be linked.
I think they are linked, simply because putting resources into crap like that cheapens the whole studio as well as the franchise. The Disney name should stand for quality.
I'm not saying sequels are bad. Aardman does a terific job with the Wallace and Gromit franchise. The difference there is that Nick Park is still in charge, and his love for the characters shines through. Every single short (and the feature) is a quality product - and 15 years after the first one was made, Wallace and Gromit are still doing great.
Along similar lines, if there ever is a Toy Story 3 it should be directed by Lasseter. I think that was actually one of the points Jobs made at the press conference - that sequels should be directed by the people who made the original.
Well - Disney animation, at least.
John Lasseter and Ed Catmull truly understand how to make good, original films -- and with Jobs riding shotgun upstairs as the biggest shareholder, they can actually get things done. This decision is proof that they are firmly in control. I think Lasseter, Catmull, and the terrific artists over in Burnbank are going to create some great films - and I'm sure some of them will be 2D as well (Brad Bird - here's your chance)
There's some great quotes from Disney artists about the managements change over at Cartoon Brew ( http://www.cartoonbrew.com/ ) Here's one from Floyd Norman (story artist who started at Disney in the 50's and has worked at many other places as well)
Not too many guys can say they've worked for both Walt Disney and John Lasseter, so I can offer a unique perspective.
Different cultures at Disney and Pixar? Naw, it's the same culture. Eisner's managers simply choked all the creative life out of Disney. The Disney culture is finally returning to Disney. Ed Catmull, Steve Jobs and John Lasseter will be returning it shortly. This is good news for all of us who love animation, and the Disney legacy in particular.
Maybe you should ask Valerie Plame.
If George Bush hired him, he can do whatever he damn well pleases with the reports. But as long as my tax dollars are in there, this guy is welcome to speak the truth.
The problem is that George Bush seems to have the notion that the government exists solely for his benefit, but not the people's. This is why people in the government are being silenced when they speak about things that upset George Bush and/or his friends.
I know very little about the specifics of DNA sequencing, but everything I've read says that the genes that make individual humans different are less than 1% of the total.
So... you don't sequence the known quantity and just sequence the 1% that is different.
From the article:
"The scientific genius who grew up in grinding poverty is an exceedingly rare bird," he said. "If it seems there was a great flowering of scientific genius out of Eastern Europe beginning in the late nineteenth century, it was due in large part to a developing middle class, a stable family life, and secular opportunities for both men and women."
So, less povery will produce more geniuses. I think that's a really good argument for creating a stronger social safety net.
With digital cameras, however, no matter how much work the amateur is willing to do, he cannot make a 3 megapixel camera take 10 megapixel pictures.
Following that logic - then you really should have ditched that film Minolta for a Hasselblad.
I won't give away the ending, but my favorite part is:
ctattggacttggaatcggatattggacacttggaatcggata
The words "Intel Dual Core" tell me it's probably a Pentium D of some sort. But, is it just a commercial chip or are the chips made specially for Apple with additional doodads? How fast is it?
Seriously... a huge number of this nation's problems have arisen from it's need for Middle East oil. Biodiesel cuts the Middle East out of the equation and gives that business to US farmers and agriculture.
Biodiesel also is much better for the environment because it recycles carbon already in the atmosphere rather than releasing new carbon buried inside the earth.
First of all, Maya is a vector graphics program (not raster)! Second of all, vector graphics can do textures, and in fact is (IMHO) better suited to a "paper cutout" style of animation than raster is.
Last time I looked, Comedy Central does not broadcast in "vector."
You're going to have to rasterize someplace in the pipeline (hopefully before you get it into the Avid)
Wow, have you actually ever used Maya? Or any digital video software?
Actually, I just wrote a book on Maya (which isn't video software, btw...) and I own several seats of it.
When a character turns around in the show, the animators have keyframed the characters poses, so they have all their characters in 3D which can be place in any position, any perspective, etc within their scenes.
You know absolutely nothing about how South Park is set up. It is done in a 3D package, but the characters are by no means "3D" in the traditional sense -- they are simply flat parts assembled in 3D space, much like the Oxberry camera stand used for the original shorts.
Characters are built "flat" using NURBS curves and surfaced using the "make planar" function, which trims a plane to the outline of the curve. The characters are simply an assemblage flat bits of geometry - the digital equivalent of a cutout bit of paper. These flat bits are textured using scans of actual construction paper.
Animation is done using set driven keys on the visibility tracks of these parts. These keys are tied to the action of a software slider. Running the head turn slider, for example, would turn off visibility on the "right" head and turn it on for the "front" head (I'm simplifying here, but you get the point)
The original decision in 1997 to go with Alias Power Animator 7 was because of the ability to render accurate textures and shadows, as well as the ability to tie sliders to visibility. Back then the sliders were driven by expressions, but Maya allowed the switch to set driven keys, which are more eficient. Flash really wasn't an option back then but 2D software such as After Effects actually were considered - AE could do the textures, but shadows were difficult as were sliders. Thus the decision to go with a 3D package to essentially do a 2D show.
(If you haven't figured it out - I used to work there)
The characters are still drawn and animated in pencil.
Film Roman here in LA does design/boards/layout, while several studios in Korea do the actual animation as well as the digital ink/paint.