Slashdot Mirror


User: larley

larley's activity in the archive.

Stories
0
Comments
28
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 28

  1. Re:Refreshing... on Learning Perl, 4th Ed. · · Score: 2, Insightful

    Amazon has quite a good return policy which lasts a few weeks, I think. You can probably send it back without much of a problem, giving the reason that a new edition just came out -- Unless it's already in bad, dog-earred condition... Which wouldn't surprise me, given the usefulness of the book. :D

  2. Two words: on Games Are Supposed To Be Fun, Right? · · Score: 2, Interesting

    Katamari Damacy. That game requires so little instruction (which is given anyways when you start a new game). It's almost as simple as Tetris to learn, and has comparable degrees of complexity depending on how seriously you take it. It's just brilliant...

  3. Re:Finally! on Resurrection Ecology Gives Life to Old Eggs · · Score: 1

    Yes, but just because we don't have an answer doesn't mean it's not possible. It took thousands of years before someone could come up with a proper theory of evolution that held any water.

    One thing we have definitely learned from gaining more knowledge about the world is that as you learn more you realise how little you truly know. Maybe, in time, they will come up with further theories as to how this could be possible. For now, it doesn't mean evolutionists are wrong when they admit they don't know.

  4. Re:Finally! on Resurrection Ecology Gives Life to Old Eggs · · Score: 1, Insightful

    Just keep telling yourself how bright you are for not seeing the obvious (the existence of a Creator) and keep denigrating those who you disagree with. Chances are, your boorish personality will prevent you from mating, and the rest of us will just have fewer dumbass secular humanists to deal with.

    Now, it's people like this with whom we have to contend. I agree with stating your opinions on the matter in an open forum, but this is just as ignorant as the ignorance he sees in evolutionists.

    Sure, there is interesting evidence for creationism, and I'm not denying that. Half of the time, there is misuse of common knowledge (i.e: everything goes toward chaos, so how can something so orderly come about without intelligent design), sometimes the people spout pure nonsense, and once in a while you get to hear a truly educated, clear piece of evidence for creationism. I just can't make the leap of faith required to accept that theory.

    There will never really BE an answer, as much as people may bicker. What we should do instead is think more about how we can use this knowledge to benefit us, as these arguments will never get anywhere.

    To get an interesting perspective on the matter, though, I definitely recommend reading "The Blind Watchmaker", by Richard Dawkins. It offers some great insight on the matter.

  5. Re:Finally! on Resurrection Ecology Gives Life to Old Eggs · · Score: 5, Insightful

    Not exactly. There have been experiments which, for all intents and purposes, have been solid arguments for evolution. The evidence at this point is overwhelmingly present. However, many do not accept it despite the evidence.

    I mean, this will still not prove it for most creationists, since it will only show what can happen under closed, controlled conditions. It's never realistic enough to change the lives of the people to whom absolute, totally undeniable proof of evolution would be a faith-shattering experience.

    There will always be room for another Scopes Monkey Trial, even today. There are still creationist education groups. It's not like the evidence will be easily accepted by them, either. It will take more than just some simulated ecosystems.

  6. Re:Why not on Forbes Predicts 5% Desktop Share for Apple in 2005 · · Score: 2, Informative

    No. OS X is closed-source but it has an open-source BSD kernel. It is a unix-based OS but it has much more to it than Linux, which is only the kernel -- In a way, you could think of it as a BSD distribution, but there's a lot more to it than that.

  7. Re:LZIP on Best Format for Archive Distribution? · · Score: 1

    Sure, if you WANT lossy compression. I doubt he'd really want that when he's distributing software... RTFP next time.

  8. Re:OS X on In Which OS Do You Feel More Productive? · · Score: 1

    Scroll lock isn't that useful (except in spreadsheets, when you don't want up/down/left/right keypresses to change cells, but just to scroll around the sheet), but I happen to use print screen all the time! I mean, it copies a screenshot to the clipboard... As a student, I take all of my notes on my laptop, in LaTeX. If I need to embed a diagram from some PDF notes, I need to do a quick screenshot, paste into the Gimp, resize and insert. It's a lot easier to just hit "print screen" when the desired diagram is there and just deal with it on the spot.

  9. I love the fact... on ID Required to Purchase Games · · Score: 0, Offtopic

    that when I clicked on this article, a large DOOM 3 advertisement popped up. :D

  10. bn.com can't spell on Holub on Patterns · · Score: 1

    Holub on Patters: Learning design Patterns by Looking at Code Surprised nobody has mentioned this...

  11. Re:Spoiler alert on Human Gene Count Slashed · · Score: 2, Insightful
    Out of curiosity, where did you get this sequence from? I can see that it involved a few copy/pastes of
    atacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac
    but did you pull it from somewhere, or was it just made up? I know it's not in the Arabidopsis genome (http://www.arabidopsis.org/Blast/)
  12. Re:This demonstrates how little we actually ... on Human Gene Count Slashed · · Score: 1

    But we also don't know how many enhancers/repressors that don't have readily apparent effects were removed as well.

    Enhancers/repressors can affect gene transcription even from a distance. Sure, you've got promoters, TATA boxes, UAS's and the like which strongly affect transcription, but the long-distance promoters have a significant effect on it as well.

    I think further phenotypic analysis of the mice would be in order before completely denouncing everything they deleted as "junk". Obviously a lot of it is due to selection pressures and evasion of mutation, but some of it might not be.

  13. Re:People vs. Flowers on Human Gene Count Slashed · · Score: 5, Informative

    The thing is, we've had the arabidopsis genome sequenced for a while now. And because the organism has a lower degree of complexity it is a lot easier to study in many ways. I don't know if I'd necessarily say that there is more study being done on humans than on Arabidopsis - In fact, I highly doubt it.

    We have a much clearer idea of most of the inner workings of that lowly little mustard plant than of our own. It's a matter of understanding the simple stuff and then working our way up. Like with the nematode C. elegans -- we know more information about that than you could possibly imagine. We know how many cells it has at every stage of its life and what they are doing. We have its genome sequenced. And from all of this information we have learned a lot about the inner workings of our cells as well. You find a lot of homologies between organisms.

    In fact, if you examine the RNA polymerases of humans, bacteria and archaea you would find that ours are much closer to archaea (the most ancient of ancient organisms still around) than to bacteria.

    So looking at these organisms that have been around since the beginning of life, we can learn about the development of our genomes and by examining their functions we can learn much about how ours work. Even if we do have our entire genome sequenced, that doesn't mean we know what it all does.

  14. Re:Fewer genes = more complexity among them? on Human Gene Count Slashed · · Score: 1

    Well, only ~30% of the human genome encodes transcription units, and of that ~30%, only ~1.6% encodes proteins. The rest is intronic (it gets spliced out before proteins are synthesized from it). The rest is just spacer and repetitious DNA (transposable elements, pseudogenes, simple-sequence DNA, etc)

  15. Re:The Scariest Part of the Article... on Human Gene Count Slashed · · Score: 5, Interesting

    Well, technically, you CAN buy genes. There are quite a few companies that sell pre-sequenced genes. In fact, the entire genomes of several organisms are available in varying amounts ligated into Bacterial Artificial Chromosomes (BACs) and plasmids. An interesting link is http://www.arabidopsis.org/ - There's a lot of information on Arabidopsis, where they keep a database of the entire Arabidopsis genome as well as many freely-available tools for its analysis.

  16. Re:It's been done on Making a GUI for OpenGL Games? · · Score: 1

    Yeah, for WINDOWS. Who said he's not making a Galactic Civilizations clone for Linux?

  17. Stick with GTK on Making a GUI for OpenGL Games? · · Score: 0, Offtopic

    I mean, it's kinda old, and really in need of a re-vamp, but it's still a classic. If you're willing to put up with the way it seems to work around all of its inadequacies.

  18. Wow... on Nuclear Batteries · · Score: 5, Funny

    Imagine going to the store to buy some new Plutonium-Cadmium batteries?

  19. Re:Mozilla... on Fyracle: Oracle-Mode Firebird · · Score: 1

    Yes I KNOW it's a different firebird. It's humour, people...

  20. Mozilla... on Fyracle: Oracle-Mode Firebird · · Score: 4, Funny

    Is there anything they can't do?

  21. Re:YeeHaw on Software for the Grass Roots · · Score: -1, Offtopic

    No such luck, my friend. Your holy grail shall forever be unattained. You have tasted glory, but it has already grown sour and stale.

  22. Grass roots, eh? on Software for the Grass Roots · · Score: 4, Insightful

    Hmmm... I had to convince a friend that free software is a plausible notion, as he simply argued that "If people aren't paying for it, what incentive is there?" But then again, if you're working on free software, then you have some sort of desire... While if you're working underpaid in a cubicle, you wind up having a lot less drive than someone doing it purely for pleasure. I respect those who work on free software immensely...

  23. Re:BSOD? on Hackers, Public Differ Greatly On E-voting · · Score: 0
    I'm not sure what they use for the election systems, but I know for sure that their ATM machinese use the Agilis Software, and I quote this from their site:
    "Agilis® is an open software platform -- which means it's based on technology that's widely known and used -- instead of the proprietary technologies of the past. Agilis takes advantage of leading, industry-standard technology like XFS service providers, TCP/IP, INvolve® middleware, and more -- and runs in the ubiquitous Windows® operating system."
    NOW I'm worried...
  24. BSOD? on Hackers, Public Differ Greatly On E-voting · · Score: 1, Insightful

    I wonder, though, whether the situation would arise where an e-voting machine crashes? I mean, so many people trust BANK machines, and yet I've encountered several situations where I insert my card, nothing happens, it spits the card out, and I see OS/2 rebooting... I just hope the same doesn't occur in the polling booths. It might scare the old Floridians to see an OS booting up - these ARE the same people who couldn't figure out where to punch a card with 4 or 5 big circles on it.

  25. Uh oh... on Gaim Forks To Get Voice And Video Support · · Score: 3, Funny

    I just realized. Seeing as the true geeks use open source and all, that'll just give us one less reason to go out and be social... As soon as they develop a usb-automated back scratcher and/or fridge/microwave, I'm not leaving the house!