Slashdot Mirror

Go read this website. Dvorak really isn't that great compared to other layouts. If you're going to learn a new layout, pick one that performs better. Dvorak was a good idea, but it was designed in the days before computers and modern statistical analysis.

There are a few such sites, but http://mkweb.bcgsc.ca/carpalx/ is probably the most amazing of em.

I'll second the Colemak recommendation. Its a lot more balanced between the L/R hands and doesn't make your right pinky reach upward or downward for letters (the Qwerty 'P' becomes semicolon, and the slash stays put) so most of the time all your right pinky has to worry about is 'O' on the home row. Going by the analysis at the CarpalX site (which evaluates many different layouts), Colemak gives you about 13% more efficiency overall than Dvorak gives over Qwerty.

Colemak is also the second most popular alternative and seems to be closing in on Dvorak. Apple and most Linux distros are including it as standard. Over at Geekhack (keyboard enthusiast site) there are noticeably more Colemak users than Dvorak users.

I've been doing it for a large number of seconds - HDTR

Not really, you just don't have to move your wrists nearly as much as around 70% of your typing (compared to about 30% on Qwerty) is done by simply pushing one of your fingers straight down. Check out http://mkweb.bcgsc.ca/carpalx/?colemak for some interesting statistics comparing Qwerty, Dvorak and Colemak.

Not true at all. The real important metric is typing effort. Sure you can go for a speed record with QWERTY, but it's going to cause serious injury to your wrists long-term. Read up on the research done by the Carpalx project. Long story short, not all key locations are created equal. Choice of finger matters. Row positioning matters. Rolls matter. Same-finger bigrams matter. Hand alternation matters, albeit not as much as Dvorak thought it did.

Proof http://mkweb.bcgsc.ca/carpalx/?dvorak

(...)
There are even more ergonomic layouts than Dvorak, as you'll find if you study that 2nd website I linked. They find a full optimisation to be a kind of XBUL layout. Colemak is another very ergonomic layout. And they even test what the worst layout for English could be.
(...)
It's silly to get emotional over a keyboard layout. But it's interesting to think about optimisation.

I agree with the last bit. However, I've been wondering about one thing for a long time. These optimized layouts seem to be designed for a specific language. What happens when you regularly type multiple languages: Finnish, English, Perl, Swedish? If the keyboard layout has been heavily optimized for a single language, others will suffer. I imagine typing Finnish on an English Dvorak keyboard would be nightmarish.

By swapping 5 pairs of keys on QWERTY produces the QWKRFY layout which beats Dvorak's effort reduction (12% lower).

I like this idea. It's certainly easier to learn 5 key switches, rather than a whole new keybaord. See -here - http://mkweb.bcgsc.ca/carpalx/?qwkr

"As of 2005, writer Barbara Blackburn was the fastest English language typist in the world, according to The Guinness Book of World Records." She would only use a Dvorak.

It's interesting to note that places on the internet put a QWERTY keyboardist, Stella Pajunas-Garnand, at 216wpm, but I can't find out how this was recorded, who witnessed, and what parameters were taken into account (eg: accuracy, word base, over what period of time, etc.)

From my own dealings with The Guinness Book of World Records (on a completely different topic) I know they're very careful about having representatives witness the event and recording the conditions.

I only have one non-biased study to show you.

But that's not what convinced me that Dvorak is faster and less error prone. What convinced me is because I have studied both layouts for myself and know that the fingers have to physically move a much smaller distance with Dvorak. I know that there are less awkward digraphs, etc. I know that the bottom row takes the longest to type from and that's one thing Dvorak avoids.

Even if you disagree with the study above, or you find no sufficient studies exist, find out for yourself. Look up how and why different layouts were/are made. By the way, QWERTY was designed to stop typing jams (by keeping hammers apart), Dvorak was designed specifically with ergonomics in mind.

There are even more ergonomic layouts than Dvorak, as you'll find if you study that 2nd website I linked. They find a full optimisation to be a kind of XBUL layout. Colemak is another very ergonomic layout. And they even test what the worst layout for English could be.

Anyway, if you're really interested, find out for yourself. If not, keep using QWERTY. I still do. It's silly to get emotional over a keyboard layout. But it's interesting to think about optimisation.

"As of 2005, writer Barbara Blackburn was the fastest English language typist in the world, according to The Guinness Book of World Records." She would only use a Dvorak.

It's interesting to note that places on the internet put a QWERTY keyboardist, Stella Pajunas-Garnand, at 216wpm, but I can't find out how this was recorded, who witnessed, and what parameters were taken into account (eg: accuracy, word base, over what period of time, etc.)

From my own dealings with The Guinness Book of World Records (on a completely different topic) I know they're very careful about having representatives witness the event and recording the conditions.

I only have one non-biased study to show you.

But that's not what convinced me that Dvorak is faster and less error prone. What convinced me is because I have studied both layouts for myself and know that the fingers have to physically move a much smaller distance with Dvorak. I know that there are less awkward digraphs, etc. I know that the bottom row takes the longest to type from and that's one thing Dvorak avoids.

Even if you disagree with the study above, or you find no sufficient studies exist, find out for yourself. Look up how and why different layouts were/are made. By the way, QWERTY was designed to stop typing jams (by keeping hammers apart), Dvorak was designed specifically with ergonomics in mind.

There are even more ergonomic layouts than Dvorak, as you'll find if you study that 2nd website I linked. They find a full optimisation to be a kind of XBUL layout. Colemak is another very ergonomic layout. And they even test what the worst layout for English could be.

Anyway, if you're really interested, find out for yourself. If not, keep using QWERTY. I still do. It's silly to get emotional over a keyboard layout. But it's interesting to think about optimisation.

Both Dvorak and qwerty were hand-designed layouts for typewriters. Since computers are much better at optimizing over permutations of a large number of objects than humans, anyone considering learning a non-standard layout should strongly consider one of the modern computer-optimized layouts.

If you have a qwerty background and care at least a little about standardization, colemak is a modern layout that includes ease of transition from qwerty in its design. I've been using colemak for about a year, and can touch type in both qwerty and colemak. The transition was very fast and painless for me, especially for conversational English. If you go in with reasonable expectations, you'll probably be surprised how quickly your mind can adapt.
http://colemak.com/

If you don't care about standardization at all, you can download software to tune a layout for the sort of typing you do here:
http://mkweb.bcgsc.ca/carpalx/

CS grads are a dime a dozen in the job market; I like my job, but career-wise, the field's been played out. If you're about to go into college, and especially if you like to reverse-engineer stuff "because it's fun", get into bioinformatics, computational biology, and do your CS as a minor. At least, that's what I'd do if I were gonna start over.

Or you could just get a whole degree in bioinformatics.

Download the SARS genetic sequence here.

[...]
GTACAGTGAATAATGCTAGGGAGAGCTGCCTATATGGAAGA GCCCTAATG
TGTAAAATTAATTTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTT CT
TAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAA

This --------- ^^^
is where god ran out of ideas

(Stupid damn lameness filter! It's not yelling, its a DNA for chists sake!)

Download the SARS genetic sequence here.