Slashdot Mirror
Celera Maps Entire Fruit Fly Genome
cjoh345 wrote: "Celera Genomics has just sequenced all the genes in the fruit fly. Apparently the scientists involved are amazed at the genes that we share with this dorm-room annoyance. This discovery also validates Celera's "shotgun approach" to mapping out this stuff. And yes, the genome is available free of charge via
Genbank. Good form, Celera!" What would Mendel have thought of this? How about Watson and Crick? This makes me want to break out my copy of The Double Helix .
Yeah, so they released the Fruitfly source code. Just what we need--soon the OSS community will stomp all the remaining bugs in the bug, and we'll have a stable, reliable, and high performance pest.
On the other hand, I'll bet you a thousand dollars that they never release the source to a really valuable product, like Christy Turlington. Greedy corporate bastards.
Lars
__
Reality or nothing.
I've spent the better part of the last year massaging the drosophila genome with perl scripts. I am intimately familiar with it, and I can tell you that it is NOT complete. While it is 90% sequenced, it is still in a bazillion tiny pieces. This makes it difficult to get complete sequence for many genes, as they may start in one contiguous piece and end in another. From personal experience, I would guess that about 15% of the genes are split like this.
And even if it were complete, this still wouldn't tell us where all the genes are. Its very difficult to string coding regions together into a complete gene, when there may be large introns that confuse the matter. The state of the art still only identifies about 70% of genes correctly, even given complete sequence.
And even if we did know all the genes, we still wouldn't know how they interact. We can make guesses based on previous experimets, but the majority of the genes in a given genome are experimentally uncharacterized. Current attempts at molecular simulations can't even predict how these proteins will fold, let alone with what other proteins they interact, or what they do.
There is still a lot of work to be done - getting the genomic sequence is only the beginning. A significant start, but only the first step. Could you reverse engineer the entire linux kernel if you were only given the binary? Probably not. I assure you that deducing the operation of an organsim given the raw DNA code is much more difficult. The complete sequence of the E.coli (an intestinal bacteria) has been available for a couple of years, and we haven't even begun to understand it. E.coli is single celled, and the genome is only 4.5Mb (thats megabases). Drosophila is very complicated, and the genome is about 120Mb. Don't look for anyone to 'solve the fly' any time soon.
Its a great time to be in bioinformatics - tons and tons of data that noone understands. If we did understand it all, I'd be out of a job. I'm not worried.
ted
human genome (more than 200trillion base pairs)
A bit over 3,000 million, actually.
To compare, the government-funded Human Genome Project has so far spent over 10 years on the same job.
There's been a lot of mapping done, that Celera is actually using at one remove, because they're picking up our data for their assembly. Celera's job would have been a lot harder if our work hadn't been available to them.
Celera is doing a 4x oversampling on the human genome, unlike the HGP, which does 10x oversampling. This is possible because Celera is sequencing DNA from one single individual (most likely Craig Venter?), thus avoiding the uncertainty of wheter differences are due to sequencing artifacts or personal variations.
The extra depth is more to do with accuracy. Incidentally, does anyone know when Celera ditched their aim to collect lots of variation data? That was going to be their great contribution to human knowledge, and their main selling point. When did they change their minds?
Plus, Celera is using our (PE Biosystems) 3700 DNA Analyzer (fully automated, unattended operation 24 hours per day), whereas the Human Genome Project mostly use our older 377 DNA Sequencer, which requires manual reloading of samples after each run (every 2-3 hours).
As I've pointed out, here at the Sanger we've got more than 100 3700s : other institutions have gone for MegaBace machines instead.
I guess the next logical step would be to mass produce giant mutant fruit flies the size of cows and then harvest them for food?
From their press release....they have a map, they don't have the sequence yet. A map is a guide with landmarks as to where major chunks of sequence fall within the genome. Celera has pioneered the approach of shotgun cloning. They randomly capture chunks of the genome and sequence them. If they do this enough times (10-50X genome size) they will ultimately have the entire genome after some sophisticated algorithyms sort the data and place it onto the map. They probably have most of the genome and have a few difficult bits to figure out (some sequences are harder then others to get).
Some searching reveals the NCBI press release. Looks like they have most of the sequence together. I'll bet berkeley provided the map which is allowing Celera to put their info together.
The big question is: Has Celera already filed patents on every ORF it has found; Will the patent office grant the patents; Will Celera get patents on the human homologs of these genes (they have identified most of the homologous sequences from EST's in the human genome project).
And you thought software patenting was fusked.
no sig.
You are absolutely correct! The next misson (after sequencing the genome is to figure out what all of those genes(proteins) are doing. So, onto the human structome project (structures of every protein that has been inferred through sequence) and the functome (functions of all genes that have been inferred from sequece data). I think 50 years is a resonable estimate. Things may accellerate a little once physicists (and coders) get involved and start creating models of signaling networks within cells. Models that predict real cellular responses to the additional expression of genes X & Y will be the one that begin to understand how cells operate.
Just think how different coding will be 50 years from now.
no sig.
Fortunately, things aren't quite as bleak as you portray them. Many, many proteins do in fact have a single, clearly defined primary function, either by themselves or as part of a larger complex. Those proteins can have their function inferred either by watching them catalyze reactions, deleting them and seeing how it affects celluar function, or comparing them to similar proteins from the same or other species.
More promisingly, new techniques of functional genomics and proteomics are being developed to analyze protein function by looking at more subtle factors. To find the function of a protein of unknown function, you can find out what other proteins it interacts with and infer what role it plays. You can also grow cells or organisms under different conditions and look for changes in levels of gene or protein expression to determine what proteins are associated with specific metabolic or other life states. Some very interesting work is also being done by determining the 3D structure of proteins (either by analysis or simulation) and predicting function based on structure.
The tools for the next big thing are out there. It's just a matter of going through the long grind of applying them. It's going to be a very long road, probably much longer than the process of sequencing the genome, but finding out (to a rough and ready approximation, at least) what every protein does is an accomplishable goal.
There's no point in questioning authority if you aren't going to listen to the answers.
Actually the sequencing part was completed earlier this year (giving tremendous subsequent rise to Celera stock). What they now did was the mapping - i.e. piecing the small fragments together.
:-)
Moreover, Celera have also completed more than 90% of the human genome within the last year or so. Once complete, this is an indication that the time before the human genome (more than 200 trillion base pairs) are mapped will be shorter than originally anticipated. To compare, the government-funded Human Genome Project has so far spent over 10 years on the same job.
Celera is doing a 4x oversampling on the human genome, unlike the HGP, which does 10x oversampling. This is possible because Celera is sequencing DNA from one single individual (most likely Craig Venter?), thus avoiding the uncertainty of wheter differences are due to sequencing artifacts or personal variations.
Plus, Celera is using our (PE Biosystems) 3700 DNA Analyzer (fully automated, unattended operation 24 hours per day), whereas the Human Genome Project mostly use our older 377 DNA Sequencer, which requires manual reloading of samples after each run (every 2-3 hours).
As originally stated when Celera was created two years ago, the data is going to be publicly available - a point that has gotten lost among very opinionated but not so informed readers of Slashdot. There will be a 3-month lag period, to ensure accuracy of the data, and to see if there is any information that could be used for patentable drugs & applications.
(Mostly, Celera's business model is based on providing the tools that will give access to this database).
And I have stock options!
-tor
Here is a much more detailed link of the story from Celera's site, talking about the similarities between our genes and the fruit fly's. (I've got a dollar that says their computers are all Celerons, ha ha ho ho.)
What's your damage, Heather?
Celera hasn't even by their own definition sequenced the entire genome of Drosophila. What they have done is sequenced most of, or all of the euchromatic region. The highly repetitive heterochromatic DNA that is clustered around the centromeric regions and makes up an estimated 30% of Drosophila genome is not sequenced. There may even be some B-heterochromatic regions which are also unclonable which is a serious problem in trying to sequence highly repetive DNA. While these regions don't have the glamour of the gene-rich euchromatin (it is often referred to as junk DNA for that reason) they can effect everything from gene expression to chromosome pairing.
And to the few posts I have read which think that this is some sort of private enterprise success story versus a slow blundering government, it isn't. It is a classic example of business going after the highly profitable bits and leaving the taxpayer to fund the basic research. The same basic research which incidentally made it all possible in the first place.
This is a wonderful accomplishment - now we can get started on the main problem.
Having a complete map of a creature's DNA tells us, in principle, all of the proteins that it can synthesize throughout its lifetime. This gives us the building blocks that the creature uses to build things, and the chemical signals that it uses to direct internal operations.
This is wonderful, and essential. To use an analogy, this is like a Victorian scientist, after years of studying a 1999 notebook computer, managing to deduce how transistors and the wires that connect them work.
He still needs to deduce a lot about capacitance, resistance, and inductance to tell how signals will propagate and influence each other, and needs to build up from scratch all of the disciplines involved in integrated circuit design before he can understand how it works, but it's a start.
Similarly, we can now move on to the next step in understanding biological creatures - trying to figure out what all of the proteins do, and how the systems built from them operate and interact with other such systems.
This would not be an easy task under the best of circumstances. It's made worse by the fact that evolution puts little value on modularity - the systems will interact with each other to such a degree that it will be difficult to even define individual systems within the chaos that is an evolved being.
I wish them luck. They have opened the door, and made available for study the vast landscape of interacting systems that we'll have to understand to truly understand how living creatures work.
-----BEGIN FRUITFLY-----
ATCGTAGCTAGCTGACTATCGTAGCTAGCTAGCGTATCGTAGCGATCG
GCATCGTAGCTAGCTAGCTACGTAGCTAGCTAGCGATCGTACGATCGA
CGTAGCATCGTAGCTAGCTACGTACGATCGATCGATCGTAGCTAGCTA
GACTAGCTAGCTAGCTAGCTAGCTACGTAGCGCGATCGATTCGATCGC
AGCTTGACTGATCGGATCGTGCTACGGACTGTACGATCGTACGATCGC
------END FRUITFLY------
GATCGATCGATGCTAGCTACGATCTGATCGATCGATCGTAGCTAGCTA