Slashdot Mirror

← Back to Stories (view on slashdot.org)

Celera Maps Entire Fruit Fly Genome

Posted by timothy on from the turtles-are-the-next-step dept.

cjoh345 wrote: "Celera Genomics has just sequenced all the genes in the fruit fly. Apparently the scientists involved are amazed at the genes that we share with this dorm-room annoyance. This discovery also validates Celera's "shotgun approach" to mapping out this stuff. And yes, the genome is available free of charge via Genbank. Good form, Celera!" What would Mendel have thought of this? How about Watson and Crick? This makes me want to break out my copy of The Double Helix .

2 of 123 comments (clear)

  1. Good, but the hard work remains to be done. by Christopher+Thomas · · Score: 5

    This is a wonderful accomplishment - now we can get started on the main problem.

    Having a complete map of a creature's DNA tells us, in principle, all of the proteins that it can synthesize throughout its lifetime. This gives us the building blocks that the creature uses to build things, and the chemical signals that it uses to direct internal operations.

    This is wonderful, and essential. To use an analogy, this is like a Victorian scientist, after years of studying a 1999 notebook computer, managing to deduce how transistors and the wires that connect them work.

    He still needs to deduce a lot about capacitance, resistance, and inductance to tell how signals will propagate and influence each other, and needs to build up from scratch all of the disciplines involved in integrated circuit design before he can understand how it works, but it's a start.

    Similarly, we can now move on to the next step in understanding biological creatures - trying to figure out what all of the proteins do, and how the systems built from them operate and interact with other such systems.

    This would not be an easy task under the best of circumstances. It's made worse by the fact that evolution puts little value on modularity - the systems will interact with each other to such a degree that it will be difficult to even define individual systems within the chaos that is an evolved being.

    I wish them luck. They have opened the door, and made available for study the vast landscape of interacting systems that we'll have to understand to truly understand how living creatures work.

  2. Here it is by MortimerK · · Score: 5

    -----BEGIN FRUITFLY-----
    GATCGATCGATGCTAGCTACGATCTGATCGATCGATCGTAGCTAGCTA
    ATCGTAGCTAGCTGACTATCGTAGCTAGCTAGCGTATCGTAGCGATCG
    GCATCGTAGCTAGCTAGCTACGTAGCTAGCTAGCGATCGTACGATCGA
    CGTAGCATCGTAGCTAGCTACGTACGATCGATCGATCGTAGCTAGCTA
    GACTAGCTAGCTAGCTAGCTAGCTACGTAGCGCGATCGATTCGATCGC
    AGCTTGACTGATCGGATCGTGCTACGGACTGTACGATCGTACGATCGC
    ------END FRUITFLY------