Slashdot Mirror


Human Genome Project Believed Complete

wecoyote writes ABC News has an article on the completion of the Human Genome Project. Apparently, there is supposed to be a presidential announcement this morning regarding the accomplishment. "

9 of 187 comments (clear)

  1. Alpha Centauri by Anonymous Coward · · Score: 3
    Human Genome Project completed! +1 talent at each base. The governor of "washington, dc" is asking you to initiate a new Secret Project, The Virtual World!

    Allow the governor to initiate a secret project
    Disallow the project, and tell the governor to interest himself in "sensible things"
    Cancel the project

    OK

  2. Will the two maps be combined? by stx23 · · Score: 3

    Given Celera's previous glitch, will the two Genome maps be combined and compared to give a better idea of overall accuracy, or will one be pandering to the private Sector, the other to the public sector?

  3. Re:caveats... by arivanov · · Score: 4

    No caveats. Sorry.

    Variations in the hunan genome has been subject of very intensive research since end of 1980-ties. The so called Restriction Length Polymorphisms have been used as a primary method for genetic diagnostics since and they are nothing but a manifestation of these variations. The exact differences are also usually well known. The data there can be correlated and joined with HGP. There will be need for additional research but no real caveat here. It is not as bad as you describe.

    Lots of math tough... Grin...

    --
    Baker's Law: Misery no longer loves company. Nowadays it insists on it
    http://www.sigsegv.cx/
  4. What exactly this Human Genome is at this point. by Effugas · · Score: 4

    Want to see something interesting?

    Go to this page within the Entrez browser of Genbank. Click Begin Download...and watch:

    >gi|8134254|ref|NT_001039|Hs22_451| Homo sapiens 22q11.2 sequence /len=1790785 TTTGGCTAAAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAGGG AGATCTTATG AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGCTG TATTTTAGGT TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTGTA CCCTTCTCTC TATGGGAGGGCTGTCCCTTGGCTGGCCTGGGATGCAGGAATAGCTTTTGT GCACCCTTTG GTGTCCACTTCTGTGTGTCTCTCTTGGTGGCACTGCTTCCCTATCTCTGC TTGCTCTGAC CACCTTCAGGCTCCTAGGACCCTACCCTCTCAAATTTCCTCCTCCCCTGC GTCCCCCTTT CCCATTCAAAGCCCACAGCACATCTCAGTTAGTGCTATGGAAAAAACTAG CCTCAGAAAC GAATATTCACTGACATGTCAAGGTCTAGTAGTTTGTAGAGCCATTTTATT GGAAGGGACT TCAGAAAGGAATTAGTTTACCTACTCATCAGGTGAGGAGACCCACAGAGG GGAAGTCACC TGCCTGACTCCCAGAGACAGAAACAGTGCTGGGACTAAAACCCAAGAAGG GTCCTGACTC CCAAGTCCCAGGAACTTAATTTTCCCCCAGGGAATGGCCCACCACCCACC CAGATGTAAA AACTAGAGACTCTGGGCAGCATTCTATCTCTATGCCAGCCTCCAGTCTCC TGTCTATTTT GCCTCCAAGATACATCTCTAATTTGCCCACTTTTCTTGAACTTCACATCA CCGATCTGGT ACAAGCCATCATCATCTCCTTGCTTGGGCCTACCAAGACACTAATCACTG TTCTTTTTGT TTCGTTTTGTTTGTTTTTGAGACAGAGTCTCATTCTTATCACCCAGGCTG GAGTACAGTG GCATGATCTCAGCTCACTGCAACCTCTGCCTCCCATGTTCAAGCGATTCT CCTGCCTCAG CCTCCCAAGAAGCTGGGATTATTGGCATGCGCCACCACACCAGGCTAACT TCATATTTTT AGTAGAGATGGGGTTTCACCCTGTTGGCCAGGCTGGTCTTGAACTCCTGA CCTCAGGTGA TCCACCTGCCTCGGCCTCCCGAAGTGCTGGCATTACAGGCATGAACCACC ATGGCAGGCT GACTTTCATTCTTTCTCTAGTATTATTAGAATATTCCCAAATAATATTCC ATTGTGTATA TATTCCACATTTTGCTCATTGGTTTCTCATGGTCCGATCTGAGCTTTGGG TAGATCTGGC TATAGGCAGATAATCCCTGAGACATACTGCTAAATGGGAACAGCAGATGC AGAACAGTGT GTATGATACGCTACCACTTCTGCTGGAAAACGTCAAACAGGCACGTGTGC ATACATATGT ACGTGGACTTGGAAAGGCATAGACCGTCTTTGAGAATACTCAAGAAGTGG TTATCTTGGG TAGGAGAGCTGGTGGCGGGGGACAGAAATGGAAAGGAGACTTATTTTTCA CTGGATATAC TTTTGTACATTTTATGGCTTATTAATAATGATTTTATAATTATATTACCA TGATCAAATA AAACCCTTGGTGAATCTTCAATATTCAATAAAAGGCTTGGTTCTTTTAAG CACATATAAA CTTTTTTTTTTTTTGAGACAGGGTCTTGCTCTGTCACCCAGGCTGGGGTG CAGTGGCACA ATCTCTGGCTCACTGCAGCCTCTACTTCCCAGGCTCAAGTGATCCTCCCG CTTCAGCCTC

    And so on, so forth, for 33Mb worth...Chromosome 22.

    It's a bit dump, folks, with two bits per character. That's it. cat /dev/sequencer | gendump. (Yeah, yeah, abuse of unix commands. Too simple to resist.) Of course, what made this so ungodly difficult was the getting the sequences straight--vast amounts of data, no headers, and a flaky character mode device. Not simple to get this data; they essentially needed to repeatedly run the data through the analyzer and look for patterns which constantly repeated to determine how everything lined up within the chromosome.

    We don't know what any of it does, of course. We have ideas, implemented using the crudest of methods. The last time I tried to figure out what a piece of code did by commenting it out, I actually felt pretty good about myself--that's what genetics researchers do, and it is what they're wanting to patent, right or wrong.

    We've got the bits. Now we've got to figure out what they do. The entire field of computational biology has been created to decode this mess...I'm truly looking forward to seeing open source genome analysis tools come out of this.

    Open Source analysis of a system within which Source has never existed. That should be interesting.

    Entertaining tidbit: The CEO of Celera will likely have his own genome sequenced and released publically. Contrary to popular belief, this has nothing to do with the Human Genome Project's threat that "your ass is mine." (Kidding ;-)

    Yours Truly,

    Dan Kaminsky
    DoxPara Research
    http://www.doxpara.com
  5. Re:What exactly this Human Genome is at this point by dmccarty · · Score: 3
    Open Source analysis of a system within which Source has never existed. That should be interesting.

    To believe that no one has ever held the "source" for humans and other living things is akin to believing that you could find an intricate piece of machinery (a watch, for example) lying on the ground that had somehow assembled itself and was designed by no one.

    I believe that our source exists, we just haven't met the programmer yet.

    Best regards,
    Daniel McCarty
    --

    --
    Have fun: Join D.N.A. (National Dyslexics Association)
  6. Re:What exactly this Human Genome is at this point by Effugas · · Score: 3

    To believe that no one has ever held the "source" for humans and other living things is akin to believing that you could find an intricate piece of machinery (a watch, for example) lying on the ground that had somehow assembled itself and was designed by no one.

    Whoa there, McCarthy. I'm not saying there's no God, or Allah, or Yehova, or anything else of that nature. I just prefer not to limit that guiding force to any single moment of creation, saying that It(the correct pronoun doesn't exist) needed to have all time and all thought forged at once.

    What could be more interesting to a Creator than a universe he did not Create? Think about that. Think about how cool self-optimizing code is to us hackers. Look at the talk of genetic algorithms. Are you saying we can pull off stuff our own creator can't?

    Actually, that'd be really interesting wouldn't it...

    (I actually wouldn't have replied to this, but I've been having an inordinate amount of fun reading the online comic strip Acid Reflux, which really should be read from the beginning but has a pretty good summary right about here...call me a blasphemer if you like; I just love the concept behind this strip!)

    Yours Truly,

    Dan Kaminsky
    DoxPara Research
    http://www.doxpara.com

  7. The Genome actually has Five bases. Sort of... by Guppy · · Score: 5

    As the HGP and Celera finish up the first draft of the human genome, I thought I'd mention a second interesting mapping project that's just starting up now.

    All life as we know it uses the same four bases in its genetic code, A, T, C, and G. However, there is a chemical modification known as methylation, which changes the structure and behavior of the base C, cytosine. Methylated cytosine is considered by some to be a "fifth" base. (Note--Adenosine can also be methylated, but mostly in prokaryotes only, I think). In mammals, about 2-5% of cytosine have this modification.

    The thing about methylation is that it doesn't affect base pairing, so G's will bind with either normal or methylated C's. The pattern of methylation can be preserved as DNA replicates, though, by the action of enzymes can methylate and de-methylate cytosines. The pattern isn't static, though. In some places it varies at different times, and sometimes may be altered in different kinds of tissues. So you get a changes which sometimes can be inherited, and sometimes not, all depending on how the patterns shift.

    Just recently, a European consortium known as the Human Epigenome Consortium (HEC) was announced to identify these methylation patterns. It's a task which is on the same scale as the HGP, but it's not as well known so I don't know if they'll be able to attract as much funding. Here's a link to an article on the HEC.

  8. Article error. by Cliffton+Watermore · · Score: 5
    The article in itself is interesting, the Human Genome Project is indeed a big milestone. However, a few of the things mentioned in the article disturb and annoy me, to be quite honest.

    Each genome contains 30,000-100,000 genes containing the basic information that makes us who we are: the color of our eyes, our intelligence, the disease to which we are susceptible and more.

    No argument with most of that, colour of eyes and disease-proneness are identifiable. Intelligence? That's utter nonsense. I've been working in this area for many years, and if anything, there are still more questions that have to be answered than answers themselves. We don't know how intelligence works, yet. We aren't there. We don't know if it's mainly genetic software (as this article just assumes, without proper consultation), wetware, or something chemical. The very definition of intelligence is in question. IQ tests prove nothing, and Academic tests are almost as useless.

    I was contracted by a firm in the UK in 1995 to design a new generation of SQUIDS. Basically, what a SQUID (Superconducting Quantum Interference Device Scanner) does is convert electrochemical impulses into instructions. This way, scientests can analyze instruction patterns and try to better-design atrificial intelligence systems. I think that experience, and my academic qualifications, qualifies me tenfold to discuss this topic - there's no way intelligence is entirely genetic. Certainly genetics affects it, but to say that you can define intelligence totally by genetic mapping is utterly ludicrous, and I will take anyone out there up on that.

    --
    "A few atoms won't even light a match" - Dr Jones, 1933
  9. Re:What exactly this Human Genome is at this point by Guppy · · Score: 5
    That's funny, I tried looking at Celera's sequence, and got the following...

    >gi|8134254|ref|NT_001039|Hs22_451| Homo sapiens 22q11.2 sequence /len=1790785
    FIRSTPOSTAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAG GGAGATCTTATG
    AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGC TGTATTTTAGGT
    TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTG TACCCTTCT...