Slashdot Mirror


Human Genome Project Believed Complete

wecoyote writes ABC News has an article on the completion of the Human Genome Project. Apparently, there is supposed to be a presidential announcement this morning regarding the accomplishment. "

3 of 187 comments (clear)

  1. The Genome actually has Five bases. Sort of... by Guppy · · Score: 5

    As the HGP and Celera finish up the first draft of the human genome, I thought I'd mention a second interesting mapping project that's just starting up now.

    All life as we know it uses the same four bases in its genetic code, A, T, C, and G. However, there is a chemical modification known as methylation, which changes the structure and behavior of the base C, cytosine. Methylated cytosine is considered by some to be a "fifth" base. (Note--Adenosine can also be methylated, but mostly in prokaryotes only, I think). In mammals, about 2-5% of cytosine have this modification.

    The thing about methylation is that it doesn't affect base pairing, so G's will bind with either normal or methylated C's. The pattern of methylation can be preserved as DNA replicates, though, by the action of enzymes can methylate and de-methylate cytosines. The pattern isn't static, though. In some places it varies at different times, and sometimes may be altered in different kinds of tissues. So you get a changes which sometimes can be inherited, and sometimes not, all depending on how the patterns shift.

    Just recently, a European consortium known as the Human Epigenome Consortium (HEC) was announced to identify these methylation patterns. It's a task which is on the same scale as the HGP, but it's not as well known so I don't know if they'll be able to attract as much funding. Here's a link to an article on the HEC.

  2. Article error. by Cliffton+Watermore · · Score: 5
    The article in itself is interesting, the Human Genome Project is indeed a big milestone. However, a few of the things mentioned in the article disturb and annoy me, to be quite honest.

    Each genome contains 30,000-100,000 genes containing the basic information that makes us who we are: the color of our eyes, our intelligence, the disease to which we are susceptible and more.

    No argument with most of that, colour of eyes and disease-proneness are identifiable. Intelligence? That's utter nonsense. I've been working in this area for many years, and if anything, there are still more questions that have to be answered than answers themselves. We don't know how intelligence works, yet. We aren't there. We don't know if it's mainly genetic software (as this article just assumes, without proper consultation), wetware, or something chemical. The very definition of intelligence is in question. IQ tests prove nothing, and Academic tests are almost as useless.

    I was contracted by a firm in the UK in 1995 to design a new generation of SQUIDS. Basically, what a SQUID (Superconducting Quantum Interference Device Scanner) does is convert electrochemical impulses into instructions. This way, scientests can analyze instruction patterns and try to better-design atrificial intelligence systems. I think that experience, and my academic qualifications, qualifies me tenfold to discuss this topic - there's no way intelligence is entirely genetic. Certainly genetics affects it, but to say that you can define intelligence totally by genetic mapping is utterly ludicrous, and I will take anyone out there up on that.

    --
    "A few atoms won't even light a match" - Dr Jones, 1933
  3. Re:What exactly this Human Genome is at this point by Guppy · · Score: 5
    That's funny, I tried looking at Celera's sequence, and got the following...

    >gi|8134254|ref|NT_001039|Hs22_451| Homo sapiens 22q11.2 sequence /len=1790785
    FIRSTPOSTAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAG GGAGATCTTATG
    AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGC TGTATTTTAGGT
    TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTG TACCCTTCT...