Purchase Your Personal Gene Map
dstone writes "Craig Venter, Time Magazine's Person of the Year in 2000 has a new hobby: collecting rich people's DNA. Millionaires are lining up to buy their personal gene maps for the cool price of USD$621,500. The process takes a week and you get some insight into your genetic mutations that may correlate with illnesses, cancers, Alzeimer's, etc. Venter is a high profile character in the genetic sequencing scene and the Human Genome Project. More info on him may be found here(1) , here(2), and here(3) . If you had the pocket change, would you give this man your business?"
Jeez, whos gonna know, if some guy gave me half a million dollars to do it i'd sit there for a day and type random combinations of a, c, g and t, heres your genome... acgtgtacgtcagtacgtcgtgcatcgatcgatctacgatcgatcgat cgatcgatcgatcgatcgatcgactgactagctagctacgatgtatgcgc gatttcggatatttcgagctacgctadgatcgatcgatcgatcgatcgat cgatcgatcdgatcgatagctagctagctagctagctgatcgatcgatca tcgatgcgtagttagtcgtcgtacgtagctatcgatcgatctagctagct agctag X 10^?
"Sic Semper Tyrannosaurus Rex."
Eventually as the process becomes less expensive and less time consuming we should see this slowly seep into the public sector.. once that happens the scare of it should wear off as the uses of it take shape.
Personally, I think we're going to be seeing a LOT of gene therapy in our lifetime..
I just know I'm gonna be the last person on earth to die!
"Yup, we discovered how to let you live youthfully and healthily forever! All I need to do is give you this injection"
"Forget it doctor... he's gone."