Slashdot Mirror

← Back to Stories (view on slashdot.org)

Burn your genes on CD -- for $500,000

Posted by CmdrTaco on from the put-that-on-gnutella dept.

An anonymous reader writes "Venter says he plans to offer the service, with the goal of burning individual human's entire DNA sequences onto shiny compact discs. It will cost about $500,000 per person, says the entrepreneurial scientist who helped decode the human genome. "

7 of 276 comments (clear)

  1. I wonder... by Innominate+Recreant · · Score: 2, Interesting

    what it would sound like. Take the data on the CD, convert it to MP3 or OGG and then have a listen. While most of our "songs" would sound the same, I suppose some filters could be applied to record only the major differences. It might make for some interesting electronica.

    1. Re:I wonder... by stile · · Score: 3, Interesting

      This has been done before. Years ago, I don't know where, I heard of someone making "DNA Music". They took A,C,T,G, and mapped them to musical notes: A->A, C->C, T->E, G->G. Fits rather nicely into the key of C major. Then they would just "play" a dna sequence and see what came out... Unfortunately, I have no links to post, I lost wherever I first heard mention of this (discover magazine, maybe?) and haven't found it since. Anyone?

    2. Re:I wonder... by the+gnat · · Score: 3, Interesting

      I dunno. . . put a throbbing techno beat behind it, you might have something. Esepcially since so much of our genomes is actually repeated motifs like SINEs or Alu sequences. Music to clone by. Even better, take some real genes or even just the DNA encoding protein fragments, and see if you get anything interesting. (I think "Leucine Zipper" would be a badass song name.)

      I'm a bioinformaticist- maybe I'll try this if I get bored some evening.

  2. some questions by john82 · · Score: 3, Interesting

    I don't see what the consumer gets for $500K, but I do see what the vendor gets: your DNA and a big chunk of money.

    1) What keeps them from exploiting your DNA for their profit? Suppose they discover something profoundly unique about your DNA that has significant medical implication. Who has the rights to that information?

    2) How is the information encoded on the CD? Is it proprietary or some kind of de facto standard? (Oh, so you want to use the information? We'll have to read that for you! $100,000 per reading!)

    3) CDs last forever right? Thirty years from now I'll be able to use the information on that CD, right? Didn't think so.

    1. Re:some questions by micromoog · · Score: 3, Interesting
      1. It's a non-profit project.
      2. It's a non-profit project.
      3. Back it up just like any other worthwhile data.
    2. Re:some questions by rew · · Score: 3, Interesting

      CGAAGACTCTTTCAGATCGGCTAGATTGATTACATCTCGG

      Nope. Won't fit.

      The Human gene set holds about 3 billion acid pairs. Thus you'd need a file of about 3 gigabytes to hold it in plain ascii. The file holds only 2 bits per byte, so can trivially be compressed to 600M, but gzip is very likely able to do much better.

      #include

      int main (int argc, char **argv)
      {
      int ch;
      char ACGT[] = "ACGT";

      while ((ch = getchar ()) != EOF) {
      putchar (ACGT[ (ch >> 0) & 0x03] );
      putchar (ACGT[ (ch >> 2) & 0x03] );
      putchar (ACGT[ (ch >> 4) & 0x03] );
      putchar (ACGT[ (ch >> 6) & 0x03] );
      }
      exit (0);
      }
      Regards,

      Roger.

  3. Ventner is suspect already... by oliphaunt · · Score: 4, Interesting

    Remember, this is the guy who swapped HIS OWN DNA with the "random sample" that was supposed to represent all of humanity. Maybe this DNA-on-a-CD scheme is what he wanted to do all along?

    --




    Humpty Dumpty was pushed.