Slashdot Mirror
Burn your genes on CD -- for $500,000
An anonymous reader writes "Venter says he plans to offer the service, with the goal of burning individual human's entire DNA sequences onto shiny compact discs.
It will cost about $500,000 per person, says the entrepreneurial scientist who helped decode the human genome. "
If you bring your own disc, that'll only come to $499,990.00
And it doesn't cost me a penny!
Government of the people, by corporate executives, for corporate profits.
than trying to find a suitable, willing girl to carry my genes, and probably almost as much fun, too!
Just more proof that, one day, the RIAA will indeed own all of us.
(Score:1, The Who Reference)
cool, now i can get the DNA sequence of someone i really dont like, and use it as a coaster for my coffee at work.
"gee, if im using your genetic sequence to keep my desk clean, chances are i dont really care for your opinion either, huh?"
Chromosome 1:t tagt atcgatcgttagctactggtactgtgatgctgtgatgcgtatcgtatctg tgatgcgtatgctgtgatgctgtgggtggtgtggtgattatatatataaa atattttaaaaaaaaaaaaaaaaaaaaaagtgtctgtatgctgtgagctg tgactggttagtggcgtgcgcccccccccccccccccccgtattgggatt atttattatattatatatattatctctatcgcttctgcgtctgctgtgct gctgtgctctctcttcttcttttttttctctctcccgcggcgatgcatgc ggtcttgatcgttaggcttgtatgcgtggtacgtgatgctgtgtctgagt ctggtggatggtctggtctgatgcgttggattgc
atgcgcctagtttatagcgagcgtatgctgatcagtctggtatgg
Linux - Because Mommy taught me to Share.
Will a CD like this get me through the express line at an airport, regardless of whether or not I wear a turban.
/^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i
Could i get my genome sequenced onto vinyl?
"Sic Semper Tyrannosaurus Rex."
burning individual human's entire DNA sequences onto shiny compact discs
I can do that for less than $500k:
Ingredients:
One CD (make use of an AOL one for a change).
A skin or blood sample.
Preperation:
Put all the ingredients into a casserole dish, preheat oven to gas mark 9. When ready place casserole dish into oven and leave until black acrid smoke comes out of the oven. Et Voila, your DNA 'burned' onto a CD.
A nice keep sake for years to come! And as Nigella Lawson would say, "Absolutely Scrumptious"!
Are you local? There's nothing for you here!
Sure, it's expensive, but think of the value! I mean, that's just pennies per gene! With all of that information you can.. uhh.... erm..... prove your genetic superiority! I mean, after they sequence your genes and find out that you share 99% of your genes with every other human on the planet, you can use the remaining 1% to find out absolutely nothing that you didn't already know about your phenotypical characteristics! I know -- I'm just getting too excited.
Now I just have to sell my stock in Venter's enterprise to affod it --- oh wait: I OWE 500 grand on ledger. Silly me!
Cheers,
-----[0_o]-----
We are not amused.
Anyone who buys it won't find out they have the Sucker Gene until they get their disc.
If I wasn't so lazy, I'd have a sig.
Yeah? Well I can burn my DNA into a live human being with just a few pelvic thrusts.
eTrade SUCKS
Why pay $500,000 for my genetic code on CD when I can just get it off of kazaa or gnutella for the cost of bandwidth? I mean really.
You see? You see? Your stupid minds! Stupid! Stupid!
It's alway good to have a backup copy of your genes in case you have to reformat / reinstall yourself.
Ideology is for ideots.
yeah, i had a friend who partitioned himself wrong and went to unichs (unix)
Disco Stu was talkin' to you.
After you have burned your genes on CD put the CD into the microwave.
Oh what fun.