Slashdot Mirror


Mouse Genetic Code Published

linuxwrangler writes "Scientists in six countries have published a nearly-complete genetic code of the mouse. Results show striking similarities between human and mouse DNA and scientists are now working on side-beside mapping of the two genomes."

51 comments

  1. I know! I know! by GuyMannDude · · Score: 4, Funny

    Results show striking similarities between human and mouse DNA and scientists are now working on side-beside mapping of the two genomes

    And the project is called "Of Mice and Men", right?

    GMD

    1. Re:I know! I know! by hitchhacker · · Score: 4, Funny


      > And the project is called "Of Mice and Men", right?

      more like "The Best laid plans of mice and men."
      oooh, creepy.
      The mice will be furious.

      -metric

    2. Re:I know! I know! by macdaddy357 · · Score: 2

      actually, they hope to combine human and mouse DNA to make a real Mickey and Minnie. Michael Eisner is suing them for copyright infringement.

      --
      How ya like dat?
  2. In other news... by Omega+Hacker · · Score: 3, Funny

    God has filed suit against the scientists who have "decoded" the DNA of a mouse, citing the DMCA's anti-circumvention provisions.

    --
    GStreamer - The only way to stream!
    1. Re:In other news... by Kragg · · Score: 1

      Deity's Mouse Copyright Act?

      --
      If you can't see this, click here to enable sigs.
  3. Striking similarities. by Kaz+Kylheku · · Score: 5, Insightful

    Just looking at a mouse shows striking similarities to a human being. Skeleton with a backbone, pelvis and skull. Two eyes. Brain, nervous system, heart, lungs. A nose with two holes above a mouth, between two eyes. Et cetera.

    It's not that astounding that similarities in the genetic code should be found, or even striking ones. ;)

    1. Re:Striking similarities. by GigsVT · · Score: 1

      It's only astounding to the Christians that still persist in claiming we are inherently different from "animals".

      Not that I'm some vegan tree-hugger, but it's naive to rationalize our treatment of animals on the premise that we are somehow not "animal". Animals eat and kill other animals. People should just accept that.

      --
      I've had enough abrasive sigs. Kittens are cute and fuzzy.
    2. Re:Striking similarities. by joebp · · Score: 1
      Animals eat and kill other animals. People should just accept that.
      Except... mice?
    3. Re:Striking similarities. by jericho4.0 · · Score: 2
      I agree that we can't say we're inherently different from animals. But there are many arguments for a vegetarian lifestyle beyond that one.

      Lesser footprint on the planet, less crulety, possibly better for you nutritionaly, less exposure to drugs and hormones,etc.

      On the other hand meat is so damn tasty though.....If God wanted us to be vegetarian, why did He make animals out of meat?

      --
      "A language that doesn't affect the way you think about programming, is not worth knowing" - Alan Perlis
    4. Re:Striking similarities. by Anonymous Coward · · Score: -1, Troll
      Animals eat and kill other animals. People should just accept that.


      Except... mice?

      Put three mice in a cage, two male and one female. One male will, in a very short amount of time, kill (an partially eat) the other male.
    5. Re:Striking similarities. by Dachannien · · Score: 1

      To understand why there are striking similarities between any animals, it's easy enough to get lower level than number of eyes or ears or limbs. Just look at the sorts of neurotransmitters used in the nervous system, for example, or the hormones that control fetal development. Many of these chemicals are the same for humans as in pretty much any animal - you have to go as far as the split between mammals and reptiles/amphibians/etc. before any real biochemical differences start appearing, and still the basic biochemical principles are the same.

      But yes - it's really not astounding at all that there would be genetic similarities between any mammals. Personally, I find it interesting that multicellular life exists at all :)

    6. Re:Striking similarities. by VisorGuy · · Score: 1

      Actually, I was watching something on Animal Planet (I think?) last night that featured the Grasshopper mouse, also known as the Scorpion mouse.

      They primarily eat insects, particularly scorpions, and other small rodents, sometimes including each other... That's right... Cannibals.

      Here's some links:
      The Carnivorous Grasshopper Mouse
      Tulare Grasshopper Mouse Profile

      --
      This user account is inactive account replaced by the PDA
    7. Re:Striking similarities. by cranos · · Score: 2

      Heres another one that eats other rodents, however it also has the dubious honour of being able to literally shag itself to death. The males only live for a couple of years before they find the right mate and then proceed to hammer away for 12 hours or so. I am not making this up, the end result is, their system is so shagged out they can't fight off infection or illness and hence the drop dead.

    8. Re:Striking similarities. by cranos · · Score: 2

      Just to prove I am a very strange person heres a link that proves the Antichinus is the sex god of the rodent world Link

    9. Re:Striking similarities. by Anonymous Coward · · Score: 0

      Before jumping to conclusions, and posting about what Christians may or may not believe, it would be open-minded of you to read the Bible or ask a Bible-believing Christian.

      Example: it's clear in the Bible that Adam and Eve down through Noah were purely vegetarian; only once the flood had subsided was Noah told that all animals were now meat(food) for him.

      And it's clear that after the tribulation, when the Lord Jesus Christ returns to set up his glorious millennial Kingdom, the earth will be restored to an Edenic state. That is where the line you're probably familiar with came from about how the lamb will lay down with the lion.

    10. Re:Striking similarities. by Moridineas · · Score: 2

      Well everything you just listed was found in a dinosaur too. For that matter everything was found in some of the earliest land dwelling amphibians. Fish even have most of those things. What is amazing to me is that these HUGE differences can be represented with so little data. I think it's time we start evaluating if what we know is right?

    11. Re:Striking similarities. by trixillion · · Score: 2

      I just read the excerpt. Unfortunately, the Antichinus is a marsupial that only resembles a mouse. This little fact destroys your original point.

    12. Re:Striking similarities. by cranos · · Score: 2

      Well aren't we a little anal. I hate to burst your bubble but there is a class of animal called Marsupial Rodents. Just like we had the Tasmanian Tiger which wasn't a Tiger and the Koala Bear which isn't a bear. With all due respect the whole message was a joke, and was not meant to be taken so seriously, lighten up.

  4. brain capacity by GigsVT · · Score: 0, Troll

    side-beside

    In other news, it was found the DNA sequences responsible for language were more mouse-like in the study group known as "Slashdot story submitters".

    --
    I've had enough abrasive sigs. Kittens are cute and fuzzy.
  5. Creationism by ohchaos · · Score: 1, Funny

    As if the creationists aren't upset enough about the prospect of us decending from monkey's....

    1. Re:Creationism by VisorGuy · · Score: 1

      In fact this would likely lend more credibility to a creation theory than an evolution theory because it would show that a creator simply stuck with a good pattern.

      Is it not true when writing code that one typically draws from past experience and often even ressurects code previously used in a successful implementation?

      --
      This user account is inactive account replaced by the PDA
    2. Re:Creationism by Catskul · · Score: 2

      ... Or maybe there just isnt that many differences in the structure and chemestry between humans and mice....

      Believe what you want,
      but when it comes to scientific discussion about evolution, your two cents about creationism don't add anything. Believing that things were designed by God doesnt give you any power of prediction. That is what Science is all about. No one really cares if electrons actually spin, but describing them that way allows you to predict what they will do.

      Making claims about creationism when topics of evolution come up just adds noise, and flames. I dont know about anyone else, but I would like it if you would resist the erge to attempt to convert people.

      --

      Im not here now... Im out KILLING pepperoni
  6. Interpretation by Anonymous Coward · · Score: 0

    "We still need help interpreting this book of life," said Kerstin Lindblad-Toh of the Whitehead Institute/MIT Center for Genome Research.

    And we need help interpreting her name!

  7. Good for mice! by The_Guv'na · · Score: 2

    Now they can be born with exceptional hearing!

    They could be used for surveilance in this age of fear and vigilance. Might work better than the cat with built in microphone+transmitter that had it's first test cut tragicly short.

    Ali

  8. hmm by dl248 · · Score: 2, Funny

    maybe that's why I like cheese so much.

  9. DNA is nice and all by Cokelee · · Score: 5, Informative

    but what could possibly be more important is noncoding RNA, or microRNA. I read a good article about it at Science News.
    Another useful link is the project site for the program RNAGENiE.

    Just thought many people would find that interesting.

    1. Re:DNA is nice and all by Otter · · Score: 4, Interesting
      Note, though, that microRNAs and other noncoding RNAs are encoded by genes in DNA, just like the more familiar genes whose RNAs are translated to protein. That's perhaps part of the reason why humans seem to have a surprisingly low number of genes -- microRNAs were recently discovered and there may be many more such families that existing methods don't recognize as genes.

      Presumably such families, being important, would be similar between the human and mouse genome and much of the analysis of those similarities involves looking exactly for that.

    2. Re:DNA is nice and all by kargis · · Score: 1

      Actually, if you look at the Nature issue, they are actually trying to look at the non-coding regions of DNA. Non-coding RNA is harder to look at because it requires finding what is in the cell, and doesn't turn into a protein. Systems biology approaches will be needed to make this happen, but it's nice to see that there is significant thought going into the fact that "non-coding" DNA can change the fur color of mice.

  10. Part of an ongoing experiment. by GMontag451 · · Score: 0
    This is just a part of an ongoing, and very subtle, experiment designed to study the psychology of humans.

    Moderators: don't mod offtopic just because you don't get the reference.

  11. Ok I gotta say it. by snoozerdss · · Score: 2, Funny

    Cool. So does this mean mice are now open source!? ;) Boo Hiss!!! baaaaad joke!

    --
    Snoozer.
  12. Genetic Mouse code unveiled by AntDaniel · · Score: 1
    Is this open source?

    Will it allow me to fix my problems with scrolling and mouse-overs
    Does allow us to descibe the evolutionary process of the Ball less mouse, or the mouse wheel.

    1. Re:Genetic Mouse code unveiled by Mercaptan · · Score: 2

      It's open source and then some. You'll be able to pick it up from the NIH and a number of other places, on government tabs no less.

      Good luck compiling it though.

      By the way, here's a more official press release.

      --
      -- "Sucks to your ass-mar"
  13. What license? by 3-State+Bit · · Score: 2

    Is this "shared-source" (MS-lingo) type "open source" (note lowercase) hardware or is it truly open-source hardware?

    Further: If this is under the GPL (although I doubt it is -- still, it's a good question for the future) and I modify the source organically (through breeding), am I required to release the resulting code? HOW? I don't HAVE the resulting code! (Unless I pay a lot of money to have scientists in six countries sequence it for me...)

    Anyway, yeah.

    1. Re:What license? by Mercaptan · · Score: 2
      To quote the Ensembl Project website, where you can get your very own copy of the mouse genome,
      "Access to all the data produced by the project, and to the software used to analyse and present it, is provided free and without constraints."
      So, it's pretty much license free. See, that's why us bio-geeks are smiling all the time.

      --
      -- "Sucks to your ass-mar"
  14. Doesn't Disney have copyright? by MacAndrew · · Score: 4, Funny

    Or patent or trademark or whatever the heck Mickey is at this point. The Sonny Bono Act will only carry them so far. (Don't blame him for what Disney forces him to lobby for.)

    Genetically engineered mice can be patented, so bioengineered or cloned progeny of Mickey may be attractive to Disney Genetics and Licensing, Inc. There is some suspicion Mickey himself is engineered, as he has not aged in over 60 years.

    Set Mickey free!

  15. Spoiler Alert: by Anonymous Coward · · Score: 2, Funny

    ####### SPOILER Alert #########

    acccctcgcagcaccccgcgccccgcgccctcccagc cgggtccagccggagccatggggccggagccgct
    agtgagcaccatgg agctggcggccttgtgccgctgggggctcctcctcgccctcttgcccccc ggagcct
    gcgagcacccaagtgtgcaccggcacagacatgaagctgcg gctccctgccagtcccgagacccacctggt
    acatgctccgccacctct accagggctgccaggtggtgcagggaaacctggaactcacctacctgccc act
    caatgccagcctgtccttcctgcaggatatccaggaggtgcaggg ctacgtgctcatcgctcacaaccaat
    gtgaggcaggtcccactgcaga ggctgcggattgtgcgaggcacccagctctttgaggacaactatgccct
    tggccgtgctagacaatggagacccgctgaacaataccacccctgtcac aggggcctccccaggaggcctt
    gcgggagctgcagcttcgaagcctca cagagatcttgaaaggaggggtcttgatccagcggaacccccagt
    ctc tgctaccaggacacgattttgtggaaggacatcttccacaagaacaacca gctggctctcacactgat
    tagacaccaaccgctctcgggcctgccacc cctgttctccgatgtgtaagggctcccgctgctggggagat
    gagttct gaggattgtcagagcctgacgcgcactgtctgtgccggtggctgtgcccg ctgcaaggggccat
    ctgcccactgactgctgccatgagcagtgtgctg ccggctgcacgggccccaagcactctgactgcctggt
    cctgcctccac ttcaaccacagtggcatctgtgagctgcactgcccagccctggtcaccta caacacagat
    cacgtttgagtccatgcccaatcccgagggccggtata cattcggcgccagctgtgtgactgcctgtccct
    tacaactacctttct acggacgtgggatcctgcaccctcgtctgccccctgcacaaccaagaggt gacagt
    cagaggatggaacacagcggtgtgagaagtgcagcaagccct gtgcccgagtgtgctatggtctgggcatt
    ggagcacttgcgagaggtg agggcagttaccagtgccaatatccaggagtttgctggctgcaagaagat ct
    tttgggagcctggcatttctgccggagagctttgatggggacccag cctccaacactgccccgctccagct
    cagagcagctccaagtgtttgag actctggaagagatcacaggttacctatacatctcagcatggccggat
    cagcctgcctgacctcagcgtcttccagaacctgcaagtaatccggggac gaattctgcacaatggcgcct
    tactcgctgaccctgcaagggctgggc atcagctggctggggctgcgctcactgagggaactgggcagtgt
    gact ggccctcatccaccataacacccacctctgcttcgtgcacacggtgccct gggaccagctctttcgt
    gaacccgcaccaagctctgctccacactgcc aaccggccagaggacgagtgtgtgggcgagggcctggcct
    tgccacca gctgtgcgcccgagggcactgctggggtccagggcccacccagtgtgtca actgcagccagtt
    tccttcggggccaggagtgcgtggaggaatgccga gtactgcaggggctccccagggagtatgtgaatgct
    caggcactgttt gccgtgccaccctgagtgtcagccccagaatggctcagtgacctgttttg gaccggagt
    gctgaccagtgtgtggcctgtgcccactataaggaccct cccttctgcgtggcccgctgccccagcggtgt
    tgaaacctgacctctc ctacatgcccatctggaagtttccagatgaggagggcgcatgccagcctt gccct
    catcaactgcacccactcctgtgtggacctggatgacaagggc tgccccgccgagcagagagccagccctt
    ctgacgtccatcgtctctgc ggtggttggcattctgctggtcgtggtcttgggggtggtctttgggatcc t
    tcatcaagcgacggcagcagaagatccggaagtacacgatgcggaga ctgctgcaggaaacggagctggtt
    ggagccgctgacacctagcggagc gatgcccaaccaggcgcagatgcggatcctgaaagagacggagctgt
    a ggaaggtgaaggtgcttggatctggcgcttttggcacagtctacaagggc atctggatccctgatggggt
    agaatgtgaaaattccagtggccatcaa agtgttgagggaaaacacatcccccaaagccaacaaagaaatt
    cttag acgaagcatacgtgatggctggtgtgggctccccatatgtctcccgcctt ctgggcatctgcctgt
    acatccacggtgcagctggtgacacagcttat gccctatggctgcctcttagaccatgtccgggaaaacct
    gcggacgcc tgggctcccaggacctgctgaactggtgtatgcagattgccaaggggatg agctacctggat
    ggatgtgcggctcgtacacagggacttggccgctcg gaacgtgctggtcaagagtcccaaccatgtcaaat
    attacagacttcg ggctggctcggctgctggacattgacgagacagagtaccatgcagatggg ggcaaggt
    tgcccatcaagtggatggcgctggagtccattctccgccg gcggttcacccaccagagtgatgtgtggagt
    ttatggtgtgactgtgt gggagctgatgacttttggggccaaaccttacgatgggatcccagcccgg gagt
    atccctgacctgctggaaaagggggagcggctgccccagccccc catctgcaccattgatgtctacatgat
    tcatggtcaaatgttggatga ttgactctgaatgtcggccaagattccgggagttggtgtctgaattctct
    ccgcatggccagggacccccagcgctttgtggtcatccagaatgagga cttgggcccagccagtcccttgt
    gacagcaccttctaccgctcactgc tggaggacgatgacatgggggacctggtggatgctgaggagtatct
    tg gtaccccagcagggcttcttctgtccagaccctgccccgggcgctggggg catggtccaccacaggcat
    ccgcagctcatctaccaggagtggcggtg gggacctgacactagggctggagccctctgaagaggaggcct
    cccagg tctccactggcaccctccgaaggggctggctccgatgtatttgatggtga cctgggaatgggggt
    cagccaaggggctgcaaagcctccccacacatg accccagccctctacagcggtacagtgaggaccccact
    agtacccctg ccctctgagactgatggctacgttgcccccctgacctgcagcccccagcc tgaatatgtgt
    aaccagccagatgttcggccccagcccccttcgcccc gagagggccctctgcctgctgcccgacctgctgt
    gtgccactctggaa agggccaagactctctccccagggaagaatggggtcgtcaaagacgtttt tgccttt
    tgggggtgccgtggagaaccccgagtacttgacaccccagg gaggagctgcccctcagccccaccctcctt
    cctgccttcagcccagcc ttcgacaacctctattactgggaccaggacccaccagagcggggggctcc act
    ccagcaccttcaaagggacacctacggcagagaacccagagtacc tgggtctggacgtgccagtgtgaact
    cagaaggccaagtccgcagaag cc

    1. Re:Spoiler Alert: by Anonymous Coward · · Score: 0

      What the hell? I must have stared at this pattern for 5 minutes and I still can't see the hidden picture! Stupid ASCII art!

    2. Re:Spoiler Alert: by dmatos · · Score: 1

      Have you tried focusing beyond the screen? That's the trick they tell you to use for those damn magic eye books.

      Of course, I'm officially stereoblind. Like 2% of the population, I'll never be able to see the schooner.

      --

      It may look like I'm doing nothing, but I'm actively waiting for my problems to go away.
      --Scott Adams
    3. Re:Spoiler Alert: by Anonymous Coward · · Score: 1, Insightful
      No, no, no! G is always paired with C, and A with T. "ACCCCT" is not valid DNA.

      Now get out of my comics shop.

    4. Re:Spoiler Alert: by GMontag451 · · Score: 4, Informative

      The pairs are for the two different helices in DNA, you don't actually write the other member of the pair when describing a DNA sequence. ACCCCT is perfectly fine DNA. It just has a complement (other side) of TGGGGA.

    5. Re:Spoiler Alert: by Anonymous Coward · · Score: 0

      Haha - I like it! That's hilarious! (It's a shame others don't appreciate your humour, and have modded you down.)

    6. Re:Spoiler Alert: by Anonymous Coward · · Score: 0

      It's not a schooner. It's a sailboat!

    7. Re:Spoiler Alert: by onco_p53 · · Score: 1

      For interest this sequence has 98% identity to:

      "Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)(ERBB2), mRNA"

      http://www.ncbi.nlm.nih.gov/blast/

    8. Re:Spoiler Alert: by dmatos · · Score: 1

      A schooner is a sailboat, stupid!

      --

      It may look like I'm doing nothing, but I'm actively waiting for my problems to go away.
      --Scott Adams
  16. DRUG LORD by Anonymous Coward · · Score: 0
  17. map with political, err patent boundaries? by anon+mouse-cow-aard · · Score: 1

    You know, bits that code for the liver are Monsanto's
    Fool around with kidney's and you will have to
    talk to Archer Daniels Midlands. Don't touch that follicle code, It's MIT's and their MEAN!

    four colors like a normal map. Have banner ads for
    biotech companies that work around patents, near the juiciest bits.

  18. Original Articles by SilverLuz · · Score: 3, Insightful

    Nature is providing most or all of the 'mouse edition' of their journal freely on their website, www.nature.com
    Some of the editorials read easily, but are a bit more meaty than little newsbites.

    I'm surprised this story didn't make the main page - do people not realize how important this data is? Having a mammalian genome available for comparative analyses with the human genome is a major landmark. The articles I've seen mostly talk about locating genes, but its locating other things - regulatory regions, non-coding RNA genes, and other functional non-protein-coding DNA - that's more difficult, but now possible, and, IMNSHO, much more exciting. Then again, I'm rather biased.

  19. You think that's exciting? by loosenut · · Score: 2

    Infant rat heads grafted onto adults' thighs

    I know what I want for xmas.

    This would be really cool if it wasn't so fucking disturbing.

  20. Corrections by AndyAMPohl · · Score: 1
    "Genetic code" refers to the mapping of codons to amino acids in the process of translation. mRNA -> proteins. This is a fairly universal code which was discovered in the 1960s. Mouse and human share the same code, but evolutionarily distant things like bacteria growing in weird climates may have some alternate mappings of codons

    Also. The mouse genome is still a draft stage. You can browse it here. The big news is the enormous mouse issue of Nature is about to hit the newsstands. This is a similar situation to the human genome. The Nature paper was published a few years ago, but the actual finished sequence isn't due until April, 2003.

    There's a few reasons for this.

    • Standard shotgun sequencing uses bacterial or yeast plasmids, cosmids. Whatever. The problem is that sometimes the sequenced DNA can get contaminated with bacterial and then show up in the assembled sequence.
    • Sequencing telomeres and centromeres of chromosomes is more difficult.
    • As the level of coverage goes up in each draft (how many times a contiguous region of a chromosome has been sequenced "covered") the likelihood that that region is correct goes up. I think what they want is 4X coverage usually genome-wide, so in the mean time they still have a "draft" good enough to work with.

    In any case, it is still exciting news. In many ways the mouse genome is more valuable than human, because ethics aren't really put into question when genetically engineering mice or throwing them into a blender.

    Andy

  21. Actually, side by side mapping is finished by MikeJ9919 · · Score: 3, Interesting

    Side by side mapping for the most recent build of the mouse genome (alignment dated in August 2002) is finished. It's only the question of analysis that's now important. The article in Nature (I'm one of the co-authors) explores a variety of different methods for explaining the differences between the human and the mouse genomes, and (hopefully) for eventually explaining (or at least predicting) the process of evolution at the genetic level. It's hard to explain how massive this project was...a lot of the information was spun of into papers in other journals simply because Nature couldn't fit it all.

    1. Re:Actually, side by side mapping is finished by SpaceLifeForm · · Score: 2

      More details available from McPaper

      --
      You are being MICROattacked, from various angles, in a SOFT manner.