Slashdot Mirror
When Good Patents Go Bad
will writes "The Washington Post has a good
review of patents in the information age. The insanity of the US
patent system has been chronicled on this site numerous times in the
past (for example, an
FTC report on patent policy, some patents for obvious applications
such as Microsoft
patenting local weather, and Amazon patenting inside
book searching). The Washington Post article does a good job
of overviewing IP issues today, why the current US patent systems
fails in the information age, and gives an example of patent
extortion. Excuse me while I patent
my DNA."
One aspect seems central to many of the patents which are generally accepted to be absurd or insane: they are patents on processes for selling goods or services rather than on the goods and services themselves or their means of production. There doesn't seem to be enough awareness of this discrepancy between these types of patents and ones which we consider to be reasonable. Online retailers such as Amazon, for example, may claim that they have two customer bases, book-buyers and advertisers, and that the website itself is a product for the advertisers, but in truth their real customers would seem to be the former....
Tim Berners-Lee must be kicking himself for not patenting the WWW. Or are there actually some decent altruistic people out there who want to make the world a better place?
When I am king, you will be first against the wall.
Comment removed based on user account deletion
Some ingenious ideas , need to be patented so that the inventor can reap the benefits of his hardwork. But inventions which leave us saying "f@#king DUH!", should seriously be quentioned.
What USofA needs is a better patent challanging system. and by challanging a patent I don't mean claim ownership of that patent, I mean demonstrate the use of that idea so commonly in public domain, that no one actually deserves the patent.
for the last time people, I am "frodo from middle eaRTH", not "middle eaST".
Seriously, that's a good example of the proper use of a patent - for ingenious hardware widgets. IP patents, on the other hand, are downright evil.
When I am king, you will be first against the wall.
There seems to be this attitude that the suffering of slaves prior to 1850 was something that only happened back then. That it has nothing to do with now, that we are more civilized, more modern, more mature, and more sophisticated. With it comes the arrogance that what happened then, means nothing now, that what happened there has no value here, that the great torment and suffering back then can safely be ignored now as we blow off history and all the values that go with it in terms of understanding, freedom, markets, property rights, and the information age.
Surely anyone who claimed that there is no incentive go grow cotton without "niggers" on the plantation would be considered a barbaric. But if someone claims that there is no incentive to create intellectual and knowledge works without copyrights and patents, then society calls them enlightened. If someone had said that the great wealth of America rested on slavery as a property right and the plantation system, they were a foolish idiot. But if someone says that the great wealth of societies in the information age rests on "Intellectual Property", then they are called wise. Anyone who says that slavery was about property rights and not control, is a liar. However, if they say that copyrights and patents are not about control, but "Intellectual Property" then they are considered trustworthy. How about - if you don't like slavery - don't own slaves, and if you don't like copyrights no one forces you to buy those creations. How about - if you don't believe in slavery, you must be an anarchist, if you don't believe in copyrights and patents you must be communist. How about - you are a thief if you free slaves from the plantation, you are a thief when you copy someones "Intellectual Property".
So why are we spoon-feed these poor logical explanations over and over again? Because, like the rapist who drugs his victim and gently penetrates her, rather than beat her and tear into her where all the scars, blood, and bruises can be seen. Like the assassin who befriends and mis-places his victims heart medications, rather than pull out a rifle and pop a bullet in the head. Copyrights and patents are the pinnacle of quiet violence. So seemingly innocent, so seemingly civilized and friendly, so hard to see and identify any direct evil, any direct consequence. After all, what could be less harmless then providing an incentive to artists and inventors, right? But do they really promote art - or just promote works that have the most hype rather than the most meaning and educational value? Do they really help inventors, or do they hinder collaboration and sharing in a way that would put a police state to shame?
Perhaps the old lady has none to blame when her patented diabetes medication is too expensive to afford anymore. Who can the workers blame when the proprietary technology they bet their career on becomes obsolete and it becomes ever harder to relearn from scratch as they get older. Who can a child in Africa blame when they are dying of AIDS, and there are no generics to treat it! Who do we blame when researchers seeking a cure for cancer encounter massive obstacles to sharing there individual research for fear that their peers will get one up on them, get a key patent, and lock them out! Who do our nations students blame when tabloids are pennies on the dollar, but textbooks dollars on the page! Who do we blame for Hollywood culture being such a failure, and so strongly influencing society in their own failed image.
As people die because patented medicines are too costly and alternatives too sparse, and the needy go without, not because of genuine shortage, but because artificial human made restrictions. Our government who is the enemy of overt violence, has become the friend of quiet violence. Our government who has organized world wars to protect our freedoms, now promotes a world order that will take them away. The democracy that has allowed us to fight for our rights with votes and politics rather than violence and bloodshed has now become
Here is the trouble I have. Suppose I come up with a piece of software that can perfectly transcribe english from speech to text - accents and all, right out of the box. Shouldn't that be worth a patent?
How about the guy with the patent on the blinking cursor? Great ideas, right? So, where does the line get drawn? Obviously, patenting something already in use is bad, but what about really obvious things that no one bothered to do yet?
For years, Ford had to pay a different company for a patent on the internal combustion engine. They literally had to wait for the patent to run out!
stuff |
If they are patenting "hey I figured out what strand GCACTCTGATCTGTCTATATGTGT does" it's garbage.
If, however, they figured out what sequence of nucleotides happens to build a molecular machine that does X (where X is something new) then a patent might be arguable. The *might* comes from the fact that I think they should patent the molecular machine, not the method of making it. After all, DNA is kind of like a programming language - it's a tool set for building molecular machines. You can't patent blueprints or schematics, so why would you be able to patent DNA? (I can't recall if blueprints are copyrightable though - I know that typically blueprints, etc. have a disclaimer that says "you can't build this without permission from the company that generated it" because the value is in *using* the blueprint, not having it. Usually. I'm sure there are caveats.
Well, that helped me calm down a little...
"There are a dozen opinions on a matter until you know the truth. Then there is only one." - CS Lewis (paraprhase)
It was a very clever strategy on the part of Acacia - first go after the porn folks (nobody would come to their defense), then the university and online education folks (no money to fight), then the broadcasters (already under siege by the trade associations), then the toolmakers. They probably could have been nipped in the bud if people had paid attention early on.
At this point, it's important to drag the big players into the fight - folks who are being sued by Acacia need to subsequently sue the tool vendors (Microsoft, Real, Apple, Macromedia) for selling them allegedly unlicensed patented technology.
3 figure salary? He must have had a lot of trouble finding NYC property he could afford.... What do you mean by "Open Source" in this context? Laws are discussed and documented in public in democracies. Like software, most people just don't care about the details :-(
I like the random politician idea, right up to the point where it just puts the power in civil servants' hands instead. They would be the persistent experts, so they would have influence out of all proportion to the random punters. Now, a randomly selected upper-house that occupies the current position of the Senate or the Lords in the UK, that sounds like a plan.
I find your analogy between there being no incentive without slaves and no incentive without copyright to be poorly thought out (or perhapse just poorly articulated).
:)
A more apt analogy for cotton with regards to copyright would be:
"There would be no incentive to grow cotton if no one would _buy_ cotton, because they could get it for free. "
I know that it isnt possible to get cotton for free, but you have to understand that it IS possible with regards to most copyrighted works.
Your slavery argument when applied to copyright is more accurately:
"If the _cost_ of creating copyrighted material went up significantly, there would be no incentive to create copyrighted material."
As you can see, both these statements are clearly incorrect, and I would say that your analogy bends the truth to make a point that isnt there. Your peice is clearly well written, but you should work on your analogies.
It is (obviously) not hard to find bad examples of software patents. But are there any good ones?
In my view, there should be only one rule: "Would X have been invented without the 20 years of protection from competition provided by patent law?"
There is absolutely no reason for society to allow patents for inventions that don't pass this simple test.
I think your essay does a real disservice to the argument against copyrights and patents.
The comparison to slavery pisses me off and it should everyone here. To put copyright/patent legislation on the same level of importance with human slavery is utterly immoral and academically incorrect. Not only does it reek of propaganda (in your next article, you might as well claim that Hitler would have supported patents), but they have zero to do with each other. From a purely economic perspective, slavery was about the confiscation of someone's income from one race to another. If anything, destroying copyrights would be about YOU confiscating income from ME. I may just as well claim that copyright destruction is the enslavement by the public of the creator of wisdom. There you go, now you're the slave master. How does it feel? Your argument based on slavery trivializes a significant human tragedy in order to make a terrible, invalid point.
95% of the substance of the essay is the narcissistic ramblings of a writer in love with his own wordage. I would hope folks here would be more intelligent consumers of information than to be persuaded by a piece of garbage wrapped up with a nice ribbon. This type of rhetoric does nothing more than alienate the 98% of folks who are sitting on the fence regarding this issue.
Hey if they can afford a Hummer then they certainly should not get a discount :)
My overall point is "ya sure it is a gimmick" but some similar gimmicks have been patented and they should not.
...patents. Before I get flamed, let me say that the article eludes to this, but doesn't quite make the case.
The whole purpose of the patent system was designed to provide an incentive(payment) for a company to willingly incrue the costs associated with the research and design of a new product. That incentive came in the form of a patent (guaranteed monopoly for 20 years) to recover the associated costs that went into research and design.
In software, although there are certainly costs incrued in the full-fledged development of a product from start-to-finish... aren't our current copyright laws sufficient protection on completed works? Even though some console games can cost millions to produce, are those millions really associated with research and design, or are they associated with actual coding, graphic art, music soundtracks, etc... ?
My argument is that there is no need for patents on software, since there is no detrimental impact on companies who innovate. In hardware, a company might spend a billion$ trying to develop a product before it can ever come to market -- that's a detrimental impact on that company's bottom line, and they should have a 20 year monopoly. If that company was not to receive that monopoly, in most cases, they would not have a necessary incentive to spend a billion$ on R&D.
Contrast that with software innovation... Does anyone REALLY BELIEVE that without software/internet patents, Amazon wouldn't have developed 1-click-shopping??? Of course they would have, because it didn't cost them anything extra to develop and it pays instant rewards in increased sales. Do you think for a second that we wouldn't have browser plug-ins without patents? Do you think for a second that we wouldn't have turbotax, halo, amazon, ebay, slashdot without patents? Of course we would! The question is what do we NOT have because of software patents. What companies are being shut-down, stifled, put out of business -- what REAL innovations are being stamped out because they might "infringe" on something as asinine as 1-click-shopping?
Everyone agrees that without industrial patents, we wouldn't have 1/10th the innovation in aerospace, electronics, mining, or environmental science... but without software/internet patents we'd have even MORE innovation than we have today.
-- I'd give my right arm to be ambidextrous
How long till that bubble bursts as well? Unless you're a company like Eolas, you don't build a business on software patents. They also don't really help, except if you are attacked by someone else for infringement on their patents (which again is not possible if there are no swpats in the first place). For a business to be succeed, it needs actual products, customers, etc, not some pieces of paper that let it appropriate some general principles when implemented on a computer.
There are several problems with this argument when applied to software patents, as nicely highlighted in the recent FTC study (the link is a summary to the swpat-related stuff, a link to the full study is available at the top of that page as well).First of all, a lot of software patents are simply business methods implemented in a computer program. By their very nature, if such business methods are put to use, they become public (since you use them to interact with the public).
Secondly, most companies forbid their employees from reading any patents, for the fear that it will result in them being sued for willful infringement (making them risk tripple damages and attorneys fees)! Besides, in general the developers can put very little of the patents to use because of all the legalese and the absence of source code.
As someone in the FTC study says "there's too much information and it's no longer meaningful".
Donate free food here