Gene Found That May Affect IQ in Males
Chowser writes to tell us the AZStarNet is running an article stating that North Carolina scientists claim to have identified a gene that affects IQ in males. The difference is apparently quite striking, with the average IQ difference between those that had the gene and those that didn't being approximately 20 points. From the article: "However, he stressed that the IQ results in his research were based on a group average; individual males carrying the gene version had a wide range of IQ scores. While females also can carry the variation, it does not appear to affect their IQ, he said."
300 10-year-olds from neighboring areas? Any variation in a sample that size is just signal noise. The genetic->IQ link has always been a contentious subject... This is only fuel for the fire.
Women are like electronics: you don't know how damaged they are until you try to turn them on.
The IQ tests aren't being used to identify the gene. The process is to administer the test, and then run a medical test to determine what genes are present. And the genetic tests run on the subjects are quite relaible. Once both tasks are done they simply correlate the IQ scores to the genes.
IQ tests are fine predictors of performance in many areas--people who score well on IQ tests tend to have much better performance at many real world tasks.
20 points is a huge difference. That's approximately the IQ gap between college graduates and non-college graduates in the US. It's more than one standard deviation in the IQ distribution.
IQ tests are _extremely_ reliable. The article doesn't mention which IQ test was administered, but if it was the Wechsler Intelligence Scale for Children (WISC) or the Stanford-Binet, those tests have fantastic psychometrics. Their reliability coefficients are in the .8 to .9 range, which is really, really good. These tests are in constant revision in order to maintain this superb reliability. I've read the technical manuals for both of these tests...you'd be hard-pressed to design a more reliable one.
I agree that looking at other populations is crucial, but from what I can tell, they haven't even determined whether this is the gene actually responsible for the observed correlation.
1. When looking at haplotypes, we see that genes travel together in chunks, and because someone has an alternate version of this gene, it could just mean that the haplotype is different. For example say the top 1/3 of chromosome #3 has 7 haplotypes. This means that when you look at populations from all over the world, you will see one of these 7 haplotypes, with 2-3 occuring in the vast majority of cases. On this haplotype there are multiple genes that travel together and recombine together so taht they stay "linked". The gene ACTUALLY affecting IQ could merely be closely linked in physical proximity to the gene they have identified. The genotypes observed in this study may just be markers for another as yet unidentified gene.
2. The fact that it affects caucasian males vs females suggest it is sex-linked and other populations with the gene would be similarly affected. HOWEVER, it is entirely possible that the observed gene is an uncommon phenotype that has not drifted throughout the species and doesn't even exist in other races/populations.
3. The gene in question codes for a growth factor receptor. Growth factor temporal expression dynamics are an interesting but complex subject, and the fact that they are looking only at 10 year olds presents another major problem. In brain development (or any development), decreased affinity for a ligand can alter the protein-binding curve such that more of the ligand (in this case the insulin-like growth factor) is needed to elicit the desired response, OR the ligand may fail to elicit the response because it "missed the train". There are different types of latencies across individuals, and increased developmental latency is a hallmark of the evolutionary nascent human brain, so it would not surprise me that there are many genetic variants of brain growth factors and receptors expressed during adolescence. Let's put it this way- there are two types of "malfunction"- A)you're supposed to meet up with your friends at 9 but you arrive at 10pm- your friends are pissed at you, but they waited for you, and the drunken revelry can continue as planned OR B) your flight was at 9pm, you missed it, too bad, do not pass go and do not collect 200 dollars.
In the case of this growth factor receptor, we have no idea whether the gene variant causes malfunction, slower reaction, or complete inactivation, or even increased activation. I would not be surprised if the observed IQ differences leveled out over the next 5 years, especially considering the sex-hormone charged brain differentation that occurs during puberty.
This article is pop fluff, and I would be wary of drawing any sort of conclusion from it.
Yes, yes.. That's very PC and all, but it looks like THAT gene does play a significant role.
From here
Jirtle said his assertion that the IGF2R gene affects IQ is bolstered by experiments in mice. When he and his colleagues disabled a copy of the gene in lab mice - an experiment intended to mimic humans who inherit the variant copy of the gene - they noticed that the male mice were slow learners on a maze test. Electrical recordings of the mice's brain tissue were also altered in a way that is consistent with slow learning.
I assure you, the strictest libertarians would prefer to let the market decide that outcome (as opposed to letting any one person or group of people dictate the 'correct' outcome).
rs_number|alleles|position (on chromosome 6)
rs8191692 C/T 160360652
rs2975115 C/G 160360684
rs2975116 C/G 160360687
rs8191704 A/G 160382749
rs11759563 C/T 160416104
rs8191746 C/T 160416109
rs8191753 A/G 160418673
rs8191754 C/G 160418735
rs8191758 A/G 160421034
rs8191763 C/T 160424152
rs1570070 A/G 160424389
rs13198308 C/T 160432052
rs8191776 A/C 160434644
rs6413489 A/G 160434696
rs894817 A/G 160434700
rs8191797 A/G 160437232
rs1050004 A/G 160437257
rs8191798 A/G 160437267
rs998075 C/T -160438689
rs6413491 A/G 160438720
rs8191808 C/G 160439921
rs8191809 A/G 160439953
rs8191810 A/G 160439956
rs8191819 A/G 160441967
rs8191820 C/T 160441987
rs8191840 C/T 160452138
rs8191842 C/T 160453003
rs8191843 A/G 160453053
rs8191844 C/G 160453340
rs2274850 C/G 160450541
rs2230043 A/C 160454948
rs8191859 A/G 160455901
rs8191860 A/G 160455961
rs2230048 A/T 160459759
rs8191869 A/G 160459815
rs8191881 C/T 160463358
rs8191886 A/G 160464245
rs2230044 A/G 160464245
rs629849 A/G 160464820
rs11552587 C/T -160465339
rs1050005 C/G 160465360
rs8191904 A/G 160471039
rs8191905 A/G 160471123
rs8191906 C/T 160471223
rs8191908 A/G 160471609
rs2230049 C/T 160471684
rs614754 C/G -160475610
rs1805075 A/G 160475618
rs8191933 C/T 160487883
rs3190229 C/T 160487892
rs1803989 C/T 160487892
rs8191955 C/T 160496427
rs8191956 C/T 160496750
rs8191957 C/T 160496859
rs8191958 A/G 160496868
rs8191959 A/G 160497049
rs8191960 -/ACAC 160497143
rs8191961 A/G 160497202
rs3832385 -/TTTG -160497316
rs8191962 -/ACAA 160497322
rs8191963 C/T 160497586
rs1050015 A/C 160497591
rs8191964 C/T 160497662
rs8191965 -/GCATGGCGTGGAGGAGGAGGGAGGCCGGGCGG 160497665
rs8191966 A/G 160497672
rs14531 G/T 160497919
(Sorry about the formatting; the lameness filter forced me to make it look like that.)
Here "C/T" in the alleles column means some people have C and other people have T. A minus sign indicates a deletion (the allele is an empty string). A negative position indicates that the reported alleles are relative to the compliment strand. (This happens if they get the strand wrong when they define it.)
You can look up population data for these genetic variations by rs number (sometimes categorized by distinct racial groups) at dbSNP. The locus in question is either one of these 66, or else the "smart/dumb" gene is a splice variant which is also likely- one of the versions has an exon that the other doesn't- which would mean that the locus is in a promoter region in one of the 47 introns. There are 603 variations in the introns. That would never get past the lameness filter.
The popularized crap on Google News is useless. I did a search on Google Scholar for "IGF2R Jirtle IQ" and found this:
Tissue-Specific Inactivation of Muri
brain development won't occur if people aren't _challenged_ to think.
t ic%22+iq
An illegitemate child named Isabelle was locked in a dark attic for years with her deaf and mute mother and no toys.
http://www.google.com/search?q=%22locked+in+an+at
She caught up with her peers within two years of being rescued and was found to have a normal IQ. Apparently her brain continued developing normally in the absence of intellectual stimulation in the dark attic.
Start with Googling for a definition of allele, to understand the concept.
If some gene-dependent trait is "positive" or not depends upon the environment. (See e.g. malaria resistance and red blood cells.)
In general, there are two things influencing wether a trait is on for males/females.
Karma: Excellent (My Karma? I wish...:-( )
How do you arrive at that figure? $5.15/hr @40hrs= $206. The employers tab for social security taxes is 6.25% of that, so add $13. Do employers pay a matching portion of the medicare tax, too? If so, add another $2-3. Now we're at $222. Where does the other $275 come from? It can't be health care costs, since we're only talking about what the law requires. Unemployment insurance? Required payments into a workman's comp fund? Maybe you can elaborate?
Got a reference handy? I may be reading this incorrectly, but Psychology Today published an article that appears to disagree with you.
"Weapons should be hardy rather than decorative" - Miyamoto Musashi
I think that goes for OS's too