Slashdot Mirror
Genetic Database Hits One Billion Entries
ChocSnorfler writes to tell us that the Sanger Institute is reporting that their Genetic Record Database has hit one billion entries, making it the world's largest. From the announcement: "The Trace Archive is a store of all the sequence data produced and published by the world scientific community, including the Sanger Institute's own prodigious output as a world-leading genomics institution. To grasp how much data is in the Archive, if it were printed out as a single line of text, it would stretch around the world more than 250 times. Printing it out on pages of A4 would produce a stack of paper two-and-a-half times as high as Mount Everest. The Archive is 22 Terabytes in size and doubling every ten months."
genetic information of organisms - mice, fish, flies, bacteria and, of course, humans... All the data are freely available to the world scientific community (http://trace.ensembl.org/) Sweet, now I can finally build myself that fleet of flying super monkeys I've always wanted!
Some dumbass is always printing 300 pages of documents and hogging the printer. Forchrissakes, just figure out what pages you need and print those! Asshole.
The amount of data here is really enormous. To put it in perspective, if you lined up 7143 blondes, the number of strands of hair present would approximately equal the number of entries in this database.
I could make this sentence wrap around the world a zillion times if I used 10^100 point text.
"To grasp how much data is in the Archive, if it were printed out as a single line of text, it would stretch around the world more than 250 times. Printing it out on pages of A4 would produce a stack of paper two-and-a-half times as high as Mount Everest. "
I have twice that much data on my 128k thumbdrive, if printed out in 72 point font size.
Anyone care to translate this into volkswagens, or libraries of congress?
if it were printed out as a single line of text, it would stretch around the world more than 250 times. Printing it out on pages of A4 would produce a stack of paper two-and-a-half times as high as Mount Everest
Did anybody else think "Wow, I've got a great idea for a mural for the space elevator!"
Anybody?
Uh, well, it's late...
--MarkusQ
Would somebody please torrent it?
This enormous archive will devour us all.. ARGHH!
-AlexC
Printing it out on pages of A4 would produce a stack of paper two-and-a-half times as high as Mount Everest.
You can't do that with ordinary A4 paper. You need to reinforce it on the sides at least so it won't tumble over. Plus, I doubt the paper would sit still with the high winds once it gets above a few thousand feet. Sheesh.
Something tells me a 22TB MS Access table just wouldn't cut it. :-P
This sig rocks the casbah.
Are they using the latest MSSQL 2005 beta 3?
I'm pretty sure storing humans on your hard drive is illegal.
It's better to vote for what you want and not get it than to vote for what you don't want and get it.
- E. Debs
More nerdly examples, please.
- It would require 100,000 liters of ink to write down all the 1's and 0's
- It would take 400 years to transmit it over a 14.4 kbps modem
* Requiring about 10 Giga Joules
- If each bit was encoded on a single hydrogen atom, the whold db would weight about 0.1 mg
- If ones are transmitted as a single (infrared) photon, it would take 0.01 Joules to transmit the whole db
* You could transmit it 100 times with the energy of a mouse trap
- It would require about one year for a million monkeys to type it in (without having to guess)
Opus: the Swiss army knife of audio codec
These people are obviously not aware that the standard unit of measurements for the press is Rhode Island and Texas. Without phrasing it in these units, I have no idea how much data that really is.
The world moves for love. It kneels before it in awe.
I'm not impressed. I already have genetic material all over my computer.
(Oops, did I just admit something bad?)
Printing it out on pages of A4 would produce a stack of paper two-and-a-half times as high as Mount Everest.
Tapping it out on morse code would take 10000 drummers 5 years!
Expressing it in smoke signals would burn 100 amazon rain forests!
Putting it in fortune cookies would require flour and sugar with the same approximate mass as the moon!
And sending it in semaphore would require every man, woman and child on the planet to signal nonstop with every flag ever made until the year 2010!
That's a lot of data.
I won't give away the ending, but my favorite part is:
ctattggacttggaatcggatattggacacttggaatcggata
Go FoxPro!
All your base (pairs) belong to us.
In the meantime, you can still get the genetic layouts of other animals on eDonkey. (groan)
Attack its weak point for massive damage!
Got a torrent?
I want to print it out to read off screen...