Human Genome Sequencing Completed

Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."

Comments

So now.

[AltGrendel]

Can we start the patent countdown clock?

Secret Project Complete

[FhnuZoag]

Now where's my +1 Talent in every base?

Would've been decoded sooner ...

[Anonymous Coward]

if God wouldn't have used LISP to encode the darn sequence in the first place

Re:Would've been decoded sooner ...

[Fjornir]

You thought wrong.

I was taught assembler
in my second year of school.
It's kinda like construction work --
with a toothpick for a tool.
So when I made my senior year,
I threw my code away,
And learned the way to program
that I still prefer today.

Now, some folks on the Internet
put their faith in C++.
They swear that it's so powerful,
it's what God used for us.
And maybe it lets mortals dredge
their objects from the C.
But I think that explains
why only God can make a tree.

For God wrote in Lisp code
When he filled the leaves with green.
The fractal flowers and recursive roots:
The most lovely hack I've seen.
And when I ponder snowflakes,
never finding two the same,
I know God likes a language
with its own four-letter name.

Now, I've used a SUN under Unix,
so I've seen what C can hold.
I've surfed for Perls, found what Fortran's for,
Got that Java stuff down cold.
Though the chance that I'd write COBOL code
is a SNOBOL's chance in Hell.
And I basically hate hieroglyphs,
so I won't use APL.

Now, God must know all these languages,
and a few I haven't named.
But the Lord made sure, when each sparrow falls,
that its flesh will be reclaimed.
And the Lord could not count grains of sand
with a 32-bit word.
Who knows where we would go to
if Lisp weren't what he preferred?

And God wrote in Lisp code
Every creature great and small.
Don't search the disk drive for man.c,
When the listing's on the wall.
And when I watch the lightning burn
Unbelievers to a crisp,
I know God had six days to work,
So he wrote it all in Lisp.

Yes, God had a deadline.
So he wrote it all in Lisp.

All credit to Julia Ecklar -- and (I believe) Heather Alexander who is singing the linked copy.

I'd like fries with that

[gentimjs]

I'll take my next kid with larger-than-average height, enhanced frontal lobes, a natural resistance to the polio virus, OH and dont forget the 20/10 vision!

Re:I'd like fries with that

[Fred_A]

It is being passed much more slowly though. Everyone knows that people with 20/10 vision have less FPS.

Re:I'd like fries with that

[Citizen of Earth]

Everyone knows that people with 20/10 vision have less FPS.

Dogs actually have a higher FPS perception than we have. OTOH, they've been known to eat their own poop. There's an efficiency/complexity tradeoff in neural computation systems.

Oblig.

[mk_is_here]

Scientists: All your base pair are belong to us!

Part of the sequence:

[GroeFaZ]

ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA

Re:Part of the sequence:

[KarmaOverDogma]

Dear sir(s)

You have posted parts of our patented human genome sequence without our prior authorization. We demand that you cease and decist this post and remove it immediatelty, or you will be hearing from our lawyers in short order.

Sincerely,

Genectics Mega Corp.

Re:Part of the sequence:

[ggvaidya]

ACTTTTTCGCGAGAGGAGAGTGAGT//todo:this should only return a positive values!AAAAAATTTCTATCTACTATCTACATATCATTACA/*warnin g we are kluding around the antique "arthropod" module, here there be bugs!*/AAAACTCTTATCTATTTATTCATCTATCATTCATCTATCATCT ACTACTATCTAATCTATACA//haha nice hackACTCTACTATAGATCGATGT

Re:First Chromosome

[PyrotekNX]

I always wondered where the movie GATTACA got it's title.

3,141 genes

[Iznogood]

pi * 1000 genes. Got to love those fun coincidences.

Re:3,141 genes

[gwayne]

That's no coincidence, it's the circle of life...

Re:3,141 genes

[Opportunist]

Superiority by having the bigger foot.

and then there was a two...!

[Anonymous Coward]

gtcatgcgatacgtaggcaaatcg2tgacggcagt

hmmm i guess its not as funny unless its binary

Re:First Chromosome

[Anonymous Coward]

Please don't spoil the ending.

How do they know it's a "gene"?

[jerometremblay]

How do they differentiate junk dna from genes?

I undestand that even if they don't know what a gene is doing, they can single it out from the rest of the dna. How do they do that?

What makes a gene a gene?

Re:First Chromosome

[LokiSteve]

You mean that for all His infinite intelligence, God couldn't come up with a decent compression algorithm?

Comment removed

[account_deleted]

Comment removed based on user account deletion

Re:First Chromosome

[tomhudson]

Well, now that they've sequenced the Genome, can sequencing the KeDE be far behind?

Slow

[Joebert]

At that rate, it must be a group made entirely of male scientists.

All I have to do is open my mouth once & any female can sequence my genes instantly.
Their accuracy is amazing, I always get the same conclusion, "You're an asshole !".

Re:Because it evolved

[fyngyrz]

Nonsense. We'd design it to have 32 bits to index the chromesomes, 32 bits to index the genes in each chromesome, and an alternate set of registers so you could quickly swap chromesomes for different tasks. You could clock it at any speed, or leave it static, and it'd never lose data. It'd be radiation hardened, low-power, erasable by ultraviolet, reprogramable by anything from dip switches to GHz pulse trains, internally and externally redundant, solar-powered, ecologically friendly, and involve a great deal of caffiene. Primary developmental needs would be met by carefully metered infusions of pizza.

However, because of technological limitations, only the bottom 4 bits of the gene index would actually be used, with the next 4 bits being set to zero by default, and the remaining 24 bits determining your average skin color.

Additionally, the 32 bit chromesome index would use 8 bits starting at the MSB, the next 8 bits would be reserved and set to zero, and the remaining 16 bits would be undefined, though later we'd find variations there gave rise to both creationist tendencies and division by zero, leading us towards a new design that is only 16 bits, but ran twice as fast and never divided by zero, or made up answers to questions without having known good data on the input side.

All other features would be put off for the beta version, because we'd have a little trouble with the alpha we didn't exactly anticipate.

Unfortunately, all advances gained by this leap in technology would be lost when hardware manufacturers forced new "quantum confusion" technology upon the geeks in a selfish race for more market share. Geeks fail to notice because they're too busy trying to get Genes 0.1 alpha through ANSI committee approval.

For maximum efficiency, this awesomely fast new technology requires light pipes for communications, however, in a legislative feat worthy of Maltheus himself, congress declares that production of light pipes within the boundaries of any state for use within the boundaries of that state represent interstate commerce of light paraphanalia, and so no one's going to be doing that, thank you. It's all part of the War on Bits. InSmell, primary manufacturer of light pipes in the USA, shuts all production down, fires half its workforce, and its stock goes up by a factor of four.

At this point, the only light-pipe architecture you can find comes from Japan, and the upper 24 bits of the gene index are all hard-coded to DDDDBB. It is expensive, but everyone buys it anyway. You can only run this hardware in Denmark. Floating (actually, more like drifting) point is emphasized, and virtual reality is experienced by all users, though that is not to say that it is the same virtual reality across the board.

In the meantime, US geeks invent open-source web 9.0, expend all their energy producing applications for it that have absolutely no merit whatsoever of any kind using the justly famous "Corundum on Wagon Ruts" technology to replace perfectly good desktop apps that already exist, but are really really cool because they can make almost any browser's "Joe" scripting language use all the memory in your computer... subsequently, geeks quietly go extinct while arguing if GPL or PD is the way to go for the open source path.

Re:3,141 genes?

[ltbarcly]

Yea, especially since you have exactly 3,141.59... genes.

And the distance from the base of the Great Pyramid is exactly twice the distance times 3/23 - the number of pounds in a dozen African Eliphants minus the sum of them... ... you get 666! Therefore, your genes are the antichrist. We should change public policy to better fit with this.

Re:Because it evolved

[zenmojodaddy]

Maybe in Arkansas...

Re:First Chromosome

[Anonymous Coward]

All your base pair belong to us