Human Genome Sequencing Completed
Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
Can we start the patent countdown clock?
The simple truth is that interstellar distances will not fit into the human imagination
- Douglas Adams
Now where's my +1 Talent in every base?
if God wouldn't have used LISP to encode the darn sequence in the first place
I'll take my next kid with larger-than-average height, enhanced frontal lobes, a natural resistance to the polio virus, OH and dont forget the 20/10 vision!
Scientists: All your base pair are belong to us!
ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA
The grass is always greener on the other side of the light cone.
I always wondered where the movie GATTACA got it's title.
pi * 1000 genes. Got to love those fun coincidences.
gtcatgcgatacgtaggcaaatcg2tgacggcagt
hmmm i guess its not as funny unless its binary
Please don't spoil the ending.
How do they differentiate junk dna from genes?
I undestand that even if they don't know what a gene is doing, they can single it out from the rest of the dna. How do they do that?
What makes a gene a gene?
You mean that for all His infinite intelligence, God couldn't come up with a decent compression algorithm?
END OF LINE.
Comment removed based on user account deletion
Well, now that they've sequenced the Genome, can sequencing the KeDE be far behind?
At that rate, it must be a group made entirely of male scientists.
All I have to do is open my mouth once & any female can sequence my genes instantly.
Their accuracy is amazing, I always get the same conclusion, "You're an asshole !".
Wanna fight ? Bend over, stick your head up your ass, and fight for air.
However, because of technological limitations, only the bottom 4 bits of the gene index would actually be used, with the next 4 bits being set to zero by default, and the remaining 24 bits determining your average skin color.
Additionally, the 32 bit chromesome index would use 8 bits starting at the MSB, the next 8 bits would be reserved and set to zero, and the remaining 16 bits would be undefined, though later we'd find variations there gave rise to both creationist tendencies and division by zero, leading us towards a new design that is only 16 bits, but ran twice as fast and never divided by zero, or made up answers to questions without having known good data on the input side.
All other features would be put off for the beta version, because we'd have a little trouble with the alpha we didn't exactly anticipate.
Unfortunately, all advances gained by this leap in technology would be lost when hardware manufacturers forced new "quantum confusion" technology upon the geeks in a selfish race for more market share. Geeks fail to notice because they're too busy trying to get Genes 0.1 alpha through ANSI committee approval.
For maximum efficiency, this awesomely fast new technology requires light pipes for communications, however, in a legislative feat worthy of Maltheus himself, congress declares that production of light pipes within the boundaries of any state for use within the boundaries of that state represent interstate commerce of light paraphanalia, and so no one's going to be doing that, thank you. It's all part of the War on Bits. InSmell, primary manufacturer of light pipes in the USA, shuts all production down, fires half its workforce, and its stock goes up by a factor of four.
At this point, the only light-pipe architecture you can find comes from Japan, and the upper 24 bits of the gene index are all hard-coded to DDDDBB. It is expensive, but everyone buys it anyway. You can only run this hardware in Denmark. Floating (actually, more like drifting) point is emphasized, and virtual reality is experienced by all users, though that is not to say that it is the same virtual reality across the board.
In the meantime, US geeks invent open-source web 9.0, expend all their energy producing applications for it that have absolutely no merit whatsoever of any kind using the justly famous "Corundum on Wagon Ruts" technology to replace perfectly good desktop apps that already exist, but are really really cool because they can make almost any browser's "Joe" scripting language use all the memory in your computer... subsequently, geeks quietly go extinct while arguing if GPL or PD is the way to go for the open source path.
I've fallen off your lawn, and I can't get up.
Yea, especially since you have exactly 3,141.59... genes.
... you get 666! Therefore, your genes are the antichrist. We should change public policy to better fit with this.
And the distance from the base of the Great Pyramid is exactly twice the distance times 3/23 - the number of pounds in a dozen African Eliphants minus the sum of them...
Maybe in Arkansas...
All your base pair belong to us