The Next X Prize
BlueCup writes "The X Prize Foundation, sponsor of a widely noted 2004 award for developing a reusable rocket suitable for private space travel, says it is now teaming with a wealthy Canadian geologist to offer $10 million to any team that can completely decode the genes of 100 people in 10 days. And that's not all. As an encore, the winning team will be paid $1 million more to decode another 100 people's genes, including a bevy of wealthy donors and celebrities. Already accepted for future decoding: Google Inc. co-founder Larry Page, Microsoft Corp. co-founder Paul G. Allen and former junk-bond king Michael Milken."
See if they can find the chair-throwing gene...
Ignore this signature. By order.
Too bad there is not a more direct way to sift through humanity to find examples of Homo Superior.
Where were you when the voynix came?
Maybe MY genes are worth decoding too, despite the fact that I'm not a C-level executive at a Fortune 500 company.
Welcome to the World of Tomorrow! Where only the obscenely rich can afford immortality for themselves and their families, and the rest of us are left out in the cold... we are called "invalids" with an icy, sneering indifference by the wealthy, geneticly gifted sons of Paul Allen and Larry Page.
Wake up people. There's a war on the horizon and the denying this technology to us proles us is going to be a major weapon.
they were encrypted.
They say the first thing to go is your penis. Well, it's either that or your brain. I forget which...
"And to sweeten the deal, we've hidden special codes somewhere the spleen section section of the genes of everyone on earth. Make sure to check these codes at www.mountaindew.com to win your free iTunes music: and one prize winner WILL RECEIVE A NEW NISSAN XTERRA!"
Where were you when the voynix came?
Hmmm... is there a gene (or a set of genes) responsible for, say, the desire to make huge amounts of money?
Or are there actual genes which determine how much introverted or extroverted a person is?
Of course, I don't think the rich and the famous are substantially different from the rest of you, but still... it's a valid question.
Ignore this signature. By order.
So a hundred wealth donors only had to put up 10,000 to get their genes decoded in 10 days? That means I can sign up for the 100 day process for only $1000, and the 1000 day process for just $100. I can wait three years.
Is the procedure to decode one person's genes really a pipeline with 100 stages, or are they basically asking competing groups to pay for many copies of the same hardware to produce the desired throughput?
I'm sponsoring the XXX prize for two women willing to accept my genetic code at the same time.
You just need to buy lot of 454 sequencing devices (http://www.454.com/) or Solexa http://www.solexa.com/wt/page/index and have big datacenter. Then you use those sequencers to re-sequence those 100 people and compare them with the reference human sequence. Big datacenter - You will need 30 Solexa devices and around 1000 TB data storage this is a nice task for Google datacenter.
how does one become a wealthy geologist?
Actually Sony's Gene Rights Management technology rootkits your own genes, so that if you attempt to copy Steve Allen's DNA without permission they can basically turn you into someone else.
My turnips listen for the soft cry of your love
Its still way down the line as far as cures. Because as they have found combinations of genes have other functions within the body. Hence "yes we found the gene for asthma!" but if they alter that gene it will have many affect to other functions. This is one of the current problems they have been trying to figure out. Yes its still a benefit but we still have many other obstacles.
They can decode my DNA for the sale price of $500K
"I think you know what I'm talkin' about, Mr. President; We're gonna kill us a mummy!" - Bruce Campbell as Elvis Presley
TO SURVIVE AT ALL are attending a In addition,
Now, where can I go to get my genes encrypted?
This tagline is copyrighted material. Please send $10 for an affordable replacement.
...would not take the encore--$1mil for the 100 extra.
They're trying to force 2 prizes in 1 here: (1) the ability to do the sequence of individuals en masse, (2) put a new/instant market and price cap on the invented tech from the get go.
First, why put a price cap on the new service at $10,000 a person, esp. for these wealthy individuals? It would be an artificial cap, for minimal gain. Second, they'd make more money from that same group of people with the "introductory price" when their tech comes out. If they are worried about proof to investors they they'd keep the price of the tech low (or get it there eventually), that's more easily proved later down the line without hampering their now/then present business prospects.
The point of the X Prize is for someone to come up with a cheaper/faster/easier way of doing it.
Just like the first X Prize. I mean you could have used a regular space shuttle to accomplish the goal but it would have enormous expense and probably not be very safe. Hell, you could have used a reusable capsule on top of Soyuz rockets for that matter. That wasn't the point of the contest though.
Basically you will want to accomplish this with somewhere around 10 million dollars (give or take a few 10 million) to make it even worth the effort.
Given you can't do crap for $10K these guys are getting a pretty good deal. As for our genetic differences, I've seen the pictures of Larry Page in a speedo and I am proud to say we have clear genetic differences.
Wouldn't that be the 'Y' prize? They had better make it take a while. There's only one left.
The obscure we see eventually. The completely obvious, it seems, takes longer. - Edward R. Murrow
I can see the value of decoding the genes of the wealthy, as it's often the case that they are smarter than those around them, thus that's how they got to where they're at. However, I fail to see the value in decoding the genes of celebrities.
This must be appeal to vanity, cause aside from the ones who are actually highly intelligent (see those who have degress from Yale, Harvard, Stanford, etc..) the rest probably contain no genetic value other than being attractive. Well...... I suppose it would be ok to decode Kate Beckinsale, Scarlett Johansson, Elisha Cuthbert and a few others, just for posterity's sake.
Ok, maybe its not a bad idea. Who decides on the celebrities....
Hmmm... is there a gene (or a set of genes) responsible for, say, the desire to make huge amounts of money?
I just wonder if we'll be able to isolate genes for sociopathy from the sample group.
I mean, Michael Milken, the Junk Bond King? I know he's done a lot of charity work since then, but he, like some other people on that list, got where he is through highly unethical (sociopathic?) business behavior.
If it's for-profit but free, you're not the customer -- you're the product (e.g., the Slashdot Beta's "audience").
I'm not an expert in the technical aspects, but it said that the Sanger sequencing (which I'm assuming provides the correct result) took 300 million dollars + 10 years. How will the verification process work?
Before this turns into a large nature vs. nurture argument, I thought I'd pipe in here with a really great paper that really throws a wrench into the argument.
In one of the largest Nature vs. Nurture shakeups, it was shown that the maternal behavior of the mother can cause epigenetic variations in the child that ultimately cause the child to grow up to become a nurturing mother or a non-nurturing mother (http://www.neurobio.ucla.edu/~lmp/Meaney.pdf ). This is one of the biggest breakthroughs in Neurobiology connecting specific epigenetic alterations to behavioral response (yes, there were controls, switching mothers/children, read the paper for the full details).
However, the genetic alterations here are not on the sequence level, but rather on the Epigenetic level (the state of the DNA). Therefore sequencing the genome of two identical twins who had different mothers (one nurturing, one non-nurturing), can lead to entirely different epigenetic levels, yet the sequences would be identical. The take home message here is that while the underlying sequence is important and full sequences will certainly help in the understanding of biology, the underlying state is just as important. This epigenetic variation is also one of the causes of cellular differentiation (stem cells, etc.), and also certain cancer types. In an effort to make my post slightly controversial, I'd go as far to say that a high throughput epigenetic snapshot is probably more important for understanding success in individuals than the underlying DNA sequence (however, it is my hope that a high-throughput sequencing approach would be a first step towards a high-throughput epigenetic approach, as they are tightly coupled in a sense)-- as well as providing great breakthroughs in other areas of biology (tissue regeneration, cancer treatement, etc.).
So, asides from the coolness factor, what are the real advantages of decoding your genes?
The original X-prize was to encourage development in an area without much activity and where it was small companies already doing the work. I'm sure Celera Genomics could win this prize more easily than anyone. What do they need with $10M? There are billions being suck into genomics research, why would anyone think another $10M is going to accomplish anything other than publicity?
Maybe TFA is more precise, or maybe it's more obvious to someone who does genetics, or maybe I'm tragically out of the loop, but what exactly does it mean to "decode" the genes of 100 humans? It seems like the real "decoding" would be to look at the ensemble of human genomes and match sequences and combinations of sequences in certain locations with specific phenotypes. That is, after all, the Holy Grail of genetic research isn't it? Given that information, looking at any given person's DNA and classifying their phenotype should be a more-or-less trivial task. Maybe it is the pure procedural/logistical problem of processing that much information in that amount of time that they are after?
m0nstr42.blogspot.com
My prediction is that someone creates a client similar to a folding@home client. They might offer a chance to get paid for your work if they happen to win. Seems to make sense to me.
Hobby Robotics
You had to learn the word gigabyte. Learn the word petabyte.
-Clio
Karma: Bad (mostly from not giving a fuck)
Blog: http://clintjcl.wordpress.com
"Zalgon, are you telling that no humans survived their planet's destruction?"
"Yes, sir. However, we were able to the complete genetic sequences of 100 individuals from the Terran datasphere before it collapsed. Apparently, it was some sort of time capsule effort on their part."
"Who were they? Scientists? Artists? Ooh! Sexy celebrities? Please tell me they were sexy celebrities, Zalgon..."
"Uh, no sir. According to my research, they were nerds. Very wealthy nerds."
"Ah, well, not all is lost. Make 10,000 clones of each wealthy nerd, put them to work in the sodium slave pits, and notify the Irony Counsel immediately. We should get a nice Poetic Justice bonus in our next paycycle!"
i read about this in popular science atleast a month ago...
AGGTACCCATGGTAAACCCGTGC...
Can I please have my money now ?
This sort of research really lays low the idea often trumpeted in the popular media that totally decoding the genome will immediately open the door to genetic therapies and cures for hereditary diseases. Between epigenetic modification of DNA and the existence of micro-RNA based expression control, we're finding that there's a lot more subtlety and intricacy in how genes work than we would have guessed 10-15 years ago.
atgactgactagctacacactcgatcatgcatatatttaaaacctactac cttaccttaaatttgggtactgagcgagaagctaactacgactacgcctc tagcatcgatcgtagcccatgctacgatgcatgcatcgatcgatcgatcg atcgatcgatcgatcgatgcactagcgcgcgtattatacggctagatcga tcgtagctagtcgatcgatgctacg
etc. etc. etc. I win!
Support Right To Repair Legislation.
OK, a prize for first-to-space-in-a-private-rocket sorta made sense. But this "give me 100 gene profiles right now" stuff? What possible use is it to be able to sequence that many individuals of a single species in a short time? The only practical value worth that kind of money is genetic profiling; sort of the Nazi eugenics approach to social purification, but on steroids, with none of that messy subjective stuff like whose brow sticks out the furthest, or nose is largest, or jaw is most rugged.
Look, just because we can doesn't mean we should. Lots of nasty sh1t lurking under the surface of something like this. The smart guy would walk away from it and never look back. But it will be those clever-but-in-a-stoopid-kinda-way guys that will belly up to the trough here. Build it and they will come; pretty soon parents-to-be will be genetically screening their potential offspring (at $5K a pop) for statistical genetic matches against... well Bill Gates and Warren Buffet I suppose... in the completely unrealistic expectation that if they can just (approximately) find out who their child is similar to genetically (by some arbitrary measure) then they can give them (somehow) the training (whatever they think that is) that the child needs to enjoy a similar life experience as that person. Same way they enrole their UNBORN children in prestigious private prep schools, thinking that they've now done their best for them and can relax for 18 years. WTF is the matter with people? 5 million years of evolution and THIS kinda of monkey see monkey do CR4P is all we have to show for it?!?
Oh wait, I changed my mind. Sequence me 100 people who know what the fsck they are doing with their lives.
=^..^= all your rodent are belong to us
Since they are often caught with their jeans down,
we might as well catch them with their genes down!
...before some Korean geek will release unde GPL and torrent Bill Gates' decoded genome. I'm eagerly waiting for the forks.
Sig
Google Inc. co-founder Larry Page, Microsoft Corp. co-founder Paul G. Allen and former junk-bond king Michael Milken
All of them are people that wouldn't be effected by insurance companies refusing to insure them because of potential future health problems.
Having to work for a living is the root of all evil.
I think they screwed up the constraint - its not time but chemical/enzyme costs that currenly make such a thing infeasible. Its not obvious that the costs of sequencing a genome is less then $10000K in raw materials, ignoring capital and labor constraints.
Immortality can have its limitations.
From Mao's 'Little Red Book':
"Political power grows out of the barrel of a gun."
Let me just get out my codebook...
Ok, so, here is what I decoded on the last 100 humans genes I looked at:
Organic
Yep, they all say the same thing. Gimme money.
...here it is - I've decoded them! Gimme the money!!
And, now - give me the next 100. No probs! Next one, please.