Bill To Outlaw Genetic Discrimination In US

Posted by kdawson on Sunday May 6, 2007 @07:54AM from the hands-off-my-genes dept.

fatduck sends us a brief note from New Scientist about the overwhelming passage in the US House of Representatives of the Genetic Information Nondiscrimination Act. As written, the bill would prohibit insurance companies from charging higher rates, and employers from discriminating in hiring, based on the results of genetic tests. A Boston Globe editorial notes that the bill has been held up in the Senate by the action of a single senator, who has an (outdated) objection based on his anti-abortion stance. President Bush has said he will sign the bill if it reaches his desk.

1 of 353 comments (clear)

Min score:

Reason:

Sort:

But would it forbid the AACS-LA from suing me by Anonymous Coward · 2007-05-06 08:48 · Score: -1, Offtopic

if I have the sequence AAGCTTGCACACAAAGGCTCCTCATGATCCGTTCGACAACCCCGTACCCG ATCCCGGAGATAAA somewhere in my DNA? How the hell am I supposed to take this out of every cell if they send me a takedown letter?