Bill To Outlaw Genetic Discrimination In US
fatduck sends us a brief note from New Scientist about the overwhelming passage in the US House of Representatives of the Genetic Information Nondiscrimination Act. As written, the bill would prohibit insurance companies from charging higher rates, and employers from discriminating in hiring, based on the results of genetic tests. A Boston Globe editorial notes that the bill has been held up in the Senate by the action of a single senator, who has an (outdated) objection based on his anti-abortion stance. President Bush has said he will sign the bill if it reaches his desk.
Now if they would only do something about flying car fuel efficiency standards.
I have the legendary cytosine-guanine combo going for me.
I fail to see why this is even an issue?
If Insurance Company X wants to discriminate that's fine and dandy. Big deal. Eventually some other insurance company will probably pick up the pace and find some way to offer these people insurance without outrageous prices, but what really is wrong here? It's like saying an insurance company can't charge people different rates based on sex.
It's just silly and another anti-discrimination agenda that makes people across both party lines and ideologies "feel good" about themselves when really, they're just making the economy less efficient.
the Political Inquirer
It's illegal to fire someone for trying to start a union at his place of work, but I got fired, anyway. They claimed I had quit.
Suddenly the burden of proof falls to the injured party and all the "big bad company" has to do is have some form of plausible denyability.
Big words, high ideals, changes nothing.
-Eldurbarn
(1) Who is the single senator? (whose name is apparently much more difficult to type than 'single senator')
(2) What makes his objection "outdated"? (For that matter, what *is* the objection?)
(3) What is he actually doing that's "holding up" the bill?
At least the main thrust of the article is expounded, but, geez, does this guy run around in a mask and a cape and do all his legislating at night, or why exactly did the submitter feel the need to leave his person and actions cloaked in mystery?
When things get complex, multiply by the complex conjugate.
After I already paid the guy to become a borrowed ladder and spent four weeks in leg braces to get taller. Thanks for nothing!
mirrorshades radio -- darkwave, industrial, futurepop, ebm.
... since there isn't enough in my current medical history to be used against me by insurance companies. Now I feel perfectly safe and secure since everyone knows every company adheres to each and every law no matter how specific.
What exactly qualifies as a genetic test? It says in the first article that it can be based on inherited illnesses. No tests need to be performed for that. Does this mean that I can get cheaper insurance even though I have a few body parts that women don't have? Those are genetic, AFAIK.
While I agree with the spirit of the bill, they need to do something better. Genetic information should be restricted medical information only. More than the fact that employers and insurers should not be allowed to discriminate based on the information, they shouldn't be allowed to have or see that information at all. Preventing them from making decisions based on the information is an area frought with grey areas that it runs the risk of being highly ineffective because in spite of the fact that there are many criteria by which insurers are prohibited to descriminate, they manage to skirt the matter by descriminating based on "similar" and statistically related information... you know, like zip codes instead of ethnicity?
The only way to truly prevent the problem from occuring is to make it illegal for them to house the information entirely. There's no grey area there. They either have it or not. Their databases either contains provisions for it or not. If they have it, you shouldn't even have to ask why. They should be fined, reprimanded and shut down until the information is proven to be purged from their databases and database record formats.
If someone suggests "but it's about identity!" I'd have to remind them that the SSN is already being illegally abused for that purpose... it's more than enough.
I'm in favor of this law, don't get me wrong, but I thought we'd been practicing "genetic discrimination" since life began.
How can I believe you when you tell me what I don't want to hear?
Shouldn't an airline be allowed to deny a pilot a job based on a profile that determines he's likely to suffer seizures? Should an insurance company have to carry and not charge extra for somebody whose genes are programmed to misfire when the applicant turns 35?
If I remember correctly there is already a law banning such discrimination based on genetics- signed during Clinton's administration.
Sigs are too short to say anything truly profound so read the above post instead.
1. We already allow insurance companies to perform complex calculations using family histories, lifestyle choices, income, living conditions etc. A whole industry is dedicated to the task of deciding as accurately as possible just who is likely to live long. I can already deduce with superb accuracy how long someone is likely to live. Conditions like heart disease, cancer, diabetes and hypertension can all be predicted rather well already. Genetics essentially is the icing on the cake, adding rare genetic conditions to the list of scannable factors. This is an incremental change, at best. Indeed, even with perfect genetic info, chance, will continue to play a major role. Hell, anyone can be hit by a car.
2. Perfect information about someone's future health might compromise the insurance system, but this is an institutional problem, not a moral one. (A weak analogy, I think, is webmaster vs. adblock. ) That two people, having vastly differing health prospects (one has undiagnosed Huntingtons, say) should pay similar premiums, is hardly an ethical judgment. It simply is how the industry operates now. Perhaps other ways exist? Life has existed before insurance, believe it or not. If indeed the function insurance fulfills is crucial under all situations, new ways of organizing it will emerge. We shouldn't seek to ossify technology just to protect status quo or a business model.
Once the genome is completely mapped, and every congenital defect is detectable, the life insurance industry will change completely. Even if they're not allowed to check, or base their rates on the results, you can bet insurance companies will take a quick look at what they can expect over the life of the policyholder. If I have a heart condition or a neurological defect that's going to kill me sometime between 55-70, that can really give the actuaries something to chew on. While not 100% certain of when I'll die, they know when I'm most likely to die, and the rest is all accident insurance.
A lot of auto insurance customers are up in arms about the "insurance score" that most US auto insurers use to determine part of your premiums. For those who don't know, the insurer runs a credit report to see how responsible you are with your finances. I guess the idea is that someone who doesn't pay their bills on time is most likely to commit fraud or be absent-minded and get into more accidents. Basing part of your life insurance premiums on a known portion of your long-term health history seems fairer to me than this.
I hope we do wind up with most of the genetic puzzle solved sometime in my life. We could wipe out most inherited conditions in 2 or 3 generations. A lot of people think it's too much like engineering a society, but I think it would be a great service to the species. There should be some limits, but who wouldn't want to get rid of conditions that produce people who are a burden on society? (retards, etc.)
So they're saying that charging type-1 diabetics more for health insurance is going to become illegal? And no longer will they be able to not hire men for work at rape crisis centers? And sperm banks will be required to accept donations from women? This sounds like socialized medicine via the back door.
(if you disagree, post)
don't you run the risk of people getting a prognosis for some horrific and debilitating disease and suddenly wanting the gold-plated health and disability plan, which the law would say has to be issued? Like going out and buying fire insurance for your burning house?
If we aren't allowed to "discriminate" on the basis of criteria we see fit, we are being denied the use of our most precious human asset: our neurons.
However, since the government insists on interfering in family matters by prohibiting euthanasia within the family setting -- the government thereby must pay the full costs of humane care for people thereby kept alive.
PS: I do not by the way consider it unethical to encourage my relatives to avail themselves of every benefit available to them under the law. I consider it unethical merely to fail to speak out against such laws given the benefits accruing to me indirectly via them. The same standards of behavior should hold for anyone who benefits from any form of "anti-discrimination" law.
Seastead this.
I had a horrible chill about Gattaca as soon as I read the title. http://www.imdb.com/title/tt0119177/
127.0.0.1
That right there killed any chance of it getting through Congress, so discussing the bill's effectiveness might be pointless. Also, there are claims that scientists have found a gene for alcoholism. What else might our genes do to us that insurance companies might want to know about? If, for example, there is a gene that makes you prone to highway hypnosis. That sends you likelihood of you being in a accident up and, if this bill is not passed, probably your insurance rates. Of course, you are still more likely to be in an accident and have your rates go up then.
blanketly outlawing discrimination based on ones genes seems such a no-brainer to me - it encompasses discrimination by race, sex, height, beauty, dumbness, maybe even sexual-orientation - forget all those other laws let's just call it what it is - if you're different because your genes are different you should be treated equally with everyone else
And when I get up before my Congregation and advocate the genetic improvement of the human race, I could be hauled off and jailed for thought crime just because I don't want my grandchildren to have six fingers and a nictating membrane!
This is a clear violation of my religious freedom, as well as my freedom of conscience.
(In case my ham-fisted irony is somehow lost on you: http://www.bloggernews.net/16539)
The good and new comes from no quarter where it is looked for, and is always something different from what is expected.
I'll just use my special getting high powers one more time...
This is the worst fucking idea I heard today on Slashdot!
Tsunami -- You can't bring a good wave down!
I was not familiar with the practice of legislative holds, so I googled it and found this description by the same senator that is holding up this bill, Tom Coburn. I thought others might find it interesting as well.
let's be consistent here - if you can't discriminate based on sex or race (both passed by genetic information) why discriminate based on some other genes?
It's like saying "we'll cover you for stuff on chromosome 11, but not chromosome 12"
Wouldn't this mean you couldn't refuse to hire my dog if he filled out an application? I think rover might finally pull his own weight.
Libertarian Leaning Political Discussion Forum.
if I have the sequence AAGCTTGCACACAAAGGCTCCTCATGATCCGTTCGACAACCCCGTACCCG ATCCCGGAGATAAA somewhere in my DNA? How the hell am I supposed to take this out of every cell if they send me a takedown letter?
If medical risks are not spread over a large enough population, there's effectively no insurance. The healthy with no medical costs spend a small amount of money to cover against catastrophy, and no one else can get insurance.
As for your pilot question, I see no reason why genetic screening of pilots wouldn't be allowed. There's a societal benefit to making sure medical coverage isn't denied to people, which allowing insurance companies to cherry-pick customers would violate.
Imagine an expensive condition with genetic markers, that no insurance company in their right financial mind would cover. Now, when that hypothetical disease starts to kill someone, without that insurance company on the hook to pay for the coverage, we have two choices: pay for the medical coverage as an entire society (who do you think pays for "uninsured" people going to hospitals?), or deny the patient coverage and let him die.
But an individual with some hypothetical condition that makes him prone to seizures has no right to be an airline pilot, and society has an obvious reason for not allowing him to be a pilot.
I wonder.
Let's say that eventually (or inevitably) we are going to be able to alter our genes with gene therapy.
Alter out genes to the point that we get a perfect genetic score card. Heck, offer social services that promulgate genetic repair.
Profiling would become less of an issue if you can change the profile, would it not?
This litigation seems prudent, but the balance between law and technological advancement needs to be watched carefully.
Read my Very Short "Stories"
What's the point of including insurance in this bill ?
Insurance was invented during a time when things really were left to chance, if genetics become usefull enough that insurance companies could use them to screen policicy applicants, couldn't that mean that insurance policies themselves would be obsolete ?
Wanna fight ? Bend over, stick your head up your ass, and fight for air.
Actually, although it is by no means an ethical duty of my family members to avoid passing on "defective" genes, the lines containing these genes are in-laws to my nuclear family and, yes, the Huntington gene is not being passed on -- although given the fact that the gene has been identified and may be amenable to editing even in the germ line in the near future renders it far less urgent that it not be passed on. The genetic susceptibility to aspergers is another matter entirely. Environmental triggers of autism spectrum have yet to be identified so it isn't reasonable to expect people with autism spectrum disorders to terminate their bloodlines simply because some corporations or governments have imposed environmental disaster upon them.
If you want people with genetic defects to stop having children then you should take your case up with Ashkenazi Jews who seem to have a preponderance of genetic disorders which are -- interestingly enough -- highly correlated with higher cognitive performance. You can tell them "correlation doesn't imply causation" or something to get them to disappear from the face of the earth... Go for it...
Seastead this.
Why does Slashdot let articles through like this? The submitter managed to put so much personal opinion in the 1st paragraph, its a wonder I just don't start reading fox news for unbiased, fair and balanced headlines....
There are genetic tests under development (and a few already available, like Huntington's) that will allow much earlier detection of some diseases. In many cases, this will allow earlier treatment, extending lives and probably reducing overall medical expenses. However, no one is going to be willing to take the tests if they're going to become uninsurable because of it.
This isn't so much about discrimination or allowing actuaries to do a good job as it is about letting new tests become useful at all. After all, the insurance company has no more useful information if you don't take the test than if they're not allowed to use the results.
So, I was tested, and I have a Y chromosome. You'd better give me cheaper car insurance at the XX rate, or I sue.
If you have some kind of condition that makes you probable to cardiac arrest under high stress conditions or low-g environments (astronauts?) and there is genetic screen process available for this shouldn't these institutions be allowed to test candidates for these? After all, they do eliminate people based on physical fitness, eyesight etc. which are all heavily influenced by genetics.
If someone has the genes for osteoporosis, early heart attacks, predisposition for cancer, why not let insurance companies charge more?
They charge more if you live in high crime areas, high storm areas, etc.
That would be an incentive for those with these predispositions to engage in preventative treatment to get lower rates.
But since most of these predispositions show increase along the lines of 10-40% of things that themselves are of minor risk, I doubt most would cause big increases in rates, though some would.
I would rather pay less if I do not pose those risks than pay for someone with a higher risk of some expensive condition. Especially if that someone is at risk for diabetes, hypertension, heart attack and obesity, yet still buys every meal at McDonald's. Those clueless dummies need to pay more for insurance, not be subsidized by the rest of us.
I'm not understanding your point here. Isn't the euthanasia thing a completely different issue? Personally, I'm for this law because it'll make it harder for employers who find out that someone is autistic to fire an autistic person without cause. There's enough bigotry against autistic people out there already, and anything making it more difficult to unjustly fire somebody is a good idea in my book. Sure, people on the autism spectrum, like all people, have their limits, but as long as the neurological limits only come into play where they affect job performance, this shouldn't be an issue. People can still be practical about who to employ, but can't discriminate unfairly - what's wrong with that?
I thought I'd have to do something crazy like steal the identity of an Olympic swimmer in a wheelchair because of my genetic heart condition. Phew.
http://twitter.com/OLDTELEGRAM
How can you determine who to hire without some form of discrmination?
Even if it's based on who is most intelligent, if we find that intelligence is a gene or set of genes, this law would not stop a determined employer from simply asking all potential employees for the genetic test results of SPECIFIC tests for SPECIFIC genes.
In the case of healthcare the situation is much more clear and makes more sense, but in hiring it's going to cause a LOT of lawsuits, confusions, and may end up in the supreme court.
Why should I have to hire you if you're genetically prone to stupidity? Or lazyness? Why can't I hire only smart motivated people?
It is what we try to do, but we cannot currently use genetic testing to determine your stupdiity or lazyness. We have to be clever and motivated ourselves and figure out less precise ways to predict your stupidity or your lazyness. It's what interviews are all about.
they always do.
Finally I stand the chance of getting a girl.
"I'm not your type? That's Genetic discrimination!"
My first reaction was "who gave him the authority to outlaw genetic discrimination?"
Reading the words, it says they cannot discriminate against a healthy person.
While that makes sense, the more heinous discriminate is doing so against a person once they are sick.
So once they ARE sick and HAVE a bad gene, then they can really ratchet up the premiums.
Since no one mentioned this, I expect that will be possible under this bill. (If this WAS included in the bill, THIS would be the true strength of the legislation)
The fact that so many representatives voted for it and the power of the insurance companies, make it likely that this, again, will be the case.
Bigotry based on economics, social, and/or genetic defaults/dejure is still a hate crime against humanity. When I look, at the USA Drug-War, Bush-War ..., I see bigotry on an obscenely grand scale resulting in crime and murder on the streets of the USA and Baghdad Iraq. The politicians and other wave a flag and thump a book as justification for wasting young lives and money, and the public accept it as truth and the American-way (pitiable).
...), politicians (Bush, Chaney ...), autocrats (Kissinger, Poindexter ...) , plutocrats (Wolfowitz, Gates ...) dogmatist/corporatist (many, many more ...) and their delusional self-serving followers are genetic parasitic afflictions upon all humanity. I stuck with a few of the better known USA names, but there are plenty more for US, EU, UN others globally.
The USA, in many ways, is far more primitive than the ideals pontificated by politicians/dogmatist for cash/votes.
Most national/international religious leaders (Falwell, Robertson
Unaccountable leaders are masters, and unrepresented people are slaves. How do US and EU fare?
Duh... then I suppose we should all dress in burkas. Just by looking at you anyone can obtain a lot of genetic information about you. Let's see, I'm too big to be a jockey, to small to be a basketball player, my voice has too much bass for a tenor, I have the wrong sex to be a model for lingerie.
No, let's face it, no matter how much your fairness principles may be hurt, ending *all* discrimination isn't practical. There are professions where genes appear to play a big role in determining aptitude, such as sports and music that I mentioned above.
Now, guess what? In which professions one can make a packet of money these days? Sports and music. Isn't it basically unfair that people make so much by playing basketball, which is a profession very few people can take because they aren't tall enough, while no one becomes a millionaire by being a nurse, plumber, baker, etc, etc?
They'd look at your code, see you were prone to x,y,z and not give you coverage for that. That's what they want to do, because it is around the only way they can remain profitable. And they would all do it if it wasn't outlawed, and outlawing it will kill off the industry pretty quick, a really serious catch 22..
What would happen is when you got affliction x,y or z, because you were prone to it, you'd have no coverage. You'd still be paying, but what you were most likely paying to be able to be covered for would *not* be covered, and NO, some other insurance company wouldn't cover it, they'd be total insane retards to do that and would go out of business soon. Well, perhaps they would, but your premiums would be out of this world.
ex-ah & l guy here, looked at the actuarial tables a lot, know how they function and how they think in those companies. They are in the business of taking your cash, and dropping the odds in their favor that they would have to shell any out. The old days of "pooling resources" to cover risks are way over, medical costs now are just way too high. They take your cash and then invest it, your (everyone "your's" in the coverage plan) premium payments barely cover sales commission and office expenses, they do NOT cover claims, not even close. It's roughly akin economically to magazine or newspaper subscriptions, your payment doesn't make them any money, barely covers costs, the ads make them their money.
If the insurance companies were forced to cover pre existing conditions-which a genetic defect would be, they would just close shop, go bankrupt, go do something else. It'll happen too, eventually, only the most rich will have private coverage. If you notice, a lot of these companies are stopping (or trying to curtail or stop) covering hurricanes and houses-it just doesn't pay, and living in a flimsy house on the coast is a "pre existing condition". The ones that are maintaining coverage are upping rates considerably and really giving a critical eye to how things are built. They haven't even come close to paying off the katrina and rita claims yet, tons are still under litigation. One more category 5 and kiss that action good bye, won't be a one of them cover homes on the coast unless the yearly premium is a huge chunk of the assessed value.
Same thing would happen if they are forced to cover genetic pre existing FUBARs. there is no cheap "market work around" for that, it is un-possible to charge enough premium to cover hundreds of thousands of probable expenses.
And that's why rates are so high now, they are trying to do that, and even with rate increases costs are still going up faster. It is going to implode some time and crash, inevitable now.
Of course congress will vote against it, make it illegal, etc, all it will do is prolong them going out of business. A politician would be defeated next election if he voted against it, they aren't stupid, but that won't change economic reality either.
The only way to avoid this is to outlaw the tests completely, literally ban them. and even that would only prolong the length of time that medical insurers are around, costs are just too high now.
But..... Dey Terk ERRR JERRRBSSS!
Hit the point. Insurances are businesses and should be treated as such.
You must admit that evolution is guided by selection, and why should we not cure ourselves using positive eugenics?
Liberal Eugenics/BioLibertarianism.
The problem is NEGATIVE EUGENICS, not POSITIVE EUGENICS. Positive Eugenics is simply selecting/mating intelleently, we can call it intelligent selection. It also includes screening fetuses in labs for diseases, and designer babies.
Then you have NEGATIVE EUGENICS, which is the abortion, and the sterilization and it gets more violent up to the point of genocides.
Positive Eugenics simply encourages intelligent people to have more kids than less intelligent people, resulting in more intelligent people. I don't see how this is wrong or even unnatural.
But let's debate it, lets debate positive eugenics and transhumanism. And if the only reason people are against it is because of the results of negative eugenics, well lets debate that too.
Better Babies
The problem with the bioconservative view is simple, it's not working.
It's not guarentee that biolibertarianism will work better, but it's more liberty/options than we have now.
That's the magic number, no?
What?
"Of course, it's illegal to discriminate, "genoism" it's called, but no one takes the law seriously. If you refuse to disclose they can always take a sample from a door handle or a handshake, even the saliva on your application form. If in doubt a legal drug test can just as easily become an illegal peek at your future in the company." - Gattaca
You can run but you can't hide, except, apparently, along the Afghan-Pakistani border.
Suppose I do not have any of these genetic risks. Suppose that I am celibate and therefore do not worry about aids. Suppose I do not wish to subsidize those who are subject to these risks. Can I buy insurance offshore, in say, London, excluding AIDS and allowing genetic tests, to get a lower rate? If I can, and enough people find out about it, it will effectively nullify this law and other "anti-discrimination" laws.
Too many people look at insurnace as a charity, and that everyone should be entitled somehow to cheap insurance. That's not what it is. There are two reasons to take out insurance. (1) if you believe the odds of cashing in on policy x the value of the policy exceeds the cost of the loss x the chance of the loss, or (2) if the harm caused by the event uninsured is unacceptable regardless of the low odds of it occurring. We take out auto insurance for the second reason, not because we believe we are going to run into someone, but because they could sue us for $2M and that would financially ruin us. The insurance companies carefully calculate the odds for the first situation, and you can bet every penny that they have determined that statistically they will come out ahead. This is how they determine the cost of policies, and this is why they need as much information on the details of the insured before they can come up with a policy cost. Buying insurance for this reason is like gambling... the house always wins. The margin may be low, but they DO always win in the end.
If you go into a policy with a "prior condition" that changes the odds dramatically, and they have to adjust the cost of your policy accordingly to keep in the black on the average. This is not unexpected and not unfair. If they are fairly sure they are going to have to pay out on you, your rates are higher because on the average, your payout will be higher than their average customer. The rest of their customers do not want to have to pay for your increased risk
Of course with unknown preexisting conditions like say, a congenitcal heart defect, they won't win that bet, but they can't know. So they raise *everyone's* rates a hair to make up for the unknown.
What these ppl here want to do is to take what should be a higher policy rate for them, and dump it onto all the rest of us, a little bit for everyone. That's NOT how it's supposed to work, and I really don't feel like helping you to pay for your insurance policy.
IMHO, insurance companies should be allowed to conduct any test they want on you. Companies with more tests or more invasitve tests will get less customers so free market will keep the abuses in check. If you don't want to submit to tests, you will probably have to get a different, more expensive policy, and that is to be expected. Though if you pass their tests you get a lower rate than you would have otherwise. Fail the tests and owell, high rates. Quit crying, it's not their fault, that's how life works. Go blame god or something, don't hike MY rates.
I work for the Department of Redundancy Department.
After all, if I'm cursed to have a Y chromosome why should I pay more for life insurance, just because most other people with Y chromosomes die a few years before those people without it?
How about behavior-related insurance, like driving? If there's some genetic factor that is known to cause driving behavior that leads to a higher rate of accidents, can an insurance company charge new drivers with that gene more for insurance before they have their first wreck or does it have to wait until they've wrecked their way into the high-risk category? Bear in mind, auto insurance companies already charge higher rates for young drivers with the genetic factor known as "being male," even if their record is spotless.
Knowledge is how to play a game, intelligence is how to win, wisdom is knowing what game to play.
Discrimination is choice / having an opinion. It may be a dumb choice / opinion or a smart one - but that is irrelevant. By saying people aren't allowed to discriminate, you're saying that they shouldn't be allowed to make choices or have their own opinions and instead should be making the "choice" (or have the "opinion") of whatever group is creating the guidelines by which people should operate.
of tres uber cool posters. :D
--- Grow a pair, liberals... stop letting the Republicans bully you!
As written, the bill would prohibit insurance companies from charging higher rates, and employers from discriminating in hiring, based on the results of genetic tests.
Isn't homosexuality genetic? Or has that not been explicitly traced to a specific set of genes?
!#@%*)anks for hanging up the phone, dear.
No your insurance as a Man will be more expensive. Men die at a younger age hence Life Insurance more expensive. Motoring Insurance for men is more expensive as men take more risks. Not sure about healthcare costs which would be the only other Insurance that may have different rate for Males and Females.
Okay, I agree with the employers thing... it's in line with our current anti-descrimination laws, and on that basis I'll accept it.
.. if your mother is 5 times less likely to crash her car than I, why shouldn't she be paying 1/5th of what I do in insurance.
But Insurance?? Really??
I pay more on my car insurance because I am a Male who is under 25. (well I did until I turned 25)... so that would be in violation of both age and sex descrimination laws wouldn't it??
Insurance works on statistics... as a <25 year old Male, I am statically more likely to act like an idiot and crash my car.. so, chances are I pay more insurance than your mother would.
This is 'fair'
So... if we move onto health insurance, and you have a genetic predispisotion towards obesity, high blood pressure and diabeties you are 4 times more likely to cost the health system more money than a healthy, young male. Tell me why I should be paying the same health insurance premium as you?
I'm not supposed to pay special attention to certain people who lack Y chromosomes? I predict much confusion in my future sex life.
"Hey, where's your vagina? And what's this weird thing?"
"Sorry, dude, I should have told you at the bar: I'm genetically deficient."
Al Pacino has been behind this since the 1970s... I'll never forget the time when, during an impassioned speach in front of a bank in Brooklyn, he yelled "GATTACA!!! GATTACA!! REMEMBER GATTACA?!?"
This sig is false.
If car insurance was outlawed our transportation systems would become safer .If we outlawed health insurance our ability to stay healthy would increase. Insurance has crippled our society.It has turned our tranportation system into a poluting demolition derby and the healthcare system into a money pit.Humanity as a whole needs to learn that fixing problems before they become critical uses less energy.The money lost in the bookie insurance pyramid scam, should have been spent on improving these systems.
You have no clue how insurance works, do you?
Okay, let's take zip codes as an example, since you mention it. Now I can't discriminate by region, so there is no reason for someone not to live in a higher insurance risk area for natural disasters, thus raising the rates for the entire country. Whoops, I can't even reduce my risk in a state that is a high insurance risk, because I can't charge a differential premium.
Whoops, also can't charge a differential premium for auto insurance based on your risk of an accident inferred from where you live. Also can't charge a differential premium for males and females (thus dramatically raising the rates for a lower risk group--men then buy better insurance given that they are more likely to have an accident, which raises the outlays for the company, thus further raising the average required insurance rates for everyone above what they would be otherwise).
Integrate Keynote and LaTeX
read it Neo Eugenics
What if we prove sexuality is genetic. Does that this would prevent discrimination based on sexual orientation?
What about other issues -- such as a disposition to being late. Or having trouble socializing with others because of a genetic psychological problem? Is the bill that far reaching? If we can prove some trait that would otherwise cost us a job is "genetic" we get it anyway?
"That which does not kill us makes us stranger." -Trevor Goodchild
[wild speculation]
The Bill probably does not, however, prevent an insurance company from saying "Oh, we see you have a genetic predisposition for cancer, so therefore if you ever get cancer, it will be a pre-existing condition and will not be covered." So naturally, the insurance company won't mind not charging higher rates because there is nothing in this bill preventing them excluding whatever illness you DNA says you might get some day. The Bill probably also contains language that makes collecting DNA without your knowledge or consent perfectly acceptable.
[/wild speculation]
This is why I pay for routine care and maintenance in cash out of pocket, with a doctor that is a friend of mine. The blood test company gets a vial with the name "John Doe" on it.
Can I buy insurance offshore, in say, London, excluding AIDS and allowing genetic tests, to get a lower rate?
In a free economy, yes.
However, in the US, it is illegal for individuals to buy healthcare goods and services in the global free market.
The repercussions of a system where insurance companies have access to individuals' DNA would be profound in a negative sense. No one is perfect - not even slashdotters. We *all* have our own unique "predispositions" to hundreds if not thousands of "flaws", many of which have yet to be "discovered". The definition of what even constitutes a genetic flaw may be unclear as well. Is having the gene for sickle cell anemia in parts of the globe where malaria is common a desired trait (increased immunity to malaria) or is it a flaw? Is it better to have the gene for the disorder and be more immune to malaria or is it better to not have the gene and be more likely to contract the disease someday? Many of the comments in this thread come across as arrogant and naive. Can we all be sure of how the dice have been rolled for us? How many of you have actually ever had your DNA scanned for genetic flaws? Just because you may "think" you are "healthy" today does not mean that the hypothetical analysis of your DNA tomorrow won't allow the world to label you as a potential colon cancer and diabetes risk or worse for the rest of your lives. I don't think anyone in their right mind would want to be subject to that and I don't think anyone has much to gain by allowing insurance companies access to this type of information. It's a dangerous can of worms best avoided at all costs.
homosexualtiy,
poverty,
medical care,
education,
and the government would be obligated to fix... everything...
Insurance companies have done well over the past century. Look at the largest buildings in any city in America, if it isn't a bank, it's an insurance company. Here is how it works:
1) Convince people they need insurance to cover the cost X of Service S.
2) Insured people can now afford to pay more so provider charges X+Y for service S.
3) Rising cost of (X+Y) means people can no longer afford service S so they must buy more insurance.
4) ??? Profit
5) goto step 1
Insurance companies don't need the ??? step and they don't need all of the advantages they've been able to buy from congressional and state representatives including:
1) Require that everyone buys insurance (I'd love to see a law requiring everyone to buy my company's products.)
2) Require that everyone buys extra insurance to cover those who break law 1.
3) Don't sell insurance to those who are likely to collect. (e.g. Don't sell earthquake insurance in earthquake zones or flood insurance in flood zones) Instead, let the federal government create a "federal flood insurance" or go ahead and sell disaster insurance in if a disaster occurs, file chapter 11 bankruptcy and leave town fast!
4) Don't provide medical insurance for those with medical conditions. (e.g. if there is ANY gap in insurance coverage due to a job loss or inability to pay COBRA, you will be considered a new customer by all insurance companies and your condition (diabetes, high cholesterol, high blood pressure) will be considered a prexisting condition. If you can get coverage at all, you'll be paying upwards of $2000/month.
Example, someone I know has a child with diabetes. A false workplace claim by a compulsive lier cost him his almost decade long career and corporate health insurance coverage. Every health insurance companies he has spoken told him that they could cover his family except for the child with diabetes.
I am in support of this bill. It will help stop more discrimination and the abuse of genetic information. Mscsrrr.com
The creator of $100,000 monthly for life system. http://www.secret33.com/home-based-business-progr
The exemption of genetic information obtained from "an embryo or fetus" makes no sense. Why should insurers be allowed to raise rates, or employers be allowed to reject or fire a worker, just because a fetus the worker is carrying might have genetic flaws?
The exemption might even make fetuses the targets of medically unnecessary genetic testing, which could result in more miscarriages and induced birth defects.
The law does not apply to abortion providers at all. I see no reason for this fetal exemption.
Logic starting from a flawed premise is a false argument.
... you may be a bigot if you consider yourself more important (in any way) than others.
... there ain't no way to justify hate and bigotry with religious, political, or economic status/discrimination.
Dogmatically (flawed premise) your logic applies to what?
Discrimination when harmfully applied to other people is hate and bigotry.
Here's your sign
Stop, don't reply
!HAVEFUN!
Unaccountable leaders are masters, and unrepresented people are slaves. How do US and EU fare?
Insurance companies are quite highly regulated already. There is a tradeoff naturally, and the goal needs to be to get as many people insured profitably by insurance companies as possible.
Like car insurance, having everyone covered by medical insurance is good for everyone. Suppose you are hit by an uninsured driver and a large amount of damage is caused. If this is a risk that your insurnace company has to meet, every customer of that insurance company is paying for the guy's failure to get insurance. In short every uninsured driver on the road drives up insurance rates for the rest of us.
Same with health insurance. The poor man's health insurance is called "the bankrupcy court." Every uninsured person drives up medical expenses which they cannot pay, and hence the hospitals have to pass on to the rest of us. This means that our insurance rates go up for each person that cannot pay. Also because those people are not getting regular preventative care, illnesses are usually diagnosed when they are far more expensive to treat.
So..... So you want to be paying more on your health insurance because the guy is insured? Or do you want to be paying more on your health insurance because the hospital cannot collect and has to pass on the cost to your insurance company?
I see very little difference, really.
LedgerSMB: Open source Accounting/ERP
There is a discussion on this topic at the huffington post
Read it and understand the topic a bit and then post a response.
Huffington Post Debate
the risk doesn't go away. The only way to make it go away is to make sure people pay for their medical care in advance or don't get it.
Don't have insurance? If you get a heart attack, no treatment until you pay.
Even if you have insurance, no treatment until that can be verified. If you die and did have insurance after all, tough luck. This can only work if this is not considered malpractice (which it is at the moment).
On the other hand, survival rates even for the insured from such events would go down along with the costs to everyone involved. And I don't think anyone would seriously consider that to be a good result.
The way the system works at the moment is that people are legally entitled to care for which they cannot pay at the moment. This means that uninsured people get to use the bankrupcy system as their insurance of last resort. Because these people cannot afford regular medical care, they don't get the early diagnosis, and illnesses are diagnosed when they are more progressed and far more expensive to treat. Hence even after bankrupcy procedings, we get stuck with a larger bill for hospital expenses, and
A more intelligent solution would be to try to move to a system where everyone has some insurance at least for basic preventative care. Maybe the government should provide such insurance. Maybe not. But it is the only way to reduce the financial risk to all insurance companies.
In short, any care given has to be paid for. Those who can pay do. Those who can't pay get their care paid for by those who can.
LedgerSMB: Open source Accounting/ERP
This is clearly unconstitutional. No where in the US Constitution (Article I, Section 8) does it authorize the Congress to set insurance rates, regulate insurance, provide health care, or health insurance. On those grounds alone it should be canned.
Also anytime the government intervenes in the marketplace, it's bad for the marketplace; consumers and sellers alike.
Libertas in infinitum
"Discrimination when harmfully applied to other people is hate and bigotry."
... you may be a bigot if you consider yourself more important (in any way) than others."
So, along with wanting to eliminate choices / opinions that you don't approve of, you want to eliminate emotions you don't approve of as well? Also, unless you're robbing / attacking someone, you are NOT harming them. Saying "sorry, you're German" and not hiring them is NOT harming a person, despite what your collectivist delusions will tell you.
"Here's your sign
You mean considering yourself so important that you should be in control of what choices / opinions / emotions people are allowed to have? =)