Genome of DNA Pioneer Is Deciphered
unchiujar writes "The New York Times reports that the full genome of James D. Watson, one of the discoverers of the structure of DNA in 1953, has been deciphered, marking what some scientists believe is the gateway to an impending era of personalized genomic medicine. A copy of his genome, recorded on a pair of DVDs, was presented to Dr. Watson on Thursday in a ceremony in Houston by Richard Gibbs, director of the Human Genome Sequencing Center at the Baylor College of Medicine, and by Jonathan Rothberg, founder of the company 454 Life Sciences. 'The first two genome sequences belonging to individuals are now being made available to researchers within a few days of each other. One is Dr. Watson's and the other belongs to J. Craig Venter, who as president of the Celera Corporation started a human genome project in competition with the government. Dr. Venter left Celera after producing only a draft version of a genome, his own, in 2001, which the company did no further work on. He has now brought his genome to completion at his own institute in Rockville, Md., and deposited it last week in GenBank, a public DNA database, he said.'"
Torrent pls?
However, Dr. Watson was told that he could not use his DNA, as it had been patented by the company and any use of his own DNA without proper permission would lead to serious legal consequences...
Cum catapultae proscriptae erunt tum soli proscripti catapultas habebunt
it's okay, linus. we appreciate your input.
Oh oh, I hope they double checked the electrical generators at Genbank. If there's a blackout and the frogs get out of the neighbouring lab and mate with Watson's and Rothberg's DNA, we'll soon have a huge Watsosaurus chasing chicken sized Rothoraptors all over North America. Personally, I'm gonna sell my home, buy a Winnabago and settle down right next to the Grand Canyon, the monsters will never find me there!
I would assume that combinations which result in your brain being outside of your body or having five lungs and the liver of a titmouse, would be a pretty strong restriction.
IOU one (1) signature
so you could fit almost 6 full humans on a DVD.
Only six? With lossy compression, you could do significantly better, as long as you don't mind all your offspring being funny-but-similar-looking lactose-intolerant non-deterministic sociopathic freaks.
it's a blue bright blue Saturday hey hey
>gnl|ti|1741299339 name:1094373133425 mate:1742401149a aaaagtttgggttatttttattgtgaaactgttggggttttctgcacatt ctctagatacaagacccttaccagatttatgtgtgggagtatcccaccca ttctgaattgtgtccctttgtcttcctcatggtgtgcttaatcgttattt aacacttaaccatttttttatggctagtgcttttagccataaagtcctaa gaaatcttttcctacctcaaggtgacaaagatactctcctctgttctatt tttcatttttatattgtacacaacacttaaaaaataagtctaagtgttac tagctgagaaataccagaaaacaacttgcataaatgctgaaatcgaattg ctacccctattttggattgaaatgaatttgaagggggaagaatgtcacag ttactttagcctcattttctagcactggaactctaagtggacaggagtga aaggaactttatggtgaaatattttgagaaatataaaatatctttgtgta tcttggggtgtctttgactagcctgttgggccagtgaggcaggaactgcc ttctctctgcatggttagtgcatggctgtggtgtggaaggtttggactcg aatgctgagctcgtgggcagacggacaggcagctggaagtaaagacgtgc cctccattctaggctgggaggaactgatgagagctgtgattctgcaggct gcctccctctggagatggcactgagatctctctcagccagggtcccagag ccagttgatgtctgtgttgagtctactttaaagacataaaatgccccctt tcttttctttctttcttccgtttttttattttttttttttttgttataaa agacagagtctcgctctgttgcccaggctagagtgcagtggtgtgatctc gggtcactgtgaactccgcctccggatcacaccattctccctccctcaca ctccagagtagctgggactacagtgcccgccaccgccgcccgactaattt tgt
gttgaaatgggacgttgatggggtgatgtctgttcagtcttcgctgttt
Gesundheit.
Hey, just patent 'em all and the whole world belongs to you!
We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
Now we clone Dr. Watson, place his infant clone in a fake city set at the time of his birth, and see if he will grow up to make the same discoveries.
/.! All posts are reposts!
:)
Or did that already happen? Are we part of the simulation, doomed to ever repeat our part in the story of Watson's life? It's like that Groundhog's Day movie on
Sorry, I'm very tired...
I'm pretty certain most people don't want to see their very own "making of" documentaries...