Slashdot Mirror


Genome of DNA Pioneer Is Deciphered

unchiujar writes "The New York Times reports that the full genome of James D. Watson, one of the discoverers of the structure of DNA in 1953, has been deciphered, marking what some scientists believe is the gateway to an impending era of personalized genomic medicine. A copy of his genome, recorded on a pair of DVDs, was presented to Dr. Watson on Thursday in a ceremony in Houston by Richard Gibbs, director of the Human Genome Sequencing Center at the Baylor College of Medicine, and by Jonathan Rothberg, founder of the company 454 Life Sciences. 'The first two genome sequences belonging to individuals are now being made available to researchers within a few days of each other. One is Dr. Watson's and the other belongs to J. Craig Venter, who as president of the Celera Corporation started a human genome project in competition with the government. Dr. Venter left Celera after producing only a draft version of a genome, his own, in 2001, which the company did no further work on. He has now brought his genome to completion at his own institute in Rockville, Md., and deposited it last week in GenBank, a public DNA database, he said.'"

30 of 142 comments (clear)

  1. Excuse me Dr. Watson... by BrunoBigfoot · · Score: 4, Funny

    Torrent pls?

    1. Re:Excuse me Dr. Watson... by CharlesEGrant · · Score: 4, Informative

      It's not a torrent, but you can in fact download the complete sequence and traces.

  2. completely torn by farkus888 · · Score: 3, Interesting

    this is really really cool for obvious reasons. it's also really really scary for equally obvious reasons. if I wasn't so afraid of the potential harm of misusing this power I'd sign my name now to be the third person done.

    --
    thats right, I rarely use capitals. deal with it. but don't mistake my laziness for stupidity
    1. Re:completely torn by kestasjk · · Score: 3, Interesting
      Why is it scary?
      • If someone wanted your DNA for malicious purposes would they have any trouble getting it? Unless you're meticulous about security and burn all your trash, it'd be no problem.
      • What could they do with your DNA?
        • Trace you back to crimes? They can do that already by taking your DNA without consent.
        • Clone you? Nope, not yet at least, and what would they do with the clones?
        • Discover you have the "criminal gene"? These "criminal/musician/pedophile/libertarian/democrat" genes are nonsense.
      • My cousin did genetics at Oxford and, iirc, his professor told him that genetics wouldn't be useful for much in a long time, even to do good.
      The scariest thing I can think of is having a national database of all genetic profiles, as it could have privacy implications. But that would be no scarier than having a national database of all fingerprints (but much more expensive).
      --
      // MD_Update(&m,buf,j);
  3. Good result, disappointing scientist / human by Anonymous Coward · · Score: 5, Informative

    For the curious, read a pretty good synopsis of Dr. Watson here: http://en.wikipedia.org/wiki/James_D._Watson#Contr oversy_about_using_King.27s_College_London.27s_res ults, and if you are extremely interested, pick up a copy of "The Double Helix." It is really strange, but even his autobiography makes him sound like a total ass, and includes an apology of sorts in the revised version, which is commendable.

    In short, Watson stole a lot of data, and the structure of DNA would have been determined in less than a couple months by the more deserving Linus Pauling, who has conducted himself in a much more dignified fashion. It is really strange how superficial history records events, with the "first" often the most noisy, obnoxious scientist / engineer / artist, and not the industrious, studious type.

    Well, perhaps they will find some genes responsible for the "jerk" phenotype... (at work, have to post AC).

    1. Re:Good result, disappointing scientist / human by mythar · · Score: 2, Funny

      it's okay, linus. we appreciate your input.

    2. Re:Good result, disappointing scientist / human by Bender0x7D1 · · Score: 2, Informative

      We also can't forget Rosalind Franklin - the "Dark Lady" of DNA, who first pohotographed the DNA molecule.

      --
      Reading code is like reading the dictionary - you have to read half of it before you can go back and understand it.
  4. Two DVD disks? by MichaelSmith · · Score: 2, Insightful

    So what's that, 16 gigabytes of information to describe one person. But this is a DNA profile, not necessarily something which can be turned back into DNA.

    1. Re:Two DVD disks? by neapolitan · · Score: 5, Interesting

      I've often thought about this (I'm a doctor...)

      By my calculations:

      3 billion base pairs in the entire human DNA sequence (give or take). Each base pair can be A, C, T, or G. (look at wikipedia or biology text for details.) Thus, each base pair can be represented by a 2 bit number (00 01 11 or 10).

      Thus, 3 x 10^9 base pairs * 2 bits / base pair = 6 x 10^9 bits = 6 billion bits * 1 byte / 8 bits = .75 billion bytes = .75 GB = 750 MB.

      A standard DVD holds 4.3 GB, so you could fit almost 6 full humans on a DVD. Of course, this doesn't count compression (which would be astoundingly effective given repetition and patterns in DNA sequences) nor the fact you could just encode the delta as much DNA is conserved. In fact, very little DNA varies between humans, so I'd bet you could quite deterministically encode a human in as little as 100 MB if you had a "standard human DNA sequence" for reference.

      Of course, you would need some magical method to reconstruct this DNA and put it into an egg at the right timing, which would likely form an approximation of the identical twin of a person. The technology for this is not here yet. Also, this does not encode any of the proteins / apparatus / mother that is needed to go from DNA in egg to functioning human.

      Still, it is interesting to think about!

      --
      Slashdotter, ID #101. UIDs are in binary, right?
    2. Re:Two DVD disks? by wizardforce · · Score: 2, Interesting

      everyone talks about the actual coding sequence but not much about epigenetics- whether or not certain cytosine residues are methylated and what not- quite important if you think about it- put the whole sequence back together and certain genes dont quite work the same way. so really counting all of that it would take quite a significant amount of more information to truely be able to reconstruct the genome as it was. then again only about 3% is methylated in that fashion...

      --
      Sigs are too short to say anything truly profound so read the above post instead.
  5. Limited Rights by manchineel · · Score: 5, Funny

    However, Dr. Watson was told that he could not use his DNA, as it had been patented by the company and any use of his own DNA without proper permission would lead to serious legal consequences...

    --
    Cum catapultae proscriptae erunt tum soli proscripti catapultas habebunt
  6. Celera = bad news by ushering05401 · · Score: 4, Interesting

    Just for anyone not following along:

    Celera is a bad news company, and news involving them should always set off alarm bells.

    They are decent at motivating people, though. Based on their track record and stated intentions they caused a massive movement to decode the human genome as public property after they announced they would compete with the federally funded decoding initiatives for the purpose of patenting the findings and licensing that data to private companies. As John Sulston, who led the British arm of the Human Genome Project put it: 'We were in a position of responsibility... without us, the human genome would be privatized.'

    Here's a quote from The New Atlantis:

    "Celera's mission was to sequence the human genome better and faster than its government-funded rival. It aimed to sell access to genomic information as well as the tools to interpret it, with an eye to "big pharma" and other biotechnology companies looking for a treasure trove of new drug targets."

    Venter, named in the submission, was the CEO of Celera at the time this strategy was developed and was deposed several months after it became clear that the public would beat Celera to the goal.

    This is admitedly troll bait, but I feel a burning personal need to inform people about this man's actions whenever I see his name in print.

    Regards.

    1. Re:Celera = bad news by Rich0 · · Score: 2, Insightful

      Ah, I remember those days.

      Basically, the issue was that the human genome project was operating under a rather long timeline (mostly based on the state of technology when the project started). Venter thought that using a massively-parallel approach to the problem and using computers to assemble the resulting mess of data would get the results faster, but with some gaps in the final data that would require follow-up. He started Celera to implement this idea.

      The business model was simple. All the data would be released publicly, but before it was patents would be secured on medical uses for a few hundred new genes that looked to be important. They also offered some database services that in theory would be superior to what was available publicly (although they did publicize their sequences in Genbank/etc).

      Suffice it to say the world of academics wasn't too happy about this, as the math on paper suggested that with the amount of capital Celera was commiting he would indeed overtake the HGP (on its original timeline) with time to spare. The reason for this is similar to what you see in distributed computing projects like the RC-5 cracking attempts. If a project stretches 5 years you'll probably see that half of the project got done in the last six months - because of the ever-growing computing power available to it. The whole project could be repeated in 1 year instead of the original 5. The same applied to DNA sequencing technology at the time - the decade-plus-long HGP could be completed in a year or two if started today with the same level of funding. So, starting late didn't really slow down Celera all that much.

      In the end Venter's idea essentially paid off. Sure, some complain that the random sequencing technique leaves gaps, but they can be closed conventionally. Also, if you look at most intended uses for sequence data, having 99% of it is just about as good as having 100% of it. And when you look at cost it is probably better to have 99% of 10 organisms sequenced to 100% of one.

      The massively-parallel approach to sequencing would probably be of interest to many in the /. crowd - it is essentially an IT solution to an otherwise-expensive problem.

  7. Well, he was (and still is) of poor character... by WIAKywbfatw · · Score: 5, Informative

    Yes, the man was part of a team that made a huge scientific breakthrough. If someone wants to argue that that makes him a genius, well, I won't start an argument on that front. But there's no doubt that Watson was (and still is) also of poor character.

    He and his colleagues knowingly stole vital DNA X-ray diffraction data from Rosalind Franklin and Raymond Gosling without their knowledge and consent (indeed, Franklin had even refused to share it), which tarnishes their acheivements.

    More recently, he has called for genetic screenings before birth to weed out "really stupid" people (the bottom 10 percent or so), and he has a nice line in how to deal with homosexuality, too. He believes "that if the gene [for homosexuality] were discovered and a woman decided not to give birth to a child that may have a tendency to become homosexual, she should be able to abort the fetus." Not to put too fine a point on it, but that strikes me as being rather too close to Third Reich thinking for my liking.

    He might have performed some fantastic science but, to me, his words preclude him from being considered a great scientist. Certainly they show that he's not a great human being.

    --

    "Accept that some days you are the pigeon, and some days you are the statue." - David Brent, Wernham Hogg
  8. Nature will find a way... by martin-boundary · · Score: 2, Funny

    Oh oh, I hope they double checked the electrical generators at Genbank. If there's a blackout and the frogs get out of the neighbouring lab and mate with Watson's and Rothberg's DNA, we'll soon have a huge Watsosaurus chasing chicken sized Rothoraptors all over North America. Personally, I'm gonna sell my home, buy a Winnabago and settle down right next to the Grand Canyon, the monsters will never find me there!

  9. Re:Well, he was (and still is) of poor character.. by WIAKywbfatw · · Score: 2, Informative

    No. Sorry, you've got me wrong here, friend. It's not a case of "anything that looks like what the Nazis did is bad", it's a case of what he said isbad.

    Abortions because of a likelyhood of low IQ or homosexuality? That doesn't abhor you? I'm all for a woman's right to choose not to have a baby (it's her body, it's her choice) but to make that choice available on the basis of likely intelligence or sexuality (or hair colour, or skin tone) is, to me and most people, a step too far.

    OK, if a foetus is going to result in a severe genetic abnormality (such as a severe mental or physical disability) then I can see why the option of an abortion should be made available but that's a whole different kettle of fish.

    --

    "Accept that some days you are the pigeon, and some days you are the statue." - David Brent, Wernham Hogg
  10. Re:Is that all I am? by Dunbal · · Score: 2, Insightful

    Anyone know if combination restrictions apply?

          Yes, but most of them are not compatible with life, so chances are you don't have any.

    --
    Seven puppies were harmed during the making of this post.
  11. Re:Is that all I am? by Smight · · Score: 2, Funny

    I would assume that combinations which result in your brain being outside of your body or having five lungs and the liver of a titmouse, would be a pretty strong restriction.

    --
    IOU one (1) signature
  12. Re:Well, he was (and still is) of poor character.. by Longtime_Lurker_Aces · · Score: 2

    If it wasn't such a serious issue, watching pro-abortion people try to justify their position would be funny.

    Its not a baby or not a human life so its okay to kill it... unless your reason for killing it is wrong because then it is a human life.

    If abortion hadn't gotten tied into religion, then everyone with a high school education would accept that on simple biological grounds a fetus is a human life. Claiming otherwise is burying your head in the sand as much as the creationism people.

  13. Only six? by quokkapox · · Score: 3, Funny

    so you could fit almost 6 full humans on a DVD.

    Only six? With lossy compression, you could do significantly better, as long as you don't mind all your offspring being funny-but-similar-looking lactose-intolerant non-deterministic sociopathic freaks.

    --
    it's a blue bright blue Saturday hey hey
  14. Re:Is that all I am? by Anonymous Coward · · Score: 2, Funny

    >gnl|ti|1741299339 name:1094373133425 mate:1742401149
    gttgaaatgggacgttgatggggtgatgtctgttcagtcttcgctgttta aaaagtttgggttatttttattgtgaaactgttggggttttctgcacatt ctctagatacaagacccttaccagatttatgtgtgggagtatcccaccca ttctgaattgtgtccctttgtcttcctcatggtgtgcttaatcgttattt aacacttaaccatttttttatggctagtgcttttagccataaagtcctaa gaaatcttttcctacctcaaggtgacaaagatactctcctctgttctatt tttcatttttatattgtacacaacacttaaaaaataagtctaagtgttac tagctgagaaataccagaaaacaacttgcataaatgctgaaatcgaattg ctacccctattttggattgaaatgaatttgaagggggaagaatgtcacag ttactttagcctcattttctagcactggaactctaagtggacaggagtga aaggaactttatggtgaaatattttgagaaatataaaatatctttgtgta tcttggggtgtctttgactagcctgttgggccagtgaggcaggaactgcc ttctctctgcatggttagtgcatggctgtggtgtggaaggtttggactcg aatgctgagctcgtgggcagacggacaggcagctggaagtaaagacgtgc cctccattctaggctgggaggaactgatgagagctgtgattctgcaggct gcctccctctggagatggcactgagatctctctcagccagggtcccagag ccagttgatgtctgtgttgagtctactttaaagacataaaatgccccctt tcttttctttctttcttccgtttttttattttttttttttttgttataaa agacagagtctcgctctgttgcccaggctagagtgcagtggtgtgatctc gggtcactgtgaactccgcctccggatcacaccattctccctccctcaca ctccagagtagctgggactacagtgcccgccaccgccgcccgactaattt tgt


    Gesundheit.

  15. 2 DVD's? by MikShapi · · Score: 5, Informative

    I'm doing undergrad biochem and we've done this math several times, as has been mentioned here in other threads, 1GB is the ballpark amount of space a single UNCOMPRESSED human genome should take up.

    On one hand, this is a marginal underestimate because there are more than 4 DNA nucleobases (quite rare, but they exist and need to be recorded if you're profiling a genome).
    However, the genome should be quite happily compressable (think bz2 or some specialized lossless form of compression) due to MANY repeating sequences and the fact that most exons (that you'd normally use 6 bits to describe) can be described using 5 bits by pinpointing their product on an amino-acid table (numbering 20 members most of the time), or even 4 bits if you narrow that table from the 20-most-common to the 15-most-common and use the 16th position to describe less-common sequences using more bits, just to name a few reasons.
    Maybe a bit of added data they put in describes things we've learned about the data which wasn't physically present in the original DNA such as "here ends intron, here starts exon, here be boundary" etc.

    In short, it should be highly compressible and fit in way under 2 DVD's, so for the life of me I can't figure out what they plugged onto two DVDs. Software to decipher it? Gene database correlating what's in your personal genome to what the genes are known to do? Free BonziBuddy extra content? Bonus "behind the scenes" material?

    --
    -
    1. Re:2 DVD's? by Anonymous Coward · · Score: 2, Funny

      Bonus "behind the scenes" material?

      I'm pretty certain most people don't want to see their very own "making of" documentaries...

    2. Re:2 DVD's? by The_mad_linguist · · Score: 2, Informative

      But you can't just point to the animo acid because the codons pointing to the same amino acid don't make the acid fold the same way when introduced to a protein.

  16. Re:Is that all I am? by Opportunist · · Score: 2, Funny

    Hey, just patent 'em all and the whole world belongs to you!

    --
    We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
  17. The Next Experiment by CopaceticOpus · · Score: 2, Funny

    Now we clone Dr. Watson, place his infant clone in a fake city set at the time of his birth, and see if he will grow up to make the same discoveries.

    Or did that already happen? Are we part of the simulation, doomed to ever repeat our part in the story of Watson's life? It's like that Groundhog's Day movie on /.! All posts are reposts!

    Sorry, I'm very tired... :)

  18. considering by ClioCJS · · Score: 2, Informative

    considering that the reason species propagate is a sexual attraction to the opposite sex, instilled by biology and thus DNA, it is not a wide leap at all to consider that sometimes the DNA would have a different effect. Like people who have two eyes that are different colors.

    --
    -Clio
    Karma: Bad (mostly from not giving a fuck)
    Blog: http://clintjcl.wordpress.com
  19. Re:Well, he was (and still is) of poor character.. by Schraegstrichpunkt · · Score: 2, Insightful

    If abortion hadn't gotten tied into religion, then everyone with a high school education would accept that on simple biological grounds a fetus is a human life.

    A fetus is excluded from the meaning of the legal term "person", because that's easier to do and results in more consistent application of the law than would amending every single law to replace "person" with "person other than a fetus". For similar reasons, corporations are considered legal "persons".

    The "fetuses aren't people" argument is a red herring, anyway. Yes, a fetus is a human life, and a chimpanzee is almost a human life. However, in our society, we benefit from offering only very limited protection to either one. In both cases, we are (arguably) conserving our resources for individuals who are more likely to become contributing members of our society. Some might say that it's cruel, but ultimately our species benefits as a result.

    Eugenics could be justified on similar grounds. Frankly, I'd be interested in hearing any sound arguments (beyond "It's just so wrong") that eugenics is bad for the species.

  20. Re:Well, he was (and still is) of poor character.. by dn15 · · Score: 2, Interesting

    Frankly, I'd be interested in hearing any sound arguments (beyond "It's just so wrong") that eugenics is bad for the species.

    Disclaimer 1: I don't know much about Eugenics so the following may be totally wrong.
    Disclaimer 2: I know that 28 Weeks Later was just a movie. Bear with me, I just bring it up to illustrate my theory.

    One way Eugenics is potentially bad for the species is that by weeding out undesirable characteristics we reduce genetic diversity. And if diversity decreases and some terrible disease hits the species it might be able to take a bigger bite out of the population.

    If you saw the movie 28 Weeks Later you may recall that the kid that was resistant to the so-called "Rage Virus" also had some genetic anomaly that led to each of his eyes being a different color. They seemed to imply that these two things were somehow connected. So let's say we encountered some similar situation in reality, but we had determined that having differently colored eyes (as an example) is undesirable. It's entirely possible that by eliminating that trait we also wiped out the few people who would have survived the next big plague.

  21. Re:Well, he was (and still is) of poor character.. by ccmay · · Score: 2, Interesting
    I don't know if Watson has had girlfriends in the past or present, but he is unmarried. He could be hypocritical if he's saying gays should be weeded out of the gene pool if he's being asexual or unsexual himself, not that it's gay or bad

    I don't think so. He is widely reputed to be a crude and insatiable womanizer, who screwed (or attempted to screw) every pretty girl who worked for him.

    --
    Too much Law; not enough Order.