Genome of DNA Pioneer Is Deciphered
unchiujar writes "The New York Times reports that the full genome of James D. Watson, one of the discoverers of the structure of DNA in 1953, has been deciphered, marking what some scientists believe is the gateway to an impending era of personalized genomic medicine. A copy of his genome, recorded on a pair of DVDs, was presented to Dr. Watson on Thursday in a ceremony in Houston by Richard Gibbs, director of the Human Genome Sequencing Center at the Baylor College of Medicine, and by Jonathan Rothberg, founder of the company 454 Life Sciences. 'The first two genome sequences belonging to individuals are now being made available to researchers within a few days of each other. One is Dr. Watson's and the other belongs to J. Craig Venter, who as president of the Celera Corporation started a human genome project in competition with the government. Dr. Venter left Celera after producing only a draft version of a genome, his own, in 2001, which the company did no further work on. He has now brought his genome to completion at his own institute in Rockville, Md., and deposited it last week in GenBank, a public DNA database, he said.'"
In reality, they just sequenced his clone!
Torrent pls?
this is really really cool for obvious reasons. it's also really really scary for equally obvious reasons. if I wasn't so afraid of the potential harm of misusing this power I'd sign my name now to be the third person done.
thats right, I rarely use capitals. deal with it. but don't mistake my laziness for stupidity
For the curious, read a pretty good synopsis of Dr. Watson here: http://en.wikipedia.org/wiki/James_D._Watson#Contr oversy_about_using_King.27s_College_London.27s_res ults, and if you are extremely interested, pick up a copy of "The Double Helix." It is really strange, but even his autobiography makes him sound like a total ass, and includes an apology of sorts in the revised version, which is commendable.
In short, Watson stole a lot of data, and the structure of DNA would have been determined in less than a couple months by the more deserving Linus Pauling, who has conducted himself in a much more dignified fashion. It is really strange how superficial history records events, with the "first" often the most noisy, obnoxious scientist / engineer / artist, and not the industrious, studious type.
Well, perhaps they will find some genes responsible for the "jerk" phenotype... (at work, have to post AC).
So what's that, 16 gigabytes of information to describe one person. But this is a DNA profile, not necessarily something which can be turned back into DNA.
http://michaelsmith.id.au
However, Dr. Watson was told that he could not use his DNA, as it had been patented by the company and any use of his own DNA without proper permission would lead to serious legal consequences...
Cum catapultae proscriptae erunt tum soli proscripti catapultas habebunt
All this to demostrate humans can be compressed to the size of 2 DVDs!
Minti: What's that huge shuriken in your back?! Kin: It's the instrument of my victory.
It may have been sequenced, but it will be some time before we have the technology to truly "decypher" or unlock the meaning of these sequences. Strikes me as a sensationalist headline.
Blu-Ray - Enough space to store your whole familys DNA!!
Just hope the DRM isn't cracked or people could clone my whole family, DAMN...Too Late
Just for anyone not following along:
Celera is a bad news company, and news involving them should always set off alarm bells.
They are decent at motivating people, though. Based on their track record and stated intentions they caused a massive movement to decode the human genome as public property after they announced they would compete with the federally funded decoding initiatives for the purpose of patenting the findings and licensing that data to private companies. As John Sulston, who led the British arm of the Human Genome Project put it: 'We were in a position of responsibility... without us, the human genome would be privatized.'
Here's a quote from The New Atlantis:
"Celera's mission was to sequence the human genome better and faster than its government-funded rival. It aimed to sell access to genomic information as well as the tools to interpret it, with an eye to "big pharma" and other biotechnology companies looking for a treasure trove of new drug targets."
Venter, named in the submission, was the CEO of Celera at the time this strategy was developed and was deposed several months after it became clear that the public would beat Celera to the goal.
This is admitedly troll bait, but I feel a burning personal need to inform people about this man's actions whenever I see his name in print.
Regards.
Yes, the man was part of a team that made a huge scientific breakthrough. If someone wants to argue that that makes him a genius, well, I won't start an argument on that front. But there's no doubt that Watson was (and still is) also of poor character.
He and his colleagues knowingly stole vital DNA X-ray diffraction data from Rosalind Franklin and Raymond Gosling without their knowledge and consent (indeed, Franklin had even refused to share it), which tarnishes their acheivements.
More recently, he has called for genetic screenings before birth to weed out "really stupid" people (the bottom 10 percent or so), and he has a nice line in how to deal with homosexuality, too. He believes "that if the gene [for homosexuality] were discovered and a woman decided not to give birth to a child that may have a tendency to become homosexual, she should be able to abort the fetus." Not to put too fine a point on it, but that strikes me as being rather too close to Third Reich thinking for my liking.
He might have performed some fantastic science but, to me, his words preclude him from being considered a great scientist. Certainly they show that he's not a great human being.
"Accept that some days you are the pigeon, and some days you are the statue." - David Brent, Wernham Hogg
Oh oh, I hope they double checked the electrical generators at Genbank. If there's a blackout and the frogs get out of the neighbouring lab and mate with Watson's and Rothberg's DNA, we'll soon have a huge Watsosaurus chasing chicken sized Rothoraptors all over North America. Personally, I'm gonna sell my home, buy a Winnabago and settle down right next to the Grand Canyon, the monsters will never find me there!
May the actions of these men lead to greater freedom on information in the future!
Accolades to those brave and capable enough to publish.
The unlocking and sharing of humanity's knowledge is the only way to a successful future (this website is proof enough)!
I wonder how long it'll be before they get dna sequences of important people and make FoxDie (as in Metal Gear Solid) equivalents
and no I didn't RTFA
If creativity is the field, copyright is the fence.
>gnl|ti|1741299339 name:1094373133425 mate:1742401149a aaaagtttgggttatttttattgtgaaactgttggggttttctgcacatt ctctagatacaagacccttaccagatttatgtgtgggagtatcccaccca ttctgaattgtgtccctttgtcttcctcatggtgtgcttaatcgttattt aacacttaaccatttttttatggctagtgcttttagccataaagtcctaa gaaatcttttcctacctcaaggtgacaaagatactctcctctgttctatt tttcatttttatattgtacacaacacttaaaaaataagtctaagtgttac tagctgagaaataccagaaaacaacttgcataaatgctgaaatcgaattg ctacccctattttggattgaaatgaatttgaagggggaagaatgtcacag ttactttagcctcattttctagcactggaactctaagtggacaggagtga aaggaactttatggtgaaatattttgagaaatataaaatatctttgtgta tcttggggtgtctttgactagcctgttgggccagtgaggcaggaactgcc ttctctctgcatggttagtgcatggctgtggtgtggaaggtttggactcg aatgctgagctcgtgggcagacggacaggcagctggaagtaaagacgtgc cctccattctaggctgggaggaactgatgagagctgtgattctgcaggct gcctccctctggagatggcactgagatctctctcagccagggtcccagag ccagttgatgtctgtgttgagtctactttaaagacataaaatgccccctt tcttttctttctttcttccgtttttttattttttttttttttgttataaa agacagagtctcgctctgttgcccaggctagagtgcagtggtgtgatctc gggtcactgtgaactccgcctccggatcacaccattctccctccctcaca ctccagagtagctgggactacagtgcccgccaccgccgcccgactaattt tgt
gttgaaatgggacgttgatggggtgatgtctgttcagtcttcgctgttt
That's it, just 10^643 unique individuals? Anyone know if combination restrictions apply?
---
I feel so finite.
I don't agree that anything that even vaguely resembles eugenics is always bad. I'm sure of the following: Government mandated executions based on genetic makeup is bad and pregnant women having the option to abort terminally-ill fetuses is good. There's a lot of ground in the middle. If we take "a woman's right to choose" as given, then I don't see any reason why aborting a stupid or gay fetus is any worse than aborting a generic unwanted fetus.
Your response is an excellent example of an ethical heuristic in action - the "anything that looks like what the Nazis did is bad" heuristic is probably a good one. But, you've got to remember the basic thing about heuristics - they're fast but don't always produce the correct result.
-- The act of censorship is always worse than whatever is being censored. Always.
No. Sorry, you've got me wrong here, friend. It's not a case of "anything that looks like what the Nazis did is bad", it's a case of what he said isbad.
Abortions because of a likelyhood of low IQ or homosexuality? That doesn't abhor you? I'm all for a woman's right to choose not to have a baby (it's her body, it's her choice) but to make that choice available on the basis of likely intelligence or sexuality (or hair colour, or skin tone) is, to me and most people, a step too far.
OK, if a foetus is going to result in a severe genetic abnormality (such as a severe mental or physical disability) then I can see why the option of an abortion should be made available but that's a whole different kettle of fish.
"Accept that some days you are the pigeon, and some days you are the statue." - David Brent, Wernham Hogg
that if the gene [for homosexuality] were discovered
This always makes me laugh. An inheritable cause for people who kind of by definition can't (or rather won't) have children. Yeah, homosexuality is a "gene"...
Seven puppies were harmed during the making of this post.
It's possible. Transmitted through the mother for gay men or the father through lesbians. I'm no geneticist, but I know enough to know that you can't definitively rule out genes having some influence on homosexuality.
If it wasn't such a serious issue, watching pro-abortion people try to justify their position would be funny.
Its not a baby or not a human life so its okay to kill it... unless your reason for killing it is wrong because then it is a human life.
If abortion hadn't gotten tied into religion, then everyone with a high school education would accept that on simple biological grounds a fetus is a human life. Claiming otherwise is burying your head in the sand as much as the creationism people.
so you could fit almost 6 full humans on a DVD.
Only six? With lossy compression, you could do significantly better, as long as you don't mind all your offspring being funny-but-similar-looking lactose-intolerant non-deterministic sociopathic freaks.
it's a blue bright blue Saturday hey hey
No, using more information to make an important decision doesn't seem abhorrent to me at all. A pregnant woman has the right to chose to abort the fetus. It's her body, it's her choice, and what information she uses to make that choice is her business.
If there were government criteria for mandatory abortions, then that would be a completely different story - but there are a lot of things that people should be free to do but shouldn't be mandatory, bar code tattoos for example.
As for your "me and most people" comment, I doubt that most people have even legitimately considered this question. Sure, a lot of people's gut reaction would be to agree with you - but a lot of people would initially support the new New York law that makes selling violent video games to kids a felony. Hopefully, in both cases, a little bit of consideration would cause them to rethink their initial position. People should generally allowed to make choices for themselves - the choice of what information to use in deciding whether to carry a fetus to term isn't an exception.
-- The act of censorship is always worse than whatever is being censored. Always.
Don't confuse the last 300,000 years of human society with modern society. The modern standard of expressing a gay gene by "not having children" might not have been an option during the bulk of human evolution.
know enough to know that you can't definitively rule out genes having some influence on homosexuality.
Yeah, the same argument is used to claim the existence of "God", because you can't "disprove it".
I think it is a LOT more likely that homosexuals are so desperate for some sort of justification for their lifestyle to be accepted by society that a "genetic" theory suits them just fine. Aww, it's not THEIR fault. It's a gene.
Seven puppies were harmed during the making of this post.
Don't confuse the last 300,000 years of human society with modern society. The modern standard of expressing a gay gene by "not having children" might not have been an option during the bulk of human evolution. Especially for lesbians.
While the term "decyphered" is incorrect (Jim Watson' and Craig Venter' genomes have "only" been REVEALED) - true "decyphering" will be much easier when a statistically significant Personal Genomes will be available. Thus far, it was ZERO (the one published was a "mix"). The two Personal Genomes will be practically identical as far as the "genes" are concerned. However, there will be much diversity in the "non-coding" (formerly "junk") DNA (see ample background at http://www.junkdna.com/ "Genomics beyond Genes" will catapult "Personalized PostGenetics".
I'm doing undergrad biochem and we've done this math several times, as has been mentioned here in other threads, 1GB is the ballpark amount of space a single UNCOMPRESSED human genome should take up.
On one hand, this is a marginal underestimate because there are more than 4 DNA nucleobases (quite rare, but they exist and need to be recorded if you're profiling a genome).
However, the genome should be quite happily compressable (think bz2 or some specialized lossless form of compression) due to MANY repeating sequences and the fact that most exons (that you'd normally use 6 bits to describe) can be described using 5 bits by pinpointing their product on an amino-acid table (numbering 20 members most of the time), or even 4 bits if you narrow that table from the 20-most-common to the 15-most-common and use the 16th position to describe less-common sequences using more bits, just to name a few reasons.
Maybe a bit of added data they put in describes things we've learned about the data which wasn't physically present in the original DNA such as "here ends intron, here starts exon, here be boundary" etc.
In short, it should be highly compressible and fit in way under 2 DVD's, so for the life of me I can't figure out what they plugged onto two DVDs. Software to decipher it? Gene database correlating what's in your personal genome to what the genes are known to do? Free BonziBuddy extra content? Bonus "behind the scenes" material?
-
"He believes "that if the gene [for homosexuality] were discovered and a woman decided not to give birth to a child that may have a tendency to become homosexual, she should be able to abort the fetus." Not to put too fine a point on it, but that strikes me as being rather too close to Third Reich thinking for my liking."
Aborting a homosexual fetus is a little like aborting an Asperger fetus, someone who is just different and who certain segments of society shun, but in the case with Aspergers, the shunning is much more widespread.
People are prejudiced and racist, its built in, you may not think you are racist/prejudice, but what exactly is friend and mate selection if not a form of *natural* prejudice based, eugenics? you look for the traits in others you favor or that do not cause your nervous system revulsion or aggravation. 90% of the people on earth associate with others based on 1) How they look 2) How they behave and 3) What value it adds to their life goals.
In this world discrimination is the norm, the fact that Eugenics got associated with the 3rd reich should not mean much since almost all nations were in on eugenics before that point. Designer people are the future whether you want to admit it or not, and capitalism and market society are leading the way. You only have to look at many successful people to realize that eugenic selecting is already happening.
There is, in fact, a difference between those cases.
Abortion is rarely chosen due to features of the baby. It's generally because of the mother's situation in one way or another.
Eugenics, on the other hand, is based entirely on the baby. It puts people in the position of being able to choose "good" features, and have a "proper" baby. This is dangerous on several levels, potential prejudices in both directions and gene pool reduction being two of the more important ones.
The fact that a fetus is being destroyed is not, in my opinion, the part that makes eugenics nasty. The part that makes eugenics nasty is what it means for the remaining children.
Breaking Into the Industry - A development log about starting a game studio.
I was at the presentation ceremony myself, and judging from what I heard, Dr Watson (and most in the medical and scientific community) believe that the most important thing which will come from these advances is the ability to make better informed decisions. In sequencing patients genomes: -An employer could blacklist you for being prone to mental illness. -A doctor can be swayed from one drug to another based previously noted reactions in persons with a particular genotype. -You may find out you have an incurable and soon to be debilitating genetic disease. -People can be advised to modify their sun exposure if they have genetic risk factors for skin cancer. -Novel medicines could be developed, tailor made to fit your particular needs. -Parents who don't want to raise a disabled, albino, gay, Downs, hemophiliac or whatever can choose to have their child aborted. Whether this new information will have a positive or negative effect on society is not yet clear, but the blade of knowledge is oft double edged.
Now we clone Dr. Watson, place his infant clone in a fake city set at the time of his birth, and see if he will grow up to make the same discoveries.
/.! All posts are reposts!
:)
Or did that already happen? Are we part of the simulation, doomed to ever repeat our part in the story of Watson's life? It's like that Groundhog's Day movie on
Sorry, I'm very tired...
Some people seem to disapprove of Watson and consider him unworthy of the glory arising from his discovery because of his supposed theft of Rosalind Franklin's data and what he has said about the the human race. Firstly, he didn't steal the data. It was shown to him by her colleague Maurice Wilkins albeit without her knowledge. Other essential data from the Wilkins/Franklin lab were provided to Francis Crick by Max Perutz, Crick's supervisor. He didn't break into her lab to steal it, or sneak a peek at her notebooks when she wasn't around. I think the data was just too important for any one person to have exclusive rights over it. Anyway, the clues were already floating around and available to many. Chargaff's ratios, the X-ray diffraction results. But it was Watson who had the crucial insight about how adenine paired with thymine and guanine with cytosine. And for that and his other contributions, he deserves the glory of his astonishing discovery.
As for his opinions about what he thinks about human nature, our problems, possible solutions, etc, he's just being the very rational person that he is. And it's not very much different from that of many other gifted scientists (eg. Steven Pinker's The Blank Slate). For more about Watson, Crick, Franklin and their contributions to one of the most breathtaking scientific discoveries of all time, I would suggest the following:
Watson, The Double Helix
Crick, What Mad Pursuit
Watson, DNA
Judson, The Eighth Day of Creation
Or at least read Watson's two books before judging or denouncing him.
If it's truly HER body and HER choice, then why should someone else's opinion of her reasons matter at all?
I wonder how big the diff output would be?
Cow Cube
The X-ray diffraction data was "vital" in the sense that it showed what the structure of DNA was, it was just necessary to interpret it correctly.
The problem is (currently studying bioinformatics after my medicine)
/. : DNA synthesising error rate is low but not negligible, so you can't just "print those 2 DVD and grow your very own DrWatson". Plus cloning is a little bit more complicated than putting some DNA into an ovocyte. ]
apparently bioinformaticians have never heard of "compression" or "efficient use of space".
The data (and it's associated metadata) is stored into formated ASCII thus the 12-fold increase of space requirement.
[ Also for all wanna-be-DrEvils on
"Sufficiently advanced satire is indistinguishable from reality." - [Tips: 1DrYakQDKCQ6y52z6QbnkxHXAocMZJE61o ]
I think part of the problem is the obsession among scientists of being the first to do something. Just think of all the grad students who spend 3 years on a project, only to get scooped by somebody else, and having to switch gears. Is their work somehow less original because it was done independently by somebody else ahead of them?
The same sorts of issues exist with negative results. Nobody cares about them, but they're just as important as positive results. Especially when everybody keeps reinventing the wheel because nobody bothers to publish that a given approach won't work.
I remember attending science classes at a smaller university and a large top-10 university. One thing that struck me as being different between the two was an emphasis on names. At the smaller university you'd just talk about the science. At the larger one every time a concept was mentioned it would also be mentioned who came up with it. I always figured that at the larger university it was due to a subconscious hope that the person doing the teaching would one day end up in one of those textbooks themselves. That and the fact that at larger universities there tends to be a lot more networking going on. Chances are that a professor at a small university will just do independant work and not collaborate with 14 other research groups (who all review each other's papers and grant applications).
Often I think the politics of large-scale science gets in the way. The same problem exists in private industry, but the desire to make a buck can cut through the red tape pretty quickly when the payoff is big enough...
If one or more genes lead to homosexuality or increase the chances of it when they are expressed alone or together, then clearly those genes would need to have other effects alone or together that would cause a net beneficial effect in terms of the spread of those genes. There would be nothing unusual with that.
Trying to dismiss the idea with comments like that just makes you seem silly.
Yeah, because gay men never marry and have children to "fit in". There are no recorded cases in history of gay men with children.
More seriously, I'm wondering how stupid, or simply cut-off from the real world, you have to be to make that kind of comment.
You are not alone. This is not normal. None of this is normal.
I remember in one of my required Honors courses, talking about the difference between the sciences and the humanities, which is, that the person doing the science shouldn't matter.
He's a great scientist because of his great science.
He isn't, however, that great of a person.
Incidentally, in 10th grade, someone in my class saw him enter a deli and order a sandwich (I live in one of the towns near Cold Spring Harbor. I could walk there. Takes me 2.5 hrs, but I could walk there.
IANAGE, but I am studying to be one.
The possibility of a gene for homosexuality is present, because all men inherit their X chromosomes through their mothers. Even if no gay men reproduced, we'd still have gay men, especially if the same gene provided some advantage to the mother, let's say larger breasts. It will be selected FOR in females, despite being selected against in males.
Lesbians don't have a similar mechanism, but, in the dark old days, you really didn't need to ask a ladies permission. Except if you're me.
So, conclusion: I'm a weakling.
to copy humans in linux: /dna_backup/insert_name_here-`date +%y%m%d`.iso
dd if=/dev/homosapien of=/dna_backup/insert_name_here-`date +%y%m%d`.iso
cdrecord -v speed=16 dev=2,0,0
Perhaps this means that the Amazon society of myth and cheesy science fiction can now take shape? Men won't be needed: women will simply select the DNA of Watson or Venter, add a little randomization from a palette of desirable eugenic traits, insert it into cloned sperm, and voila, one man-less designer baby coming up.
The dataset probably includes certainty coefficients, SNR's or at minimum peak heights from the readers.
(posting anonymously as I'm in the field, and it's a small world)
I watched the live webcast of him accepting the (portable hard drive) that contained the genome data. He was kind of an ass, trashing DOE, former NIH administrators, and various and sundry others. My colleagues and I confirmed that he had definitely fallen into the "I'm old and famous and don't care what I say or who hears it" model. I was disappointed, as I had hoped he would have been gracious.
You don't understand genetics or biology.
"I think it is a LOT more likely..." Ahh right, there's your problem.
considering that the reason species propagate is a sexual attraction to the opposite sex, instilled by biology and thus DNA, it is not a wide leap at all to consider that sometimes the DNA would have a different effect. Like people who have two eyes that are different colors.
-Clio
Karma: Bad (mostly from not giving a fuck)
Blog: http://clintjcl.wordpress.com
How do you explain homosexuality when it occurs in individuals of other species in the animal kingdom, you Bible-thumping fucktard? /oops, did I just go all ad-hominem on you?
Actually I'm an atheist. This would have been clear had you actually read what I wrote. So considering you are headed in exactly the opposite direction to rational conversation with your post, I guess you'll fail to understand that I'm also a homophobe, and I merely posted what I did to rile all the gay people on slashdot. I don't BELIEVE in a genetic basis for homosexuality. You/They can't PROVE there is one (yet). So I am as free to preach MY views as they are theirs since this isn't about SCIENCE yet - nothing has been proven.
All their theories and conjecture and arguments make me laugh. Simply put, you fell for a troll, retard.
Seven puppies were harmed during the making of this post.
Sure, it's a human life. But is it a person? The two are not synonymous. Ending a human life doesn't matter much if it's a brainless, unfeeling lump.
With two genes, you get sickle cell anemia and are quite likely to die young. With just one, you're much more likely to survive malaria.
For homosexuality:
With two genes, you like dudes and are quite unlikely to get one pregnant. With just one... maybe you can better resist the urge to screw women with obvious signs of an STD. Maybe you don't get yourself killed in a fight over a woman.
Maybe you exist to be an unthreatening way to get women to spend time with your family... so that your brothers (sharing much DNA with you) can grab them.
The makeup of the human gene pool is being influenced by human choices all the time. Women chose genetic characteristics for their children by selecting the father. Sure, there's the horror story of the human race losing the gene for red hair because it became unfashionable - or more relevently, losing the gene for sickle-cell anemia because it's usually harmful - but A.) there's no chance of that at all in the near future and B.) that would be better solved by a set of "endangered gene" laws or something.
What? Seriously - what, specifically, are you afraid of here? That schools will have to spend slightly less money on special education because a few less mentally handicapped kids were born? That our health care costs will go down slightly because there were a couple less fat kids? Sure, if this were government mandated or culturally expected then there would be a problem - but a couple of early adopters do not a social problem make.
I'm all for preserving genetic diversity - even sickle-cell anemia - but until a significant portion of parents have access to this sort of fetal genetic information the problem just doesn't exist.
-- The act of censorship is always worse than whatever is being censored. Always.
There is an argument against selective abortions that does not rely on the humanity of the fetus at all. That argument goes like this:
Allowing people to abort their children based on genetic information is socially unacceptable. That's clearly an opening to human genetic engineering, and genetic manipulation is dangerous and poorly understood. That's the sort of thing that leads to Godzilla destroying Tokyo. You don't want Tokyo to be destroyed, do you?
You are right about one thing though: If abortion is murder, then abortion based on genetic information is still murder. It turns out that the "is abortion murder?" question is hotly debated...
-- The act of censorship is always worse than whatever is being censored. Always.
A fetus is excluded from the meaning of the legal term "person", because that's easier to do and results in more consistent application of the law than would amending every single law to replace "person" with "person other than a fetus". For similar reasons, corporations are considered legal "persons".
The "fetuses aren't people" argument is a red herring, anyway. Yes, a fetus is a human life, and a chimpanzee is almost a human life. However, in our society, we benefit from offering only very limited protection to either one. In both cases, we are (arguably) conserving our resources for individuals who are more likely to become contributing members of our society. Some might say that it's cruel, but ultimately our species benefits as a result.
Eugenics could be justified on similar grounds. Frankly, I'd be interested in hearing any sound arguments (beyond "It's just so wrong") that eugenics is bad for the species.
http://outcampaign.org/
What, have you done a poll? How many people did you survey, and what's your confidence interval?
http://outcampaign.org/
Disclaimer 1: I don't know much about Eugenics so the following may be totally wrong.
Disclaimer 2: I know that 28 Weeks Later was just a movie. Bear with me, I just bring it up to illustrate my theory.
One way Eugenics is potentially bad for the species is that by weeding out undesirable characteristics we reduce genetic diversity. And if diversity decreases and some terrible disease hits the species it might be able to take a bigger bite out of the population.
If you saw the movie 28 Weeks Later you may recall that the kid that was resistant to the so-called "Rage Virus" also had some genetic anomaly that led to each of his eyes being a different color. They seemed to imply that these two things were somehow connected. So let's say we encountered some similar situation in reality, but we had determined that having differently colored eyes (as an example) is undesirable. It's entirely possible that by eliminating that trait we also wiped out the few people who would have survived the next big plague.
It may sound scary, but there are at least 64 commercial "synthetic genomics" companies (see http://www.junkdna.com/ ) that can turn INFORMATION (of A,C,T and G-s) into actual DNA. Thus, the two DVD information is really, our "blueprint". Even scarier, the DVD is a rather primitive carrier of the DNA information. A sperm and an ovum are MUCH tinier...
That's exactly why any government mandated or otherwise near-universal social policy that reduces genetic diversity is a bad idea. But... we could easily allow half the population of, say, the United States the choice to abort their fetuses with genes for "dumb", "fat", or even "doesn't have red hair" without measurably impacting the diversity of the overall human gene pool.
Mandated eugenics is definitely bad. Eugenics through executions is sick and evil. But making choices about what child you want to have (i.e. "I want a boy with freckles") is mostly harmless - and I don't see any reason to step in and prevent other people from making their own decisions about that sort of thing.
-- The act of censorship is always worse than whatever is being censored. Always.
Actually most of the scientific studies on the subject tend to find that there is a fairly large heritable component to homosexuality. In particular, there have been a number of twin studies that looked at rates of homosexuality in maternal vs fraternal twins that find identical twins (who share 100%) are more likely to both be homosexual than a fraternal twin pair (who only share 50%).
since this isn't about SCIENCE yet - nothing has been proven
d &Cmd=ShowDetailView&TermToSearch=1553528 d &Cmd=ShowDetailView&TermToSearch=11058483
Sure about that? SCIENCE would seem to disagree:
http://www.ncbi.nlm.nih.gov/sites/entrez?Db=PubMe
http://www.narth.com/docs/nothardwired.html
http://www.ncbi.nlm.nih.gov/sites/entrez?Db=PubMe
Actually, dictating the basis by which people make their decisions sounds like an even worse idea.
Fascism trolls keeping me up every night. When I starts a preachin', he HITS ME WITH HIS REICH!
Something left out of most of this discussion is that not all sequecing is the same in terms of accuracy and completeness and other measures of quality. The method used here, that of the 454/Roche sequencing has some accuracy issues relative to other sequencing technologies. This is balanced somewhat by some advtantages of 454 sequencing compared to other methods (e.g., no cloning is needed) but the end result is still probably of lower quality than the ABI "Sanger" Capillary methods used for the human genome project. Each of the new methods also has the pluses and minuses. And in the end, their completeness and quality and accuracy are going to be very important for how useful such genomes are for personalized medicine.
Okay. Now let's say that, in your example, people with the differently-coloured eyes become excellent carriers for that plague. If we had wiped out those undesirable genes, the plague would never have taken hold in the first place.
More importantly, genetic engineering/selection might ultimately end up being necessary. As various microbes evolve into more drug-resistant forms, we're going to need something to ensure our own survival. Nanotechnology also shows promise, but we still don't really know enough about it to know what its limitations are.
http://outcampaign.org/
I don't think so. He is widely reputed to be a crude and insatiable womanizer, who screwed (or attempted to screw) every pretty girl who worked for him.
Too much Law; not enough Order.
>The fact that a fetus is being destroyed is not, in my opinion, the part that makes eugenics nasty. The part that makes eugenics nasty is what it means for the remaining children.
What does it mean for the remaining children? They were the ones who didn't have the undesirable characteristics, remember?
Look, caring for a severely mentally impaired child can be a real drain on the family. Remember that case of the parents who wanted their young daughter's ovaries removed and her growth stunted, because she was already a vegetable, and had no consciousness anyway, so they wanted her kept small to make it easier to care for her.
Ultimately, if you chose to have the fully healthy kid over having the vegetable kid, then does it make you a monster?
And another thing -- most abortions are done in the first few weeks of the pregnancy. The foetus isn't even big enough to fill a tablespoon at that point. There isn't even any significant brain development. If you're stopped from giving blood because a test determines you have some undesirable viral DNA in your blood at the time, then is that so different than you stopping yourself from having a kid if a test determines there's undesirable DNA in the foetus, which is technically part of the mother anyway at that point?
With Watson getting up there in age, and DVD players being ubiquitous, if we ever need to steal the discovery of DNA again, we can readily clone him with ordinary household objects.
The Admin and the Engineer
DNA is almost fractal. Fractal data doesnt compress very well.