Slashdot Mirror


Genome of DNA Pioneer Is Deciphered

unchiujar writes "The New York Times reports that the full genome of James D. Watson, one of the discoverers of the structure of DNA in 1953, has been deciphered, marking what some scientists believe is the gateway to an impending era of personalized genomic medicine. A copy of his genome, recorded on a pair of DVDs, was presented to Dr. Watson on Thursday in a ceremony in Houston by Richard Gibbs, director of the Human Genome Sequencing Center at the Baylor College of Medicine, and by Jonathan Rothberg, founder of the company 454 Life Sciences. 'The first two genome sequences belonging to individuals are now being made available to researchers within a few days of each other. One is Dr. Watson's and the other belongs to J. Craig Venter, who as president of the Celera Corporation started a human genome project in competition with the government. Dr. Venter left Celera after producing only a draft version of a genome, his own, in 2001, which the company did no further work on. He has now brought his genome to completion at his own institute in Rockville, Md., and deposited it last week in GenBank, a public DNA database, he said.'"

116 of 142 comments (clear)

  1. That's What They Think! by Anonymous Coward · · Score: 1, Funny

    In reality, they just sequenced his clone!

  2. Excuse me Dr. Watson... by BrunoBigfoot · · Score: 4, Funny

    Torrent pls?

    1. Re:Excuse me Dr. Watson... by CharlesEGrant · · Score: 4, Informative

      It's not a torrent, but you can in fact download the complete sequence and traces.

  3. completely torn by farkus888 · · Score: 3, Interesting

    this is really really cool for obvious reasons. it's also really really scary for equally obvious reasons. if I wasn't so afraid of the potential harm of misusing this power I'd sign my name now to be the third person done.

    --
    thats right, I rarely use capitals. deal with it. but don't mistake my laziness for stupidity
    1. Re:completely torn by DirtySouthAfrican · · Score: 1

      I do!

    2. Re:completely torn by kestasjk · · Score: 3, Interesting
      Why is it scary?
      • If someone wanted your DNA for malicious purposes would they have any trouble getting it? Unless you're meticulous about security and burn all your trash, it'd be no problem.
      • What could they do with your DNA?
        • Trace you back to crimes? They can do that already by taking your DNA without consent.
        • Clone you? Nope, not yet at least, and what would they do with the clones?
        • Discover you have the "criminal gene"? These "criminal/musician/pedophile/libertarian/democrat" genes are nonsense.
      • My cousin did genetics at Oxford and, iirc, his professor told him that genetics wouldn't be useful for much in a long time, even to do good.
      The scariest thing I can think of is having a national database of all genetic profiles, as it could have privacy implications. But that would be no scarier than having a national database of all fingerprints (but much more expensive).
      --
      // MD_Update(&m,buf,j);
    3. Re:completely torn by MikShapi · · Score: 1, Interesting

      Harm? And I thought all the "Be scared of Hitler Clones" has subsided.

      Dude, if we mastered electricity, nuclear technology, chemistry, biological warfare and millions of 1+ ton hunks of metal whizzing around at 100km/h all over the the planet's surface, and made humanity benefit from all the above, do you REALLY think personalized medicine as a consequence of knowing your personal genome would do more bad than good to warrant "being afraid of the technology"?

      Gimme a break. 1978 called, they want their hitler DNA back.

      --
      -
    4. Re:completely torn by farkus888 · · Score: 1

      I am concerned about people wanting to make decisions about who's life is more important than whose based on genetic dispositions to certain health issues. I don't think I should be passed up for a liver transplant from years of hard drinking because I have a genetic predisposition to parkinsons or diabetes.

      --
      thats right, I rarely use capitals. deal with it. but don't mistake my laziness for stupidity
    5. Re:completely torn by Wolfrider · · Score: 1

      --They gave it to him on (2) DVD's. Couldn't they have just burned it to a dual-layer?
      :b

      --
      .
      == WolfriderV6 == I'm willing to admit that *I just might* be wrong... Are you??
    6. Re:completely torn by Anonymous Coward · · Score: 1, Insightful

      I don't think I should be passed up for a liver transplant from years of hard drinking because I have a genetic predisposition to parkinsons or diabetes.

      I would deny you the liver implant based solely on your hard drinking. All unlucky souls that need a new liver because of a disease should get it before you who knowingly killed your own liver get a new.

    7. Re:completely torn by espressojim · · Score: 1

      IAAG (I am a geneticist, and a bioinformatician, too), and knowing your complete sequence does give us lots of interesting info about your susceptibility of many genes.

      One thing you (and that's the slashdot you) know is that in the last few years we've had a moore's law ^2 increase in the amount of data we're gathering and analyzing. This is leading us to a huge increase in our understanding of humans and disease. 5 years ago, it was a pipe dream (or a million dollar project) to do a complete genome scan of an individual. It's now common place, and costs just a few hundred dollars (thus, we do it on thousands of individuals at a time to have the sample size for proper statistics and sensitivity.)

      We could look at Craig V's sequence, and tell him about all the increased risk he has. On the other hand, I don't know that anyone in the academic community has ANY love for the guy at all.

    8. Re:completely torn by Founder+of+PostGenet · · Score: 1

      Yes, this is a juncture of time when everybody has reasons to be "completely torn". Just as at every paradigm-shift in the history of science & technology. When the automobile appeared... When the A and H bombs appeared... When the home computer appeared... When the Internet appeared... (etc). If human kind is racing towards good or evil, is a question of philosophy. Fact remains, that the race has just accelerated (presently, for most people, beyond comprehension). There will be winners and losers (see above examples). Optimists may focus on the the possibility (virtual certainty) that e.g. if your Personal Genome harbors one of those "Junk DNA disease" glitches ( see http://www.junkdna.com/junkdna_diseases.html ), you will hugely benefit from your "Personal Genome". Even for healthy people their "Personal Genome" will help selecting those foods, medicines, activities (even partners) that are the best (and worst) for them. Pessimists may well worry about unprecedented "privacy" issues. While experts are already working on minimizing such effects ( see http://www.safedna.com/ ), the challenge is so great that even the biggest companies may "swim or sink" on this issue. (Just as IBM was the loser in the PC paradigm shift and Microsoft was the big winner; this issue already popped up with Google/23andme - with Microsoft and other IT giants not far behind). If Christiansen is right ("The innovator's dilemma"), like in every disruptive technology the biggest companies with largest inertia are at a disadvantage - while small and agile business can hugely benefit from the opportunity. Scientifically, PostGenetics (see http://www.postgenetics.org/ is likely to be a major beneficiary, since most of the Personal Diversity of Genomes is in "Genomics beyond Genes" (in what used to be called "Junk" DNA).

  4. Good result, disappointing scientist / human by Anonymous Coward · · Score: 5, Informative

    For the curious, read a pretty good synopsis of Dr. Watson here: http://en.wikipedia.org/wiki/James_D._Watson#Contr oversy_about_using_King.27s_College_London.27s_res ults, and if you are extremely interested, pick up a copy of "The Double Helix." It is really strange, but even his autobiography makes him sound like a total ass, and includes an apology of sorts in the revised version, which is commendable.

    In short, Watson stole a lot of data, and the structure of DNA would have been determined in less than a couple months by the more deserving Linus Pauling, who has conducted himself in a much more dignified fashion. It is really strange how superficial history records events, with the "first" often the most noisy, obnoxious scientist / engineer / artist, and not the industrious, studious type.

    Well, perhaps they will find some genes responsible for the "jerk" phenotype... (at work, have to post AC).

    1. Re:Good result, disappointing scientist / human by mythar · · Score: 2, Funny

      it's okay, linus. we appreciate your input.

    2. Re:Good result, disappointing scientist / human by Bender0x7D1 · · Score: 2, Informative

      We also can't forget Rosalind Franklin - the "Dark Lady" of DNA, who first pohotographed the DNA molecule.

      --
      Reading code is like reading the dictionary - you have to read half of it before you can go back and understand it.
  5. Two DVD disks? by MichaelSmith · · Score: 2, Insightful

    So what's that, 16 gigabytes of information to describe one person. But this is a DNA profile, not necessarily something which can be turned back into DNA.

    1. Re:Two DVD disks? by neapolitan · · Score: 5, Interesting

      I've often thought about this (I'm a doctor...)

      By my calculations:

      3 billion base pairs in the entire human DNA sequence (give or take). Each base pair can be A, C, T, or G. (look at wikipedia or biology text for details.) Thus, each base pair can be represented by a 2 bit number (00 01 11 or 10).

      Thus, 3 x 10^9 base pairs * 2 bits / base pair = 6 x 10^9 bits = 6 billion bits * 1 byte / 8 bits = .75 billion bytes = .75 GB = 750 MB.

      A standard DVD holds 4.3 GB, so you could fit almost 6 full humans on a DVD. Of course, this doesn't count compression (which would be astoundingly effective given repetition and patterns in DNA sequences) nor the fact you could just encode the delta as much DNA is conserved. In fact, very little DNA varies between humans, so I'd bet you could quite deterministically encode a human in as little as 100 MB if you had a "standard human DNA sequence" for reference.

      Of course, you would need some magical method to reconstruct this DNA and put it into an egg at the right timing, which would likely form an approximation of the identical twin of a person. The technology for this is not here yet. Also, this does not encode any of the proteins / apparatus / mother that is needed to go from DNA in egg to functioning human.

      Still, it is interesting to think about!

      --
      Slashdotter, ID #101. UIDs are in binary, right?
    2. Re:Two DVD disks? by troylanes · · Score: 1

      Two DVD disks in each one of our trillions of cells. Pretty amazing data storage density, really. How much of it actually encodes for useful proteins/enzymes/etc may only be a tiny fraction but at some level it's all functional. Perhaps DNA computing will reduce the size/cost/power consumption of data centers someday. Wikipedia DNA Computing

    3. Re:Two DVD disks? by Evil+Cretin · · Score: 1

      It would be interesting (albeit an ethical grey area) if one day we reached a stage where we can create a clone of someone from their genome (i.e. without needing their actual DNA). We'd be able to recreate people hundreds of years after they die.

      But we're still rather a while away from being able to stick together billions of base pairs and create a usable piece of DNA. However - it's actually been done before (article is pretty old, I know) with simpler organisms (viruses) and their RNA, so it's not unthinkable...

      --
      "A deadlock has been reached. One task must die. We must now choose between murder and suicide."
    4. Re:Two DVD disks? by DigiShaman · · Score: 1

      Of course, you would need some magical method to reconstruct this DNA and put it into an egg at the right timing, which would likely form an approximation of the identical twin of a person. The technology for this is not here yet.


      How about "cyber synthetic biology"? Basically, digitally grow the organism via emulation. I bet this technology will be used to study and digitally dissect a dinosaur long before one is actually cloned.

      Throw enough CPU power at it to emulate neural activity...and it might be "alive"

      Could happen in the next 50 years. Ya never know ;)
      --
      Life is not for the lazy.
    5. Re:Two DVD disks? by SolexaJoe875 · · Score: 1

      The Human genome is about 3.5 billion bases, and you need 2 bits to encode 2 bases, which corresponds to 7Gigiabits of data. 1 byte is 8 bits. So you would need at least 875Megabytes to store your DNA. This, I'm sure, would be bloated somewhat with the extra encoding and CRC checking to ensure that a disk with your DNA isn't missing any bases.. Does anyone know how much more space would be required to ensure that the DNA is copied accurately? I've heard that disks use Reed-Solomon codes as a way of minimizing bit errors, while also minimizing the amount of extra data you'd need to store.. It would be interesting to find out how much more space, in addition to the 875MBytes you would need, the probability of a bit-error, etc.. http://www.4i2i.com/reed_solomon_codes.htm I work at a company that makes DNA sequencers, and feel excited to be in this business..

    6. Re:Two DVD disks? by wizardforce · · Score: 2, Interesting

      everyone talks about the actual coding sequence but not much about epigenetics- whether or not certain cytosine residues are methylated and what not- quite important if you think about it- put the whole sequence back together and certain genes dont quite work the same way. so really counting all of that it would take quite a significant amount of more information to truely be able to reconstruct the genome as it was. then again only about 3% is methylated in that fashion...

      --
      Sigs are too short to say anything truly profound so read the above post instead.
    7. Re:Two DVD disks? by ZorbaTHut · · Score: 1

      CDs and DVDs already contain error correction. If that error correction isn't enough, the first thing you'd need to do is figure out how much damage you expect to be able to recover from. If you're planning on keeping it in an armored container stored in a bank vault, you're probably fine - if you're planning on using it as a floor sander, you might have some trouble.

      "How much" depends entirely on your needs.

      --
      Breaking Into the Industry - A development log about starting a game studio.
    8. Re:Two DVD disks? by Wolfrider · · Score: 1

      --Dude... I think you might have just facilitated the invention of the Transporter, by an order of magnitude... ;-)

      --
      .
      == WolfriderV6 == I'm willing to admit that *I just might* be wrong... Are you??
    9. Re:Two DVD disks? by RDW · · Score: 1

      But remember that (for the first time, and unlike the current reference assembly) these are diploid genomes, so you have to double those numbers. They're presumably stored as uncompressed ascii for convenience (so around 6Gb of data - maybe they should have used a dual-layer DVD!). However, 2-bit encoding is in fact used where space is at a premium (e.g. to fit a database derived from an entire genome into available RAM for BLAT or BLAST analysis). Here's the scheme used by BLAT:

      http://genome.ucsc.edu/FAQ/FAQformat#format7

      With this encoding, you can conformatably create an appropriate database from the ~3Gb reference assembly and BLAT against it on a desktop PC with 1.5Gb RAM.

    10. Re:Two DVD disks? by srichand · · Score: 1

      DVD. Of course, this doesn't count compression (which would be astoundingly effective given repetition and patterns in DNA sequences) Having worked on DNA sequence compression, I can tell you that its rather tough to get anything better than 1.6 bits per base. For the sake of completeness: 3x10^9 * 1.6 = 4.8 x 10^9 bits = 0.6 billion bytes = 600 MB. That's a little more than 7 complete sequences on a standard DVD. So DNA compression doesn't achieve too much more.
    11. Re:Two DVD disks? by SolexaJoe875 · · Score: 1

      I'm Assuming that we want to guarantee a 100% accurate 875Mbyte image of your DNA. A bit-error-rate better than 1 bit in 3.5 * 10^9.. What is the typical bit error rate for any file stored on a disk using the forward-error-correction and data redundancy that's built into a standard disk? A disk can handle being scratched by utilizing error correcting codes.. Error correction, in part, makes the fundamental trade-off between the amount of data redundancy you need to store to guarantee a bit error rate. It's all a matter of Gaussian probability.. The number I remember hearing about is 1 part in 2^31; so a standard disk should be able to recover your DNA even with scratches, but I'm not sure. In college, I only went briefly into the theory of data-storage, error-correcting codes; etc, other than knowing that Reed-Solomon is the one that is used to encode your data on standard disks. It would still be interesting to know how much more space you would need using a standard Reed-Solomon encoding to store an 875MByte image of your DNA.. I wonder how the file size would increase with decreasing bit-error rate? What can we assume about how writable DVD disks age and lose data over time, assuming that you keep them in a humidity and temperature controlled, dark environment?

    12. Re:Two DVD disks? by tOaOMiB · · Score: 1

      Just to nitpick a little: you're off by a factor of 2, since we each have 2 copies of the 3 billion base pairs--one from Mommy, and one from Daddy.

  6. Limited Rights by manchineel · · Score: 5, Funny

    However, Dr. Watson was told that he could not use his DNA, as it had been patented by the company and any use of his own DNA without proper permission would lead to serious legal consequences...

    --
    Cum catapultae proscriptae erunt tum soli proscripti catapultas habebunt
    1. Re:Limited Rights by PequalsNP · · Score: 1

      Though your comment is in jest, patents and intellectual property rights for DNA are in many ways trickier than even software patents.

  7. Compressed Humans by Soiden · · Score: 1

    All this to demostrate humans can be compressed to the size of 2 DVDs!

    --
    Minti: What's that huge shuriken in your back?! Kin: It's the instrument of my victory.
    1. Re:Compressed Humans by Dunbal · · Score: 1

      I'll see your Lucy Liu and raise you one Uma Thurmann

      --
      Seven puppies were harmed during the making of this post.
    2. Re:Compressed Humans by Wolfrider · · Score: 1

      --Back of the line, bothayaz... *I* want the Milla Jovovich + Elizabeth Hurley + Lucy Lawless + Mary McDonnell + Uma + Milena Velba + Nadine Jansen + Tricia Helfer + Mickie James + "Victoria" + "Caffeinated Librarian" + Diane Duane boxed set.

      --And coldsleep for myself for ~25 years while they grow up and are educated. (And my $$ earns enough Interest in the BG to pay for it all)

      --Can you imagine the conversations... and teh sex? ;-)

      --They won't be slaves; but they will have a nice profile/background of me, and be encouraged to anticipate my "thawing." Any of them who wants out can do so, as long as they pay off their expenses (which would admittedly be considerable.) They'd have to live onsite, pay rent, and do chores and such while paying it off.
       
      // Halfway serious
      // Can't afford it :(

      --
      .
      == WolfriderV6 == I'm willing to admit that *I just might* be wrong... Are you??
  8. Jumping the gun by AirLace · · Score: 1

    It may have been sequenced, but it will be some time before we have the technology to truly "decypher" or unlock the meaning of these sequences. Strikes me as a sensationalist headline.

    1. Re:Jumping the gun by DrMindWarp · · Score: 1

      Correct. Nothing has been decoded or 'decyphered'. It has been sequenced or transcribed.

      News stories with DNA are always encumbered with misleading inappropriate terms.

    2. Re:Jumping the gun by cariaso1 · · Score: 1
      In addition to the sequencing being transcribed, it has been analyzed.
      • variations in 310 genes known to cause disease, were found.
      • with 23 which are specifically known to increase the risk of disease
      Future analyses will go much further.

      www.SNPedia.com is a resource to help unravel the effects of these variations. We will cross reference the Watson and Venter genomes as soon as they are actually released. To date, the genomes have not been released.

      If anyone can point to where these specific sequences can be found I'd welcome it. In both cases I think the respective journals are holding the sequence until publication.
  9. Real Purpose by seven7h · · Score: 1, Funny

    Blu-Ray - Enough space to store your whole familys DNA!!

    Just hope the DRM isn't cracked or people could clone my whole family, DAMN...Too Late

  10. Celera = bad news by ushering05401 · · Score: 4, Interesting

    Just for anyone not following along:

    Celera is a bad news company, and news involving them should always set off alarm bells.

    They are decent at motivating people, though. Based on their track record and stated intentions they caused a massive movement to decode the human genome as public property after they announced they would compete with the federally funded decoding initiatives for the purpose of patenting the findings and licensing that data to private companies. As John Sulston, who led the British arm of the Human Genome Project put it: 'We were in a position of responsibility... without us, the human genome would be privatized.'

    Here's a quote from The New Atlantis:

    "Celera's mission was to sequence the human genome better and faster than its government-funded rival. It aimed to sell access to genomic information as well as the tools to interpret it, with an eye to "big pharma" and other biotechnology companies looking for a treasure trove of new drug targets."

    Venter, named in the submission, was the CEO of Celera at the time this strategy was developed and was deposed several months after it became clear that the public would beat Celera to the goal.

    This is admitedly troll bait, but I feel a burning personal need to inform people about this man's actions whenever I see his name in print.

    Regards.

    1. Re:Celera = bad news by Rich0 · · Score: 2, Insightful

      Ah, I remember those days.

      Basically, the issue was that the human genome project was operating under a rather long timeline (mostly based on the state of technology when the project started). Venter thought that using a massively-parallel approach to the problem and using computers to assemble the resulting mess of data would get the results faster, but with some gaps in the final data that would require follow-up. He started Celera to implement this idea.

      The business model was simple. All the data would be released publicly, but before it was patents would be secured on medical uses for a few hundred new genes that looked to be important. They also offered some database services that in theory would be superior to what was available publicly (although they did publicize their sequences in Genbank/etc).

      Suffice it to say the world of academics wasn't too happy about this, as the math on paper suggested that with the amount of capital Celera was commiting he would indeed overtake the HGP (on its original timeline) with time to spare. The reason for this is similar to what you see in distributed computing projects like the RC-5 cracking attempts. If a project stretches 5 years you'll probably see that half of the project got done in the last six months - because of the ever-growing computing power available to it. The whole project could be repeated in 1 year instead of the original 5. The same applied to DNA sequencing technology at the time - the decade-plus-long HGP could be completed in a year or two if started today with the same level of funding. So, starting late didn't really slow down Celera all that much.

      In the end Venter's idea essentially paid off. Sure, some complain that the random sequencing technique leaves gaps, but they can be closed conventionally. Also, if you look at most intended uses for sequence data, having 99% of it is just about as good as having 100% of it. And when you look at cost it is probably better to have 99% of 10 organisms sequenced to 100% of one.

      The massively-parallel approach to sequencing would probably be of interest to many in the /. crowd - it is essentially an IT solution to an otherwise-expensive problem.

  11. Well, he was (and still is) of poor character... by WIAKywbfatw · · Score: 5, Informative

    Yes, the man was part of a team that made a huge scientific breakthrough. If someone wants to argue that that makes him a genius, well, I won't start an argument on that front. But there's no doubt that Watson was (and still is) also of poor character.

    He and his colleagues knowingly stole vital DNA X-ray diffraction data from Rosalind Franklin and Raymond Gosling without their knowledge and consent (indeed, Franklin had even refused to share it), which tarnishes their acheivements.

    More recently, he has called for genetic screenings before birth to weed out "really stupid" people (the bottom 10 percent or so), and he has a nice line in how to deal with homosexuality, too. He believes "that if the gene [for homosexuality] were discovered and a woman decided not to give birth to a child that may have a tendency to become homosexual, she should be able to abort the fetus." Not to put too fine a point on it, but that strikes me as being rather too close to Third Reich thinking for my liking.

    He might have performed some fantastic science but, to me, his words preclude him from being considered a great scientist. Certainly they show that he's not a great human being.

    --

    "Accept that some days you are the pigeon, and some days you are the statue." - David Brent, Wernham Hogg
  12. Nature will find a way... by martin-boundary · · Score: 2, Funny

    Oh oh, I hope they double checked the electrical generators at Genbank. If there's a blackout and the frogs get out of the neighbouring lab and mate with Watson's and Rothberg's DNA, we'll soon have a huge Watsosaurus chasing chicken sized Rothoraptors all over North America. Personally, I'm gonna sell my home, buy a Winnabago and settle down right next to the Grand Canyon, the monsters will never find me there!

  13. Congratulations! by 311Stylee · · Score: 1

    May the actions of these men lead to greater freedom on information in the future!

    Accolades to those brave and capable enough to publish.

    The unlocking and sharing of humanity's knowledge is the only way to a successful future (this website is proof enough)!

  14. subject by Doddman · · Score: 1

    I wonder how long it'll be before they get dna sequences of important people and make FoxDie (as in Metal Gear Solid) equivalents


    and no I didn't RTFA

    --
    If creativity is the field, copyright is the fence.
  15. Is that all I am? by nbritton · · Score: 1

    >gnl|ti|1741299339 name:1094373133425 mate:1742401149
    gttgaaatgggacgttgatggggtgatgtctgttcagtcttcgctgttta aaaagtttgggttatttttattgtgaaactgttggggttttctgcacatt ctctagatacaagacccttaccagatttatgtgtgggagtatcccaccca ttctgaattgtgtccctttgtcttcctcatggtgtgcttaatcgttattt aacacttaaccatttttttatggctagtgcttttagccataaagtcctaa gaaatcttttcctacctcaaggtgacaaagatactctcctctgttctatt tttcatttttatattgtacacaacacttaaaaaataagtctaagtgttac tagctgagaaataccagaaaacaacttgcataaatgctgaaatcgaattg ctacccctattttggattgaaatgaatttgaagggggaagaatgtcacag ttactttagcctcattttctagcactggaactctaagtggacaggagtga aaggaactttatggtgaaatattttgagaaatataaaatatctttgtgta tcttggggtgtctttgactagcctgttgggccagtgaggcaggaactgcc ttctctctgcatggttagtgcatggctgtggtgtggaaggtttggactcg aatgctgagctcgtgggcagacggacaggcagctggaagtaaagacgtgc cctccattctaggctgggaggaactgatgagagctgtgattctgcaggct gcctccctctggagatggcactgagatctctctcagccagggtcccagag ccagttgatgtctgtgttgagtctactttaaagacataaaatgccccctt tcttttctttctttcttccgtttttttattttttttttttttgttataaa agacagagtctcgctctgttgcccaggctagagtgcagtggtgtgatctc gggtcactgtgaactccgcctccggatcacaccattctccctccctcaca ctccagagtagctgggactacagtgcccgccaccgccgcccgactaattt tgt

    That's it, just 10^643 unique individuals? Anyone know if combination restrictions apply?

    ---
    I feel so finite.

    1. Re:Is that all I am? by Dunbal · · Score: 2, Insightful

      Anyone know if combination restrictions apply?

            Yes, but most of them are not compatible with life, so chances are you don't have any.

      --
      Seven puppies were harmed during the making of this post.
    2. Re:Is that all I am? by Smight · · Score: 2, Funny

      I would assume that combinations which result in your brain being outside of your body or having five lungs and the liver of a titmouse, would be a pretty strong restriction.

      --
      IOU one (1) signature
    3. Re:Is that all I am? by Anonymous Coward · · Score: 2, Funny

      >gnl|ti|1741299339 name:1094373133425 mate:1742401149
      gttgaaatgggacgttgatggggtgatgtctgttcagtcttcgctgttta aaaagtttgggttatttttattgtgaaactgttggggttttctgcacatt ctctagatacaagacccttaccagatttatgtgtgggagtatcccaccca ttctgaattgtgtccctttgtcttcctcatggtgtgcttaatcgttattt aacacttaaccatttttttatggctagtgcttttagccataaagtcctaa gaaatcttttcctacctcaaggtgacaaagatactctcctctgttctatt tttcatttttatattgtacacaacacttaaaaaataagtctaagtgttac tagctgagaaataccagaaaacaacttgcataaatgctgaaatcgaattg ctacccctattttggattgaaatgaatttgaagggggaagaatgtcacag ttactttagcctcattttctagcactggaactctaagtggacaggagtga aaggaactttatggtgaaatattttgagaaatataaaatatctttgtgta tcttggggtgtctttgactagcctgttgggccagtgaggcaggaactgcc ttctctctgcatggttagtgcatggctgtggtgtggaaggtttggactcg aatgctgagctcgtgggcagacggacaggcagctggaagtaaagacgtgc cctccattctaggctgggaggaactgatgagagctgtgattctgcaggct gcctccctctggagatggcactgagatctctctcagccagggtcccagag ccagttgatgtctgtgttgagtctactttaaagacataaaatgccccctt tcttttctttctttcttccgtttttttattttttttttttttgttataaa agacagagtctcgctctgttgcccaggctagagtgcagtggtgtgatctc gggtcactgtgaactccgcctccggatcacaccattctccctccctcaca ctccagagtagctgggactacagtgcccgccaccgccgcccgactaattt tgt


      Gesundheit.

    4. Re:Is that all I am? by Opportunist · · Score: 2, Funny

      Hey, just patent 'em all and the whole world belongs to you!

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
  16. Re:Well, he was (and still is) of poor character.. by Chandon+Seldon · · Score: 1

    More recently, he has called for genetic screenings before birth to weed out "really stupid" people (the bottom 10 percent or so), and he has a nice line in how to deal with homosexuality, too. He believes "that if the gene [for homosexuality] were discovered and a woman decided not to give birth to a child that may have a tendency to become homosexual, she should be able to abort the fetus." Not to put too fine a point on it, but that strikes me as being rather too close to Third Reich thinking for my liking.

    I don't agree that anything that even vaguely resembles eugenics is always bad. I'm sure of the following: Government mandated executions based on genetic makeup is bad and pregnant women having the option to abort terminally-ill fetuses is good. There's a lot of ground in the middle. If we take "a woman's right to choose" as given, then I don't see any reason why aborting a stupid or gay fetus is any worse than aborting a generic unwanted fetus.

    Your response is an excellent example of an ethical heuristic in action - the "anything that looks like what the Nazis did is bad" heuristic is probably a good one. But, you've got to remember the basic thing about heuristics - they're fast but don't always produce the correct result.

    --
    -- The act of censorship is always worse than whatever is being censored. Always.
  17. Re:Well, he was (and still is) of poor character.. by WIAKywbfatw · · Score: 2, Informative

    No. Sorry, you've got me wrong here, friend. It's not a case of "anything that looks like what the Nazis did is bad", it's a case of what he said isbad.

    Abortions because of a likelyhood of low IQ or homosexuality? That doesn't abhor you? I'm all for a woman's right to choose not to have a baby (it's her body, it's her choice) but to make that choice available on the basis of likely intelligence or sexuality (or hair colour, or skin tone) is, to me and most people, a step too far.

    OK, if a foetus is going to result in a severe genetic abnormality (such as a severe mental or physical disability) then I can see why the option of an abortion should be made available but that's a whole different kettle of fish.

    --

    "Accept that some days you are the pigeon, and some days you are the statue." - David Brent, Wernham Hogg
  18. Re:Well, he was (and still is) of poor character.. by Dunbal · · Score: 1

    that if the gene [for homosexuality] were discovered

          This always makes me laugh. An inheritable cause for people who kind of by definition can't (or rather won't) have children. Yeah, homosexuality is a "gene"...

    --
    Seven puppies were harmed during the making of this post.
  19. Re:Well, he was (and still is) of poor character.. by zegota · · Score: 1

    It's possible. Transmitted through the mother for gay men or the father through lesbians. I'm no geneticist, but I know enough to know that you can't definitively rule out genes having some influence on homosexuality.

  20. Re:Well, he was (and still is) of poor character.. by Longtime_Lurker_Aces · · Score: 2

    If it wasn't such a serious issue, watching pro-abortion people try to justify their position would be funny.

    Its not a baby or not a human life so its okay to kill it... unless your reason for killing it is wrong because then it is a human life.

    If abortion hadn't gotten tied into religion, then everyone with a high school education would accept that on simple biological grounds a fetus is a human life. Claiming otherwise is burying your head in the sand as much as the creationism people.

  21. Only six? by quokkapox · · Score: 3, Funny

    so you could fit almost 6 full humans on a DVD.

    Only six? With lossy compression, you could do significantly better, as long as you don't mind all your offspring being funny-but-similar-looking lactose-intolerant non-deterministic sociopathic freaks.

    --
    it's a blue bright blue Saturday hey hey
    1. Re:Only six? by VirtualJWN · · Score: 1

      awwwww, c'mon, we have enough democrat/liberals already. you need to use a randomizer function.

      --
      "Any sufficiently advanced technology is indistinguishable from magic." - Arthur C. Clarke
  22. Re:Well, he was (and still is) of poor character.. by Chandon+Seldon · · Score: 1

    Abortions because of a likelyhood of low IQ or homosexuality? That doesn't abhor you? I'm all for a woman's right to choose not to have a baby (it's her body, it's her choice) but to make that choice available on the basis of likely intelligence or sexuality (or hair colour, or skin tone) is, to me and most people, a step too far.

    No, using more information to make an important decision doesn't seem abhorrent to me at all. A pregnant woman has the right to chose to abort the fetus. It's her body, it's her choice, and what information she uses to make that choice is her business.

    If there were government criteria for mandatory abortions, then that would be a completely different story - but there are a lot of things that people should be free to do but shouldn't be mandatory, bar code tattoos for example.

    As for your "me and most people" comment, I doubt that most people have even legitimately considered this question. Sure, a lot of people's gut reaction would be to agree with you - but a lot of people would initially support the new New York law that makes selling violent video games to kids a felony. Hopefully, in both cases, a little bit of consideration would cause them to rethink their initial position. People should generally allowed to make choices for themselves - the choice of what information to use in deciding whether to carry a fetus to term isn't an exception.

    --
    -- The act of censorship is always worse than whatever is being censored. Always.
  23. Re:Well, he was (and still is) of poor character.. by doug141 · · Score: 1

    Don't confuse the last 300,000 years of human society with modern society. The modern standard of expressing a gay gene by "not having children" might not have been an option during the bulk of human evolution.

  24. Re:Well, he was (and still is) of poor character.. by Dunbal · · Score: 1, Flamebait

    know enough to know that you can't definitively rule out genes having some influence on homosexuality.

          Yeah, the same argument is used to claim the existence of "God", because you can't "disprove it".

          I think it is a LOT more likely that homosexuals are so desperate for some sort of justification for their lifestyle to be accepted by society that a "genetic" theory suits them just fine. Aww, it's not THEIR fault. It's a gene.

    --
    Seven puppies were harmed during the making of this post.
  25. Re:Well, he was (and still is) of poor character.. by doug141 · · Score: 1

    Don't confuse the last 300,000 years of human society with modern society. The modern standard of expressing a gay gene by "not having children" might not have been an option during the bulk of human evolution. Especially for lesbians.

  26. Not DECYPHERED. Start of Personalized PostGenetics by Founder+of+PostGenet · · Score: 1

    While the term "decyphered" is incorrect (Jim Watson' and Craig Venter' genomes have "only" been REVEALED) - true "decyphering" will be much easier when a statistically significant Personal Genomes will be available. Thus far, it was ZERO (the one published was a "mix"). The two Personal Genomes will be practically identical as far as the "genes" are concerned. However, there will be much diversity in the "non-coding" (formerly "junk") DNA (see ample background at http://www.junkdna.com/ "Genomics beyond Genes" will catapult "Personalized PostGenetics".

  27. 2 DVD's? by MikShapi · · Score: 5, Informative

    I'm doing undergrad biochem and we've done this math several times, as has been mentioned here in other threads, 1GB is the ballpark amount of space a single UNCOMPRESSED human genome should take up.

    On one hand, this is a marginal underestimate because there are more than 4 DNA nucleobases (quite rare, but they exist and need to be recorded if you're profiling a genome).
    However, the genome should be quite happily compressable (think bz2 or some specialized lossless form of compression) due to MANY repeating sequences and the fact that most exons (that you'd normally use 6 bits to describe) can be described using 5 bits by pinpointing their product on an amino-acid table (numbering 20 members most of the time), or even 4 bits if you narrow that table from the 20-most-common to the 15-most-common and use the 16th position to describe less-common sequences using more bits, just to name a few reasons.
    Maybe a bit of added data they put in describes things we've learned about the data which wasn't physically present in the original DNA such as "here ends intron, here starts exon, here be boundary" etc.

    In short, it should be highly compressible and fit in way under 2 DVD's, so for the life of me I can't figure out what they plugged onto two DVDs. Software to decipher it? Gene database correlating what's in your personal genome to what the genes are known to do? Free BonziBuddy extra content? Bonus "behind the scenes" material?

    --
    -
    1. Re:2 DVD's? by Anonymous Coward · · Score: 2, Funny

      Bonus "behind the scenes" material?

      I'm pretty certain most people don't want to see their very own "making of" documentaries...

    2. Re:2 DVD's? by The_mad_linguist · · Score: 2, Informative

      But you can't just point to the animo acid because the codons pointing to the same amino acid don't make the acid fold the same way when introduced to a protein.

    3. Re:2 DVD's? by DerCed · · Score: 1

      Propably not only the sequence itself, but also numerous annotations such as the quality of the sequencing, gene names, functions, references, links to databases, predicted and known functional annotations, etc. etc. etc. etc.!!
      There is a lot more interesting information than just the nucleotides.

    4. Re:2 DVD's? by espressojim · · Score: 1

      If you're cool, you'd diff someone's genome against the reference, then compress that result.

      This isn't the first genome sequenced, and I have to wonder if the coverage is anywhere near as deep as the reference. My guess is that the coverage is 2-3x at best, and they used the reference as a scaffold for assembly anyway.

      This is why the shortcut exists to measure 500K to 1M SNPs per person, since it captures 95+% of the genetic diversity of an individual.

    5. Re:2 DVD's? by Poromenos1 · · Score: 1

      Backup copy!

      --
      Send email from the afterlife! Write your e-will at Dead Man's Switch.
    6. Re:2 DVD's? by RDW · · Score: 1

      Most tools for doing anything useful with a genome sequence expect an ascii-encoded text file. The reference assembly is usually distributed as a conventionally zipped or gzipped ascii file, which is about 900Mb compressed, and >3Gb uncompressed. Unlike the existing reference assembly, the Watson genome is diploid (has both his maternally and paternally inherited DNA), which equates to >6Gb of ascii-encoded data. This is more than will fit on a single-layer DVD, even without the Director's commentary! You could certainly get the whole thing on a single DVD in a compressed or 2-bit encoded format (2-bit encoding is used for certain applications - see my reply above), but for most purposes this would be less useful (data couldn't be accessed directly by most sequence analysis software).

    7. Re:2 DVD's? by MikShapi · · Score: 1

      Good point. Multiple combinations of bases may yield the same amino acid, yet you want to be recording not only what acid gets created but also which of the possible gene sequences that creates it was used, in (the quite possible) case something else hinges off the same data. Data compression (reuse of the same stored information for more than one purpose) is IIRC not unheard of.

      And to think I've just proposed using lossy compression for DNA :-)

      --
      -
    8. Re:2 DVD's? by archermadness · · Score: 1

      Actually, we put his genome on a portable 2.5" hard drive. As others have mentioned, there's a lot of annotation as part of his genome.
      I'm not sure why the DVD reference. I think it got into the press release, and everyone's going off that.

    9. Re:2 DVD's? by MikShapi · · Score: 1

      You'd be a good person to ask then.
      How long do you anticipate before someone (you? :-) nails down the Archon prize for Genomics?

      They were saying "5-10 years" when they floated it. Realistic?

      --
      -
    10. Re:2 DVD's? by tOaOMiB · · Score: 1

      Erm, this is the whole sequence, and there is important variation that is non-coding. So: ~3Gigabases of human DNA, and there's 2 copies (both of which are recorded here, so that's 6 gigabases of DNA. While a certainly sensical way to store it (uncompressed even) would be to use 2 bits per base, results in 12 gigabits = 1.5 Gb which easily fits on a DVD, the stupid (but convenient) way involves just storing each base as a full byte (as a char: A C T or G), coming out to 6Gb. Enough for two DVDs. This leaves some room for annotation, splitting up the sequence by chr, etc. And makes it very easy to view the sequence. You can just open the files up in a word processor, instead of having a special format.

    11. Re:2 DVD's? by CharlesEGrant · · Score: 1

      The two DVDs include not only the DNA sequence, but the raw traces coming out of the sequencing machine. Those are quite bulky, but they allow you to check if the base calls are correct or to find evidence of heterozygosity.

  28. Re:Well, he was (and still is) of poor character.. by blahplusplus · · Score: 1

    "He believes "that if the gene [for homosexuality] were discovered and a woman decided not to give birth to a child that may have a tendency to become homosexual, she should be able to abort the fetus." Not to put too fine a point on it, but that strikes me as being rather too close to Third Reich thinking for my liking."

    Aborting a homosexual fetus is a little like aborting an Asperger fetus, someone who is just different and who certain segments of society shun, but in the case with Aspergers, the shunning is much more widespread.

    People are prejudiced and racist, its built in, you may not think you are racist/prejudice, but what exactly is friend and mate selection if not a form of *natural* prejudice based, eugenics? you look for the traits in others you favor or that do not cause your nervous system revulsion or aggravation. 90% of the people on earth associate with others based on 1) How they look 2) How they behave and 3) What value it adds to their life goals.

    In this world discrimination is the norm, the fact that Eugenics got associated with the 3rd reich should not mean much since almost all nations were in on eugenics before that point. Designer people are the future whether you want to admit it or not, and capitalism and market society are leading the way. You only have to look at many successful people to realize that eugenic selecting is already happening.

  29. Re:Well, he was (and still is) of poor character.. by ZorbaTHut · · Score: 1

    There is, in fact, a difference between those cases.

    Abortion is rarely chosen due to features of the baby. It's generally because of the mother's situation in one way or another.

    Eugenics, on the other hand, is based entirely on the baby. It puts people in the position of being able to choose "good" features, and have a "proper" baby. This is dangerous on several levels, potential prejudices in both directions and gene pool reduction being two of the more important ones.

    The fact that a fetus is being destroyed is not, in my opinion, the part that makes eugenics nasty. The part that makes eugenics nasty is what it means for the remaining children.

    --
    Breaking Into the Industry - A development log about starting a game studio.
  30. The Possibilities of Having Genomes Sequenced by Medinole · · Score: 1

    I was at the presentation ceremony myself, and judging from what I heard, Dr Watson (and most in the medical and scientific community) believe that the most important thing which will come from these advances is the ability to make better informed decisions. In sequencing patients genomes: -An employer could blacklist you for being prone to mental illness. -A doctor can be swayed from one drug to another based previously noted reactions in persons with a particular genotype. -You may find out you have an incurable and soon to be debilitating genetic disease. -People can be advised to modify their sun exposure if they have genetic risk factors for skin cancer. -Novel medicines could be developed, tailor made to fit your particular needs. -Parents who don't want to raise a disabled, albino, gay, Downs, hemophiliac or whatever can choose to have their child aborted. Whether this new information will have a positive or negative effect on society is not yet clear, but the blade of knowledge is oft double edged.

  31. The Next Experiment by CopaceticOpus · · Score: 2, Funny

    Now we clone Dr. Watson, place his infant clone in a fake city set at the time of his birth, and see if he will grow up to make the same discoveries.

    Or did that already happen? Are we part of the simulation, doomed to ever repeat our part in the story of Watson's life? It's like that Groundhog's Day movie on /.! All posts are reposts!

    Sorry, I'm very tired... :)

  32. Judge a scientist by his achievements by BayaWeaver · · Score: 1

    Some people seem to disapprove of Watson and consider him unworthy of the glory arising from his discovery because of his supposed theft of Rosalind Franklin's data and what he has said about the the human race. Firstly, he didn't steal the data. It was shown to him by her colleague Maurice Wilkins albeit without her knowledge. Other essential data from the Wilkins/Franklin lab were provided to Francis Crick by Max Perutz, Crick's supervisor. He didn't break into her lab to steal it, or sneak a peek at her notebooks when she wasn't around. I think the data was just too important for any one person to have exclusive rights over it. Anyway, the clues were already floating around and available to many. Chargaff's ratios, the X-ray diffraction results. But it was Watson who had the crucial insight about how adenine paired with thymine and guanine with cytosine. And for that and his other contributions, he deserves the glory of his astonishing discovery.

    As for his opinions about what he thinks about human nature, our problems, possible solutions, etc, he's just being the very rational person that he is. And it's not very much different from that of many other gifted scientists (eg. Steven Pinker's The Blank Slate). For more about Watson, Crick, Franklin and their contributions to one of the most breathtaking scientific discoveries of all time, I would suggest the following:
    Watson, The Double Helix
    Crick, What Mad Pursuit
    Watson, DNA
    Judson, The Eighth Day of Creation
    Or at least read Watson's two books before judging or denouncing him.

    1. Re:Judge a scientist by his achievements by eli+pabst · · Score: 1
      There actually was an acknowledgment in the paper:

      "We have also been stimulated by a knowledge of the general nature of the unpublished results and ideas of Dr. M.H.F. Wilkins, Dr. R.E. Franklin, and their co-workers at King's College London"
      http://www.nature.com/physics/looking-back/crick/i ndex.html

      From their paper in the Proceedings of the Royal Academy:

      The information reported in this section was very kindly reported to us prior to its publication by Drs Wilkins and Frankilin. We are most heavily indebted in this respect to the King's College Group, and we wish to point out that without this data the formulation of our structure would have been most unlikely, if not impossible"
      http://www.journals.royalsoc.ac.uk/content/h2p6126 43886l61q/fulltext.pdf

      She probably deserved a full authorship, but as a graduate student that is a crapshoot depending on your advisor and who is writing the paper. Plus that's not bad considering she basically told them to fsck off.
  33. Re:Well, he was (and still is) of poor character.. by Tomfrh · · Score: 1

    If it's truly HER body and HER choice, then why should someone else's opinion of her reasons matter at all?

  34. Can I run them through diff? by Excel_Spread_Sheep · · Score: 1

    I wonder how big the diff output would be?

  35. Re:Well, he was (and still is) of poor character.. by HappyEngineer · · Score: 1

    He and his colleagues knowingly stole vital DNA X-ray diffraction data from Rosalind Franklin and Raymond Gosling without their knowledge and consent (indeed, Franklin had even refused to share it), which tarnishes their acheivements.
    Did they steal it or copy it? How was it "vital"? If it's scientific data then shouldn't it just all be public anyway? (I'm not flaming. I really want to know the answers.)
  36. Re:Well, he was (and still is) of poor character.. by Cadallin · · Score: 1
    It was stealing because they broke into her office and took it, or used a similar method equally dishonest. And that's completely apart from the issue of taking someone's unfinished work and then submitting it for publication as your own. What they did was close enough to plaigarism that I think the difference is insignificant. I've read about how it happened and basically Watson and Crick realized that whoever solved the problem of DNA structure would be famous. So they started bumming data off other scientists working on that and related problems, and in some cases resorted to actual theft. But they were right, they solved the problem and now they're famous and tenured. I think their submission of the correct answer (a scientific paper submitted to a journal whose name I can't remember) beat Linus Pauling's by mere hours.

    The X-ray diffraction data was "vital" in the sense that it showed what the structure of DNA was, it was just necessary to interpret it correctly.

  37. The problem is... by DrYak · · Score: 1

    The problem is (currently studying bioinformatics after my medicine)
    apparently bioinformaticians have never heard of "compression" or "efficient use of space".

    The data (and it's associated metadata) is stored into formated ASCII thus the 12-fold increase of space requirement.

    [ Also for all wanna-be-DrEvils on /. : DNA synthesising error rate is low but not negligible, so you can't just "print those 2 DVD and grow your very own DrWatson". Plus cloning is a little bit more complicated than putting some DNA into an ovocyte. ]

    --
    "Sufficiently advanced satire is indistinguishable from reality." - [Tips: 1DrYakQDKCQ6y52z6QbnkxHXAocMZJE61o ]
  38. Re:Well, he was (and still is) of poor character.. by Rich0 · · Score: 1

    I think part of the problem is the obsession among scientists of being the first to do something. Just think of all the grad students who spend 3 years on a project, only to get scooped by somebody else, and having to switch gears. Is their work somehow less original because it was done independently by somebody else ahead of them?

    The same sorts of issues exist with negative results. Nobody cares about them, but they're just as important as positive results. Especially when everybody keeps reinventing the wheel because nobody bothers to publish that a given approach won't work.

    I remember attending science classes at a smaller university and a large top-10 university. One thing that struck me as being different between the two was an emphasis on names. At the smaller university you'd just talk about the science. At the larger one every time a concept was mentioned it would also be mentioned who came up with it. I always figured that at the larger university it was due to a subconscious hope that the person doing the teaching would one day end up in one of those textbooks themselves. That and the fact that at larger universities there tends to be a lot more networking going on. Chances are that a professor at a small university will just do independant work and not collaborate with 14 other research groups (who all review each other's papers and grant applications).

    Often I think the politics of large-scale science gets in the way. The same problem exists in private industry, but the desire to make a buck can cut through the red tape pretty quickly when the payoff is big enough...

  39. Re:Well, he was (and still is) of poor character.. by vidarh · · Score: 1
    You seem to think evolution can't lead to genes that preclude survival of individuals from becoming widespread, but that's bullshit. Evolution doesn't "care" about individuals - what matters is if the expression of the gene causes a net increase in the odds of someone surviving and passing on their genes than without it.

    If one or more genes lead to homosexuality or increase the chances of it when they are expressed alone or together, then clearly those genes would need to have other effects alone or together that would cause a net beneficial effect in terms of the spread of those genes. There would be nothing unusual with that.

    Trying to dismiss the idea with comments like that just makes you seem silly.

  40. Re:Well, he was (and still is) of poor character.. by squiggleslash · · Score: 1

    Yeah, because gay men never marry and have children to "fit in". There are no recorded cases in history of gay men with children.

    More seriously, I'm wondering how stupid, or simply cut-off from the real world, you have to be to make that kind of comment.

    --
    You are not alone. This is not normal. None of this is normal.
  41. Re:Well, he was (and still is) of poor character.. by my+$anity++0 · · Score: 1

    I remember in one of my required Honors courses, talking about the difference between the sciences and the humanities, which is, that the person doing the science shouldn't matter.

    He's a great scientist because of his great science.

    He isn't, however, that great of a person.

    Incidentally, in 10th grade, someone in my class saw him enter a deli and order a sandwich (I live in one of the towns near Cold Spring Harbor. I could walk there. Takes me 2.5 hrs, but I could walk there.

  42. Re:Well, he was (and still is) of poor character.. by my+$anity++0 · · Score: 1

    IANAGE, but I am studying to be one.

    The possibility of a gene for homosexuality is present, because all men inherit their X chromosomes through their mothers. Even if no gay men reproduced, we'd still have gay men, especially if the same gene provided some advantage to the mother, let's say larger breasts. It will be selected FOR in females, despite being selected against in males.

    Lesbians don't have a similar mechanism, but, in the dark old days, you really didn't need to ask a ladies permission. Except if you're me.

    So, conclusion: I'm a weakling.

  43. whoa one day this will work by kemo_by_the_kilo · · Score: 1

    to copy humans in linux:
    dd if=/dev/homosapien of=/dna_backup/insert_name_here-`date +%y%m%d`.iso
    cdrecord -v speed=16 dev=2,0,0 /dna_backup/insert_name_here-`date +%y%m%d`.iso

  44. Age of the Amazons upon us? by macraig · · Score: 1

    Perhaps this means that the Amazon society of myth and cheesy science fiction can now take shape? Men won't be needed: women will simply select the DNA of Watson or Venter, add a little randomization from a palette of desirable eugenic traits, insert it into cloned sperm, and voila, one man-less designer baby coming up.

    1. Re:Age of the Amazons upon us? by RDW · · Score: 1

      Yes, and because they already hold the patent they'll be able to do it by 1-Click Ordering!

  45. Metadata by ProfessionalCookie · · Score: 1

    The dataset probably includes certainty coefficients, SNR's or at minimum peak heights from the readers.

  46. Re:Well, he was (and still is) of poor character.. by Anonymous Coward · · Score: 1, Insightful

    (posting anonymously as I'm in the field, and it's a small world)

    I watched the live webcast of him accepting the (portable hard drive) that contained the genome data. He was kind of an ass, trashing DOE, former NIH administrators, and various and sundry others. My colleagues and I confirmed that he had definitely fallen into the "I'm old and famous and don't care what I say or who hears it" model. I was disappointed, as I had hoped he would have been gracious.

  47. Re:Well, he was (and still is) of poor character.. by abigor · · Score: 1

    You don't understand genetics or biology.

    "I think it is a LOT more likely..." Ahh right, there's your problem.

  48. considering by ClioCJS · · Score: 2, Informative

    considering that the reason species propagate is a sexual attraction to the opposite sex, instilled by biology and thus DNA, it is not a wide leap at all to consider that sometimes the DNA would have a different effect. Like people who have two eyes that are different colors.

    --
    -Clio
    Karma: Bad (mostly from not giving a fuck)
    Blog: http://clintjcl.wordpress.com
  49. Re:Well, he was (and still is) of poor character.. by Dunbal · · Score: 1

    How do you explain homosexuality when it occurs in individuals of other species in the animal kingdom, you Bible-thumping fucktard? /oops, did I just go all ad-hominem on you?

          Actually I'm an atheist. This would have been clear had you actually read what I wrote. So considering you are headed in exactly the opposite direction to rational conversation with your post, I guess you'll fail to understand that I'm also a homophobe, and I merely posted what I did to rile all the gay people on slashdot. I don't BELIEVE in a genetic basis for homosexuality. You/They can't PROVE there is one (yet). So I am as free to preach MY views as they are theirs since this isn't about SCIENCE yet - nothing has been proven.

          All their theories and conjecture and arguments make me laugh. Simply put, you fell for a troll, retard.

    --
    Seven puppies were harmed during the making of this post.
  50. Re:Well, he was (and still is) of poor character.. by neonleonb · · Score: 1

    Sure, it's a human life. But is it a person? The two are not synonymous. Ending a human life doesn't matter much if it's a brainless, unfeeling lump.

  51. like sickle cell anemia by r00t · · Score: 1

    With two genes, you get sickle cell anemia and are quite likely to die young. With just one, you're much more likely to survive malaria.

    For homosexuality:

    With two genes, you like dudes and are quite unlikely to get one pregnant. With just one... maybe you can better resist the urge to screw women with obvious signs of an STD. Maybe you don't get yourself killed in a fight over a woman.

    Maybe you exist to be an unthreatening way to get women to spend time with your family... so that your brothers (sharing much DNA with you) can grab them.

  52. Re:Well, he was (and still is) of poor character.. by Chandon+Seldon · · Score: 1

    This is dangerous on several levels, potential prejudices in both directions and gene pool reduction being two of the more important ones.

    The makeup of the human gene pool is being influenced by human choices all the time. Women chose genetic characteristics for their children by selecting the father. Sure, there's the horror story of the human race losing the gene for red hair because it became unfashionable - or more relevently, losing the gene for sickle-cell anemia because it's usually harmful - but A.) there's no chance of that at all in the near future and B.) that would be better solved by a set of "endangered gene" laws or something.

    The part that makes eugenics nasty is what it means for the remaining children.

    What? Seriously - what, specifically, are you afraid of here? That schools will have to spend slightly less money on special education because a few less mentally handicapped kids were born? That our health care costs will go down slightly because there were a couple less fat kids? Sure, if this were government mandated or culturally expected then there would be a problem - but a couple of early adopters do not a social problem make.

    I'm all for preserving genetic diversity - even sickle-cell anemia - but until a significant portion of parents have access to this sort of fetal genetic information the problem just doesn't exist.

    --
    -- The act of censorship is always worse than whatever is being censored. Always.
  53. Re:Well, he was (and still is) of poor character.. by Chandon+Seldon · · Score: 1

    Its not a baby or not a human life so its okay to kill it... unless your reason for killing it is wrong because then it is a human life.

    There is an argument against selective abortions that does not rely on the humanity of the fetus at all. That argument goes like this:
    Allowing people to abort their children based on genetic information is socially unacceptable. That's clearly an opening to human genetic engineering, and genetic manipulation is dangerous and poorly understood. That's the sort of thing that leads to Godzilla destroying Tokyo. You don't want Tokyo to be destroyed, do you?

    You are right about one thing though: If abortion is murder, then abortion based on genetic information is still murder. It turns out that the "is abortion murder?" question is hotly debated...

    --
    -- The act of censorship is always worse than whatever is being censored. Always.
  54. Re:Well, he was (and still is) of poor character.. by Schraegstrichpunkt · · Score: 2, Insightful

    If abortion hadn't gotten tied into religion, then everyone with a high school education would accept that on simple biological grounds a fetus is a human life.

    A fetus is excluded from the meaning of the legal term "person", because that's easier to do and results in more consistent application of the law than would amending every single law to replace "person" with "person other than a fetus". For similar reasons, corporations are considered legal "persons".

    The "fetuses aren't people" argument is a red herring, anyway. Yes, a fetus is a human life, and a chimpanzee is almost a human life. However, in our society, we benefit from offering only very limited protection to either one. In both cases, we are (arguably) conserving our resources for individuals who are more likely to become contributing members of our society. Some might say that it's cruel, but ultimately our species benefits as a result.

    Eugenics could be justified on similar grounds. Frankly, I'd be interested in hearing any sound arguments (beyond "It's just so wrong") that eugenics is bad for the species.

  55. Re:Well, he was (and still is) of poor character.. by Schraegstrichpunkt · · Score: 1

    but to make that choice ... is, to me and most people, a step too far.

    What, have you done a poll? How many people did you survey, and what's your confidence interval?

  56. Re:Well, he was (and still is) of poor character.. by dn15 · · Score: 2, Interesting

    Frankly, I'd be interested in hearing any sound arguments (beyond "It's just so wrong") that eugenics is bad for the species.

    Disclaimer 1: I don't know much about Eugenics so the following may be totally wrong.
    Disclaimer 2: I know that 28 Weeks Later was just a movie. Bear with me, I just bring it up to illustrate my theory.

    One way Eugenics is potentially bad for the species is that by weeding out undesirable characteristics we reduce genetic diversity. And if diversity decreases and some terrible disease hits the species it might be able to take a bigger bite out of the population.

    If you saw the movie 28 Weeks Later you may recall that the kid that was resistant to the so-called "Rage Virus" also had some genetic anomaly that led to each of his eyes being a different color. They seemed to imply that these two things were somehow connected. So let's say we encountered some similar situation in reality, but we had determined that having differently colored eyes (as an example) is undesirable. It's entirely possible that by eliminating that trait we also wiped out the few people who would have survived the next big plague.

  57. Re:Two DVD disks? - can be turned back to DNA by Founder+of+PostGenet · · Score: 1

    It may sound scary, but there are at least 64 commercial "synthetic genomics" companies (see http://www.junkdna.com/ ) that can turn INFORMATION (of A,C,T and G-s) into actual DNA. Thus, the two DVD information is really, our "blueprint". Even scarier, the DVD is a rather primitive carrier of the DNA information. A sperm and an ovum are MUCH tinier...

  58. Re:Well, he was (and still is) of poor character.. by Chandon+Seldon · · Score: 1

    One way Eugenics is potentially bad for the species is that by weeding out undesirable characteristics we reduce genetic diversity. And if diversity decreases and some terrible disease hits the species it might be able to take a bigger bite out of the population.

    That's exactly why any government mandated or otherwise near-universal social policy that reduces genetic diversity is a bad idea. But... we could easily allow half the population of, say, the United States the choice to abort their fetuses with genes for "dumb", "fat", or even "doesn't have red hair" without measurably impacting the diversity of the overall human gene pool.

    Mandated eugenics is definitely bad. Eugenics through executions is sick and evil. But making choices about what child you want to have (i.e. "I want a boy with freckles") is mostly harmless - and I don't see any reason to step in and prevent other people from making their own decisions about that sort of thing.

    --
    -- The act of censorship is always worse than whatever is being censored. Always.
  59. Re:Well, he was (and still is) of poor character.. by eli+pabst · · Score: 1

    Actually most of the scientific studies on the subject tend to find that there is a fairly large heritable component to homosexuality. In particular, there have been a number of twin studies that looked at rates of homosexuality in maternal vs fraternal twins that find identical twins (who share 100%) are more likely to both be homosexual than a fraternal twin pair (who only share 50%).

  60. Re:Well, he was (and still is) of poor character.. by eli+pabst · · Score: 1
  61. Re:Well, he was (and still is) of poor character.. by Profane+MuthaFucka · · Score: 1

    Actually, dictating the basis by which people make their decisions sounds like an even worse idea.

    --
    Fascism trolls keeping me up every night. When I starts a preachin', he HITS ME WITH HIS REICH!
  62. Not all sequencing is the same by dnarepair · · Score: 1

    Something left out of most of this discussion is that not all sequecing is the same in terms of accuracy and completeness and other measures of quality. The method used here, that of the 454/Roche sequencing has some accuracy issues relative to other sequencing technologies. This is balanced somewhat by some advtantages of 454 sequencing compared to other methods (e.g., no cloning is needed) but the end result is still probably of lower quality than the ABI "Sanger" Capillary methods used for the human genome project. Each of the new methods also has the pluses and minuses. And in the end, their completeness and quality and accuracy are going to be very important for how useful such genomes are for personalized medicine.

  63. Re:Well, he was (and still is) of poor character.. by Schraegstrichpunkt · · Score: 1

    So let's say we encountered some similar situation in reality, but we had determined that having differently colored eyes (as an example) is undesirable. It's entirely possible that by eliminating that trait we also wiped out the few people who would have survived the next big plague.

    Okay. Now let's say that, in your example, people with the differently-coloured eyes become excellent carriers for that plague. If we had wiped out those undesirable genes, the plague would never have taken hold in the first place.

    More importantly, genetic engineering/selection might ultimately end up being necessary. As various microbes evolve into more drug-resistant forms, we're going to need something to ensure our own survival. Nanotechnology also shows promise, but we still don't really know enough about it to know what its limitations are.

  64. Re:Well, he was (and still is) of poor character.. by ccmay · · Score: 2, Interesting
    I don't know if Watson has had girlfriends in the past or present, but he is unmarried. He could be hypocritical if he's saying gays should be weeded out of the gene pool if he's being asexual or unsexual himself, not that it's gay or bad

    I don't think so. He is widely reputed to be a crude and insatiable womanizer, who screwed (or attempted to screw) every pretty girl who worked for him.

    --
    Too much Law; not enough Order.
  65. Re:Well, he was (and still is) of poor character.. by sanman2 · · Score: 1

    >The fact that a fetus is being destroyed is not, in my opinion, the part that makes eugenics nasty. The part that makes eugenics nasty is what it means for the remaining children.

    What does it mean for the remaining children? They were the ones who didn't have the undesirable characteristics, remember?

    Look, caring for a severely mentally impaired child can be a real drain on the family. Remember that case of the parents who wanted their young daughter's ovaries removed and her growth stunted, because she was already a vegetable, and had no consciousness anyway, so they wanted her kept small to make it easier to care for her.

    Ultimately, if you chose to have the fully healthy kid over having the vegetable kid, then does it make you a monster?

  66. Re:Well, he was (and still is) of poor character.. by sanman2 · · Score: 1

    And another thing -- most abortions are done in the first few weeks of the pregnancy. The foetus isn't even big enough to fill a tablespoon at that point. There isn't even any significant brain development. If you're stopped from giving blood because a test determines you have some undesirable viral DNA in your blood at the time, then is that so different than you stopping yourself from having a kid if a test determines there's undesirable DNA in the foetus, which is technically part of the mother anyway at that point?

  67. why this is cool by catmistake · · Score: 1

    With Watson getting up there in age, and DVD players being ubiquitous, if we ever need to steal the discovery of DNA again, we can readily clone him with ordinary household objects.

  68. wont compress very well by peter303 · · Score: 1

    DNA is almost fractal. Fractal data doesnt compress very well.

  69. Re:Well, he was (and still is) of poor character.. by dn15 · · Score: 1

    Okay. Now let's say that, in your example, people with the differently-coloured eyes become excellent carriers for that plague. If we had wiped out those undesirable genes, the plague would never have taken hold in the first place.
    Possibly, but that's not an argument for eliminating some characteristics because we consider them to be less than ideal. Ultimately for the survival of the species, it's less important when something can take hold in a minority if the majority of the population is resistant. But the reverse situation is extremely important -- we're screwed if something comes along that can take out the majority and we have no remaining minorities with genetic abnormalities that might allow them to resist it and be able to continue the species.

    More importantly, genetic engineering/selection might ultimately end up being necessary. As various microbes evolve into more drug-resistant forms, we're going to need something to ensure our own survival. Nanotechnology also shows promise, but we still don't really know enough about it to know what its limitations are.
    Granted, it may be necessary in some cases, but the threat we're fixing by genetic engineering would have to be both devastating and slow-moving at the same time. If a truly unstoppable plague is sweeping the planet and decimating the population, we don't have much time to (1) find out what genes to tweak to make people survive it and (2) start cranking out engineered babies who can survive.