Mutant Algae to Fuel Cars of Tomorrow?
Hugh Pickens writes "Algae has long been known as a promising source of biodiesel. It's worth noting, though, that algae also produces a small amount of hydrogen during photosynthesis. The MIT Technology Review reports that researchers have created a mutant algae that makes better use of sunlight to increase the amount of hydrogen that the algae produce. Anastasios Melis and his team at the University of California have manipulated the genes that control the amount of chlorophyll in the algae's chloroplasts. Although the process is still at least five years from being used for hydrogen generation, Melis estimates that if 50% of the algae's photosynthesis could be directed toward hydrogen production, an acre could produce 40 kilograms of hydrogen per day. At the price of $2.80 a kilogram, hydrogen could compete with gasoline, since a kilogram of hydrogen is equivalent in energy to a gallon of gasoline."
At $2.8 per Kg, this would be one of the cheapest ways yet to extract hydrogen, but it still leaves the problem of containing it in a vehicle, the cost of building the fuel cell or engine you'd burn it in, and so on. The fact is that gasoline has an incredible energy density by volume, and in absolute terms, it's still very, very cheap.
Something I find rather more promising is the work described in an earlier MIT review article, where bacteria are being modified to make gasoline directly. Just like petroleum-based gasoline, except that it's carbon-neutral, and sulphur-free. We're talking gasoline from anything that E. coli can ferment.
-jcr
The only title of honor that a tyrant can grant is "Enemy of the State."
Is it to much to ask to get reference links with more credibility than wikipedia? I mean, come on, is it really that hard to find a credible source to reference? For pete's sake even wikipedia claims it should /not/ be sourced as a cite, only a starting point.
Once it's produced, how do you store it? I confess that I now (sort of) work for evil "big oil" but I do have some experience with the practicalities of storing and transporting hydrogen.
Thats a pretty good question there! I'd recommend using Metastable Metallic Hydrogen personally, except there's a small issue that nobody has exactly figured out how to make the stuff yet.
That being said, I always thought that good old Ammonia (NH4) had some nice potential for hydrogen storage. Its easily liquefied at room temperature. There are a couple issues with Ammonia though. First, it tends to be rather poisonous, such that breathing in a good lung full of the pure gas would probably be fatal. Secondly, its a bit difficult to get it to react in a controlled fashion. Thirdly, it tends to explode violently sometimes, kind of unpredictably I gather. There's no doubt that Ammonia is an energy dense substance; however, exploiting it for a consumer energy material is somewhat problematic.
A safer alternative would be to saturate a carbon backbone with hydrogens, resulting in some kind of diesel or wax type fuel. That more or less puts us back where we started though, except now we have to expend extra energy to synthesize the stuff rather than just pumping it out of a hole. I suppose when the holes start going dry it might be an option...
Clickety Click
Hmm.. Or for 10 Gigawatts, you could use a solar plant about 10x10 miles in the Nevada desert. This sceme http://www.reuk.co.uk/Nevada-Solar-One.htm Delivers 64 Mw for 350 acres = 45 watts per sqr meter. 10 x10 miles = 260 000 000 m2, x 45 (watts) = 11.7 GigaWatt supply. Yup ok, day only - but you are charging car batteries, so you could work out a scheme that does that in the day. They reckon it costs around $0.07/Kwh.
You are right on one thing though - probably better to just generate & use electricity directly than to mess about with Hydrogen, etc. Think of all the plastic/glass you would need to contain the algea and collect the gas..
"A nation that forgets its past is doomed to repeat it." - Churchill
...then the governments of the developed world will find ways to:
a. stifle it while there's still fossil fuels to be had (ie with prohibitive taxation)
b. stifle the technology which utilises it (by classifying it for military use)
c. bud off private concerns (or use existing military contractors) who then go on a patent grab for said technology, making an example of anyone who tried it (yes, you, Mr. Hobbyist!)
d. license favoured concerns to (under)develop and (under)utilise the technology until such time as the oil becomes economically nonviable.
As a side note, I already use photovoltaics and gel storage to power my custom bike (so, sue me, Shell!). While it doesn't go 0-60 at the speed of thought, it does carry me and my laptop at a nice pace (20-40 depending on conditions). No petrol consumption at all there, and I get about two hours off of a cold charge with the panel off.
Operation Guillotine is in effect.
Corn was never meant to be the perpetual energy fuel feedstock. It is being done as a transition fuel feedstock while other technologies, like this algae for instance, or cellulosic ethanol from switchgrass, etc, develop. And it is because we are set up to produce corn (and soybeans) in mass quantities with no infrastructure changes right now today, this season, it's happening. Just like the vehicle changes, we are transitioning from straight gashogs to hybrids to eventually plug in hybrids and hydrogen fuel cells and straight electric drive, but that is still way down the road. This is the tech we have now, that's all, have to start someplace.
There's another bonus with oil producing algae, it can grow in brackish water and eat sewage.
What algae lacks is a powerful lobby in Washington like the corporate farms and corn sweetener have. It would also threaten a large volume of the petroleum supply chain. Since so much of our foreign policy seems centered around protecting Saudi Arabia's cash flow (when we're not arming Israel), I can't imagine our government getting behind algae production.
Not like energy independence should be a national strategic priority or anything.
It would mean we'd need to put more diesel vehicles on the road but who says we have to have a single source model? With the hydrogen bonus from the algae oil, a little ethanol to keep the farm lobby happy, and oil producing algae we could certainly retire a few of those super tankers in the oil pipeline.
With the right financial incentives and treating it like a strategic priority we could have large scale production online in five years. We could potentially be getting the majority of our transportation fuel from algae in ten years if we really committed to it. I don't mean a Bush commitment, I mean a Kennedy man-on-the-moon commitment.
That's our life, the big wheel of shit. - The Fat Man, Blue Tango Salvage
Biodiesel production also requires (or at least prefers) carefully bred strains with high oil production. This also leads to somewhat reduced fitness. Probably not as big a deal as these hydrogen producers, but still an issue.
What I can't seem to get anyone to explain is why we want a hydrogen economy anyway. Liquid fuel for vehicles seems like a much better plan. The only reason to go hydrogen is if you want to fuel vehicles with coal or nuclear plants, and even then, I think it is a better plan to convert they hydrogen to methane or methanol at the generation facility. Biodisel, on the other hand, seems nearly the optimal motor fuel.
Transportation, storage, transfer, and use of hydrogen are all difficult. All of those problems are solvable, but it seems like unnecessary cost and complexity to me.
Um, the hard sciences *are* the very basics because they're directly verifiable.
Which is why string theory isn't science.
If by "verify", you mean, "we can't go back in time to witness it", yes.
And if by "verify", you mean, "simplify global climate into a simple, testable experiment", yes. You can merely verify most (if not all) of the factors that make up the theory.
Reasonably true.
That's hardly the case. The problem is when hypotheses or conjectures are taken as accurate (instead of merely well-informed guesses) or when theories, after being disproven, are still viewed as accurate (even innaccurate ones (general relativity) can be useful when one recognizes and works around those innacuracies). Or, put another way, the very dangerous to science is when people think science always has an answer, instead of taking a more nuanced view of the situation (which is often, "I don't know").
Correction. It pushes the idea that eventually enough people will see problems and issue changes to correct those problems. The point of accuracy is supposed to come not from popularity but through proper citation (which itself is based squarely on verifiability, to the point that verifiability is more important than accuracy).
Perhaps you hadn't considered that that's what people view Wikipedia as? Consider that, instead of linking to a source directly, one can instead alter Wikipedia to include that source (assuming, of course, that the source is appropriate (ie, that it serves better than existing sources)) and link to the article so that you not only receive the source but also *other* sources as well. Of course, it might be wise to include Wikipedia *and* an appropriate source.
I somewhat agree. But, one of the main points of /. (and the web, in general) is to provide an easy means of linking things. Of course, one could aruge that such easy linking is something more suited for a web browser extension. Or, one could go to google news as a stream of news articles to filter through to find your own sources and avoid /. completely. In fact, googling something can be trivially easy at times, to the point that one could argue that citing anything is to mock one's audience. Clearly that's not true. So, while Wikipedia might not be the best source (directly), t
Eurohacker European paranoia, gun rights, and h
I work on Chlamydomonas (single celled eukaryotic algae) biochemistry.
These little fellas are tough. Give them a few basic nutrients (phosphates, trace minerals) sunlight and air and they will grow like weeds. They can be autotrophic (using light) or heterotrophic if you give them a carbon source (like those found in sewage and agricultural waste). People have also had great success growing these by bubbling the exhaust from incinerators through liquid cultures (exhaust is rich in CO2 and NOx which Chlamy can use). Chlamy has been extensively studied (the genome of C. reinhardtii has been sequenced) and there is a huge library of mutants already available. I saw a presentation at an algae conference last year by people working on this. Holy grail is getting hydrogen while they are growing, then extract oil.
Best of all, they are completely harmless (trust me, if they were in any way dangerous I would be dead by now).
Algal biodiesel and butanol from agricultural waste are our best hope. Ethanol from food crops is basically a big give-away to agribusiness companies. While hydrogen is promising, biologically derived liquid hydrocarbons can take advantage of the extensive infrastructure that has been built for petroleum fuels.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA