Slashdot Mirror
Mutant Algae to Fuel Cars of Tomorrow?
Hugh Pickens writes "Algae has long been known as a promising source of biodiesel. It's worth noting, though, that algae also produces a small amount of hydrogen during photosynthesis. The MIT Technology Review reports that researchers have created a mutant algae that makes better use of sunlight to increase the amount of hydrogen that the algae produce. Anastasios Melis and his team at the University of California have manipulated the genes that control the amount of chlorophyll in the algae's chloroplasts. Although the process is still at least five years from being used for hydrogen generation, Melis estimates that if 50% of the algae's photosynthesis could be directed toward hydrogen production, an acre could produce 40 kilograms of hydrogen per day. At the price of $2.80 a kilogram, hydrogen could compete with gasoline, since a kilogram of hydrogen is equivalent in energy to a gallon of gasoline."
If they can make this work I think it's great. The current U.S. consumption of oil is about 5.2 Million bb/d, and there is about 950 Million acres of farmland as of 2002. One barrel of crude equals about 42 gallons of gasoline according to this. So we can safely say that one acre is about a barrel of crude according TFA. I think that is very doable provided that it actually works. Much better solution than ethanol if you ask me, which has proven time and again that if we want to go with corn ethanol that there isn't enough farmland in the U.S. Now granted that 40kg is optimal so if we allow say 8 million acres for this I think we may even have a surplus of energy. That is the kind of idea I like to see.
"Some books contain the machinery required to create and sustain universes."-Tycho
At $2.8 per Kg, this would be one of the cheapest ways yet to extract hydrogen, but it still leaves the problem of containing it in a vehicle, the cost of building the fuel cell or engine you'd burn it in, and so on. The fact is that gasoline has an incredible energy density by volume, and in absolute terms, it's still very, very cheap.
Something I find rather more promising is the work described in an earlier MIT review article, where bacteria are being modified to make gasoline directly. Just like petroleum-based gasoline, except that it's carbon-neutral, and sulphur-free. We're talking gasoline from anything that E. coli can ferment.
-jcr
The only title of honor that a tyrant can grant is "Enemy of the State."
Is it to much to ask to get reference links with more credibility than wikipedia? I mean, come on, is it really that hard to find a credible source to reference? For pete's sake even wikipedia claims it should /not/ be sourced as a cite, only a starting point.
If "a kilogram of hydrogen is equivalent in energy to a gallon of gasoline" then, estimating about 400 million gallons of gas per day used by the US, we will need 10 million acres of algae farm. That is with the assumption that they obtain their optimal output, and no additional energy is expended for processing, transport, etc.
By contrast, an average nuclear power plant produces 1000 megawatts of energy. Also assuming optimum efficiency, we get (10^9 joules pers second * (60 * 60 *24) seconds per day / (237.1*10^3 joules to electrolyze 1 mole of hydrogen at 298K) * 1.01 grams/mole = 368,047 kilograms of hydrogen per day.
So... 10 nuclear plants, or 10 million acres of algae farm?
Let's not forget that your algae farm will stop photosynthesizing when it's cloudy out.
When things get complex, multiply by the complex conjugate.
A major reason why this won't ever be as economical as biodiesel production is that this requires mutant algae, as you said. This means the culture needs to be kept isolated from the outside world to keep it pure (the mutants have reduced fitness compared to wildtype algae).
Biodiesel, on the other hand, is produced by wildtype algae that are capable of holding their own against competing organisms.
If I had more time, I'd dig up photos of the respective bioreactor design. Hydrogen production requires sealed, sterile, glass containers, while biodiesel production simply requires an irrigated ditch.
"A week in the lab saves an hour in the library"
Why do people keep saying this? It's like they don't actually understand why fossil fuels contribute to the greenhouse effect.
Look, carbon that's locked away underground in the form of fossil fuels isn't part of the carbon cycle. It's been sequestered by geological processes for millions of years, removing it from the air. When we dig it up and burn it, we bring it back into circulation. The total amount of airborne carbon increases; the greenhouse effect gets stronger. This is, in a nutshell, anthropic global warming.
Carbon that's already in the atmosphere can be trapped by photosynthesis. If the plant that trapped the carbon is then burned, or eaten, or even if it just dies and rots, the carbon returns to the air. This is the regular carbon cycle, with or without human intervention, and it doesn't alter the net balance of Co2. It's this process that we employ when we make biodiesel.
Biodiesel doesn't contribute to global warming. At all. The "bio" part means the hydrocarbons were synthesized from plant matter; the carbon in those hydrocarbons came from airborne Co2. As long as you plant biofuel crops, process them, and burn them, the total amount of airborne Co2 will never increase. Every ounce of carbon added to the air is matched by an ounce of carbon removed from the air by the fuel plantation.
Erotic is when you use a feather. Exotic is when you use the whole chicken.
Once it's produced, how do you store it? I confess that I now (sort of) work for evil "big oil" but I do have some experience with the practicalities of storing and transporting hydrogen.
Thats a pretty good question there! I'd recommend using Metastable Metallic Hydrogen personally, except there's a small issue that nobody has exactly figured out how to make the stuff yet.
That being said, I always thought that good old Ammonia (NH4) had some nice potential for hydrogen storage. Its easily liquefied at room temperature. There are a couple issues with Ammonia though. First, it tends to be rather poisonous, such that breathing in a good lung full of the pure gas would probably be fatal. Secondly, its a bit difficult to get it to react in a controlled fashion. Thirdly, it tends to explode violently sometimes, kind of unpredictably I gather. There's no doubt that Ammonia is an energy dense substance; however, exploiting it for a consumer energy material is somewhat problematic.
A safer alternative would be to saturate a carbon backbone with hydrogens, resulting in some kind of diesel or wax type fuel. That more or less puts us back where we started though, except now we have to expend extra energy to synthesize the stuff rather than just pumping it out of a hole. I suppose when the holes start going dry it might be an option...
Clickety Click
Let me introduce you to an advanced technology vehicle I've been researching for years. It runs on nothing but pure cellulose in form of grass and so is very environmentally friendly. I call it a "horse". It requires no fossil fuels and is surely the transportation of the future.
...then the governments of the developed world will find ways to:
a. stifle it while there's still fossil fuels to be had (ie with prohibitive taxation)
b. stifle the technology which utilises it (by classifying it for military use)
c. bud off private concerns (or use existing military contractors) who then go on a patent grab for said technology, making an example of anyone who tried it (yes, you, Mr. Hobbyist!)
d. license favoured concerns to (under)develop and (under)utilise the technology until such time as the oil becomes economically nonviable.
As a side note, I already use photovoltaics and gel storage to power my custom bike (so, sue me, Shell!). While it doesn't go 0-60 at the speed of thought, it does carry me and my laptop at a nice pace (20-40 depending on conditions). No petrol consumption at all there, and I get about two hours off of a cold charge with the panel off.
Operation Guillotine is in effect.
Corn was never meant to be the perpetual energy fuel feedstock. It is being done as a transition fuel feedstock while other technologies, like this algae for instance, or cellulosic ethanol from switchgrass, etc, develop. And it is because we are set up to produce corn (and soybeans) in mass quantities with no infrastructure changes right now today, this season, it's happening. Just like the vehicle changes, we are transitioning from straight gashogs to hybrids to eventually plug in hybrids and hydrogen fuel cells and straight electric drive, but that is still way down the road. This is the tech we have now, that's all, have to start someplace.
In general, by genetically modifying something we make it less fit in a survival sense. Look at all the plants and animals we've domesticated for our use by hybridization. They hardly run rampant destroying their wild cousins. In fact they'd be dead without our help, because we've reduced their fitness by making them overproduce some aspect we are interested in. This algae is no different. The modification actually makes each cell absorb less light so it absorbs only what it can use allowing the sunlight to be spread over more cells. So this algae is less competitive than its wild "light-hogging" cousins.
> Wikipedia, the concept that persistent opinions are accurate opinions
Persistent opinions ARE accurate opinions in many fields (to the best of human knowledge), and in other fields they're not.
The only strong "limitation" of Wikipedia's model is that it requires readers to understand which field falls into which category. If you wish to accuse Wikipedia of not being 100% useful to totally non-perceptive readers, then yes you're right, one would have to agree with you. It's only useful to totally non-perceptive readers when they happen to be reading pages of the first kind, not the second. But those who are perceptive know how much to trust both kinds of article.
The types of fields in which persistent opinions are accurate opinions are those ruled by verifiable fact, the rule of mathematics and logic, and cooperative progress through explicit reasoning, not through debate. That includes mathematics and logic themselves, plus all the hard sciences and branches of engineering. It excludes almost everything else, even many fields that try to employ logical discourse (eg. about 95% of philosophy is excluded). And even harsher than this, it also excludes personal opinion within the included fields: for example, it excludes personal interpretations in climatology and claimed predictions for the future, while including the very scientific fact finding and analysis in that field of science.
To those who understand the above, Wikipedia is an invaluable resource, because (apart from occasional human error and abuse, which are both rapidly corrected) the entries are all made cooperatively and all new progress builds upon past progress. Thus, the entries that persist represent the current peak of human understanding.
This contrasts markedly with the other kind of fields, in which personal opinion, claimed experience, authoritative position, and vocal statements matter. Yes, you can't trust anything that you read in those fields on Wikipedia, but that's not Wikipedia's problem. You can't trust what you read about those field on any other forum or means of communication either.
So, if you have a problem with trusting Wikipedia, it's either because you work in fields of the second kind (and hence you're part of the problem), or else because you fail to understand how human endeavour is split into those two very different categories and so you don't apply suitably varying degrees of trust.
It's your problem, not ours on the science and engineering side. Wikipedia serves us well.
"The question of whether machines can think is no more interesting than [] whether submarines can swim" - Dijkstra
This ceases to be true when biofuels become totally self sufficient. This means that fertiliser plants, the plants that manufacture everything used in the biofuel production cycle, storage etc., are all being entirely fuelled by their own product.
For this reason, for many years to come, biodiesel has to be the preferred route. This is because the huge installed base of plant can mostly run on it; you can do process heating with biodiesel as well as run generators, trucks and ships. You can, as it were, bootstrap the biodiesel economy, whereas you cannot bootstrap the ethanol or hydrogen economies. Steel plants and machine shops cannot run on either.
Hydrogen is attractive to the vehicle industry not because it is efficient but because it requires replacement of the entire vehicle fleet and would provide a boost to the industry. Biodiesel allows the existing fleet to be replaced much more slowly, with the same emissions benefits.
One of the simplest ways to reduce anthropogenic global warming is just to use less energy. One of the best ways to do that is to make consumer durables last longer, and make them out of readily recyclable materials. But that threatens the entire basis of the US-Chinese industrial complex, whereas hydrogen offers it greatly increased opportunities to expand.
Pining for the fjords
Biodiesel production also requires (or at least prefers) carefully bred strains with high oil production. This also leads to somewhat reduced fitness. Probably not as big a deal as these hydrogen producers, but still an issue.
What I can't seem to get anyone to explain is why we want a hydrogen economy anyway. Liquid fuel for vehicles seems like a much better plan. The only reason to go hydrogen is if you want to fuel vehicles with coal or nuclear plants, and even then, I think it is a better plan to convert they hydrogen to methane or methanol at the generation facility. Biodisel, on the other hand, seems nearly the optimal motor fuel.
Transportation, storage, transfer, and use of hydrogen are all difficult. All of those problems are solvable, but it seems like unnecessary cost and complexity to me.
Can you get enough sun light and CO2 in your backyard?
Assuming you have 10 square meters yard, the sun shine's energy input is 1000W per square meter, you get 10 hours of sun shine per day, then you have 100,000Wh energy input. Assume 10% photosynthesis energy convert efficiency (this assumption is too high, 1%-5% is better but for the ease of calculation, I will use 10%), you will get 10,000Wh energy into hydrogen, that's 36MJ.
One kilogram of hydrogen has 143MJ of energy. Then to produce 1kg of hydrogen, you will need 40 sqare meters of yard, to produce 4 kg of hydrogen, you will need 160 square meters of yard, that's 1700 sqare feet. Remember we are assuming 1000W sun light input and 10% conversion here, both are too high.
I don't think we need to calculate the CO2 input now.
There is a spark in every single flame bait point.
That's without considering that the entire planet would be given over to growing grass. Unlike cars, horses consume a lot of fuel even when going nowhere. You have to be quite well off to be an Amish.
Pining for the fjords
I work on Chlamydomonas (single celled eukaryotic algae) biochemistry.
These little fellas are tough. Give them a few basic nutrients (phosphates, trace minerals) sunlight and air and they will grow like weeds. They can be autotrophic (using light) or heterotrophic if you give them a carbon source (like those found in sewage and agricultural waste). People have also had great success growing these by bubbling the exhaust from incinerators through liquid cultures (exhaust is rich in CO2 and NOx which Chlamy can use). Chlamy has been extensively studied (the genome of C. reinhardtii has been sequenced) and there is a huge library of mutants already available. I saw a presentation at an algae conference last year by people working on this. Holy grail is getting hydrogen while they are growing, then extract oil.
Best of all, they are completely harmless (trust me, if they were in any way dangerous I would be dead by now).
Algal biodiesel and butanol from agricultural waste are our best hope. Ethanol from food crops is basically a big give-away to agribusiness companies. While hydrogen is promising, biologically derived liquid hydrocarbons can take advantage of the extensive infrastructure that has been built for petroleum fuels.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA