Slashdot Mirror


Mutant Algae to Fuel Cars of Tomorrow?

Hugh Pickens writes "Algae has long been known as a promising source of biodiesel. It's worth noting, though, that algae also produces a small amount of hydrogen during photosynthesis. The MIT Technology Review reports that researchers have created a mutant algae that makes better use of sunlight to increase the amount of hydrogen that the algae produce. Anastasios Melis and his team at the University of California have manipulated the genes that control the amount of chlorophyll in the algae's chloroplasts. Although the process is still at least five years from being used for hydrogen generation, Melis estimates that if 50% of the algae's photosynthesis could be directed toward hydrogen production, an acre could produce 40 kilograms of hydrogen per day. At the price of $2.80 a kilogram, hydrogen could compete with gasoline, since a kilogram of hydrogen is equivalent in energy to a gallon of gasoline."

4 of 158 comments (clear)

  1. Nice work, but... by jcr · · Score: 3, Interesting

    At $2.8 per Kg, this would be one of the cheapest ways yet to extract hydrogen, but it still leaves the problem of containing it in a vehicle, the cost of building the fuel cell or engine you'd burn it in, and so on. The fact is that gasoline has an incredible energy density by volume, and in absolute terms, it's still very, very cheap.

    Something I find rather more promising is the work described in an earlier MIT review article, where bacteria are being modified to make gasoline directly. Just like petroleum-based gasoline, except that it's carbon-neutral, and sulphur-free. We're talking gasoline from anything that E. coli can ferment.

    -jcr

    --
    The only title of honor that a tyrant can grant is "Enemy of the State."
  2. Re:The requirements... by eniac42 · · Score: 4, Interesting

    Hmm.. Or for 10 Gigawatts, you could use a solar plant about 10x10 miles in the Nevada desert. This sceme http://www.reuk.co.uk/Nevada-Solar-One.htm Delivers 64 Mw for 350 acres = 45 watts per sqr meter. 10 x10 miles = 260 000 000 m2, x 45 (watts) = 11.7 GigaWatt supply. Yup ok, day only - but you are charging car batteries, so you could work out a scheme that does that in the day. They reckon it costs around $0.07/Kwh.

    You are right on one thing though - probably better to just generate & use electricity directly than to mess about with Hydrogen, etc. Think of all the plastic/glass you would need to contain the algea and collect the gas..

    --
    "A nation that forgets its past is doomed to repeat it." - Churchill
  3. Re:transition by SunTzuWarmaster · · Score: 4, Interesting

    No one ever seems to remember sugar cane and sugar beets, so I'll point it out. They are double the yield per acre (vastly more efficient but harder to grow) as compared to American corn.

    Well that's not entirely true, Brazil didn't forget. But then again, they don't have corn lobbyists.

  4. Chlamydomonas by primenerd · · Score: 3, Interesting

    I work on Chlamydomonas (single celled eukaryotic algae) biochemistry.
    These little fellas are tough. Give them a few basic nutrients (phosphates, trace minerals) sunlight and air and they will grow like weeds. They can be autotrophic (using light) or heterotrophic if you give them a carbon source (like those found in sewage and agricultural waste). People have also had great success growing these by bubbling the exhaust from incinerators through liquid cultures (exhaust is rich in CO2 and NOx which Chlamy can use). Chlamy has been extensively studied (the genome of C. reinhardtii has been sequenced) and there is a huge library of mutants already available. I saw a presentation at an algae conference last year by people working on this. Holy grail is getting hydrogen while they are growing, then extract oil.
    Best of all, they are completely harmless (trust me, if they were in any way dangerous I would be dead by now).
    Algal biodiesel and butanol from agricultural waste are our best hope. Ethanol from food crops is basically a big give-away to agribusiness companies. While hydrogen is promising, biologically derived liquid hydrocarbons can take advantage of the extensive infrastructure that has been built for petroleum fuels.

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA