Slashdot Mirror
Mutant Algae to Fuel Cars of Tomorrow?
Hugh Pickens writes "Algae has long been known as a promising source of biodiesel. It's worth noting, though, that algae also produces a small amount of hydrogen during photosynthesis. The MIT Technology Review reports that researchers have created a mutant algae that makes better use of sunlight to increase the amount of hydrogen that the algae produce. Anastasios Melis and his team at the University of California have manipulated the genes that control the amount of chlorophyll in the algae's chloroplasts. Although the process is still at least five years from being used for hydrogen generation, Melis estimates that if 50% of the algae's photosynthesis could be directed toward hydrogen production, an acre could produce 40 kilograms of hydrogen per day. At the price of $2.80 a kilogram, hydrogen could compete with gasoline, since a kilogram of hydrogen is equivalent in energy to a gallon of gasoline."
If they can make this work I think it's great. The current U.S. consumption of oil is about 5.2 Million bb/d, and there is about 950 Million acres of farmland as of 2002. One barrel of crude equals about 42 gallons of gasoline according to this. So we can safely say that one acre is about a barrel of crude according TFA. I think that is very doable provided that it actually works. Much better solution than ethanol if you ask me, which has proven time and again that if we want to go with corn ethanol that there isn't enough farmland in the U.S. Now granted that 40kg is optimal so if we allow say 8 million acres for this I think we may even have a surplus of energy. That is the kind of idea I like to see.
"Some books contain the machinery required to create and sustain universes."-Tycho
At $2.8 per Kg, this would be one of the cheapest ways yet to extract hydrogen, but it still leaves the problem of containing it in a vehicle, the cost of building the fuel cell or engine you'd burn it in, and so on. The fact is that gasoline has an incredible energy density by volume, and in absolute terms, it's still very, very cheap.
Something I find rather more promising is the work described in an earlier MIT review article, where bacteria are being modified to make gasoline directly. Just like petroleum-based gasoline, except that it's carbon-neutral, and sulphur-free. We're talking gasoline from anything that E. coli can ferment.
-jcr
The only title of honor that a tyrant can grant is "Enemy of the State."
If "a kilogram of hydrogen is equivalent in energy to a gallon of gasoline" then, estimating about 400 million gallons of gas per day used by the US, we will need 10 million acres of algae farm. That is with the assumption that they obtain their optimal output, and no additional energy is expended for processing, transport, etc.
By contrast, an average nuclear power plant produces 1000 megawatts of energy. Also assuming optimum efficiency, we get (10^9 joules pers second * (60 * 60 *24) seconds per day / (237.1*10^3 joules to electrolyze 1 mole of hydrogen at 298K) * 1.01 grams/mole = 368,047 kilograms of hydrogen per day.
So... 10 nuclear plants, or 10 million acres of algae farm?
Let's not forget that your algae farm will stop photosynthesizing when it's cloudy out.
When things get complex, multiply by the complex conjugate.
Why do people keep saying this? It's like they don't actually understand why fossil fuels contribute to the greenhouse effect.
Look, carbon that's locked away underground in the form of fossil fuels isn't part of the carbon cycle. It's been sequestered by geological processes for millions of years, removing it from the air. When we dig it up and burn it, we bring it back into circulation. The total amount of airborne carbon increases; the greenhouse effect gets stronger. This is, in a nutshell, anthropic global warming.
Carbon that's already in the atmosphere can be trapped by photosynthesis. If the plant that trapped the carbon is then burned, or eaten, or even if it just dies and rots, the carbon returns to the air. This is the regular carbon cycle, with or without human intervention, and it doesn't alter the net balance of Co2. It's this process that we employ when we make biodiesel.
Biodiesel doesn't contribute to global warming. At all. The "bio" part means the hydrocarbons were synthesized from plant matter; the carbon in those hydrocarbons came from airborne Co2. As long as you plant biofuel crops, process them, and burn them, the total amount of airborne Co2 will never increase. Every ounce of carbon added to the air is matched by an ounce of carbon removed from the air by the fuel plantation.
Erotic is when you use a feather. Exotic is when you use the whole chicken.
No one ever seems to remember sugar cane and sugar beets, so I'll point it out. They are double the yield per acre (vastly more efficient but harder to grow) as compared to American corn.
Well that's not entirely true, Brazil didn't forget. But then again, they don't have corn lobbyists.
I live in sugar beet country and I can assure you that we didn't forget, I'm also in corn country so that gets a lot of noise as well. The real answer will be more like
1. grow the corn,
2. grow the beets,
3. press out the oils out of the corn for food use,
4. reclaim the used food stuff oils aned animal fats for biodiesel,
5 extract the sugars from the corn, feed the distiller's dried grain and roughage back to the cows (makes food and animal fat for step 4)
6. add beet sugar to the corn sugar and make Butanol instead of inefficient Ethanol
7. profit!
I don't think there will ever be a one answer answer; the answer will be multi-use feed the waste of one almost economical process to the next almost economical process.
Apocalypse Cancelled, Sorry, No Ticket Refunds
I work on Chlamydomonas (single celled eukaryotic algae) biochemistry.
These little fellas are tough. Give them a few basic nutrients (phosphates, trace minerals) sunlight and air and they will grow like weeds. They can be autotrophic (using light) or heterotrophic if you give them a carbon source (like those found in sewage and agricultural waste). People have also had great success growing these by bubbling the exhaust from incinerators through liquid cultures (exhaust is rich in CO2 and NOx which Chlamy can use). Chlamy has been extensively studied (the genome of C. reinhardtii has been sequenced) and there is a huge library of mutants already available. I saw a presentation at an algae conference last year by people working on this. Holy grail is getting hydrogen while they are growing, then extract oil.
Best of all, they are completely harmless (trust me, if they were in any way dangerous I would be dead by now).
Algal biodiesel and butanol from agricultural waste are our best hope. Ethanol from food crops is basically a big give-away to agribusiness companies. While hydrogen is promising, biologically derived liquid hydrocarbons can take advantage of the extensive infrastructure that has been built for petroleum fuels.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA