Slashdot Mirror

← Back to Stories (view on slashdot.org)

Encyclopedia of Life Launches First 30,000 Pages

Posted by kdawson on from the sure-is-loud-in-here dept.

An anonymous reader writes to let us know that the Encyclopedia of Life opened up to the public today with its first 30,000 pages in place — and, according to the AP, promptly crumbled even before being Slashdotted. (The site seems fine now.) We discussed this project last year when it was announced. The Telegraph has an overview of the launch, and reports that only 25 "exemplar" pages on the site are fully fleshed out to the extent scientists hope eventually to attain for all species; the other few tens of thousands are expanded placeholders. The project hopes to begin taking input from citizen-scientists late this year.

22 of 87 comments (clear)

  1. 30000 pages... by joaommp · · Score: 3, Interesting

    now that's going to take a long time to fill...

    I can see it now, like in wikipedia... about 1/10 of the articles are stubs... they mark it as stubs and no one ever remembers to fill them. I would fill them, problem is, I only found the stubs because I was actually searching for that information... not because I had it.

    --
    Onda Technology Institute
  2. Dupe? by Wolfbone · · Score: 2, Insightful

    Not the story - the project. What I mean is: how is this new project related to this one: http://tolweb.org/ if at all?

    1. Re:Dupe? by banana+fiend · · Score: 5, Informative

      They are separate projects, with TOL being less well funded basically, and smaller in scope. I believe that TOL have shared their data with EOL.

      --
      Johns: Well, how does it look now? Riddick: Looks clear.
    2. Re:Dupe? by esocid · · Score: 4, Informative

      Let's try that again with the link this time.
      From this page here at ToL, you can see that there is a collaboration between efforts as to not overlap in data. It also states that the goals of each are slightly different in that EOL focuses more on specific species, whereas the ToL is more about phylogenetic classifications and evolutionary branches. I've been looking into the National Science Foundation's AToL program recently because of an offer for grad school which is due to a grant from that specific program and I'm curious what, if any, connection there is between the two.

      --
      Absolute power corrupts absolutely. indymedia
  3. ONLY 30000? by polar+red · · Score: 3, Interesting

    Only 30000?
    There are Tens of millions of different species on earth - Flowering plants ALONE are numbering 250000!
    there is another similar project called tree of life

    --
    Yes, I'm left. You have a problem with that?
    1. Re:ONLY 30000? by rucs_hack · · Score: 2, Interesting

      Well, I can cover several tens of millions of those species in one sentence:

      GGCAGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGC

      Specifically, a Core Promoter as shared by almost all Eukaryotes.

      Where each species differs by one or two characters. I guess you could work it out in terms of Hamming Distance..

  4. Re:180? by llirik · · Score: 5, Informative

    Try http://eol.org/ not http://www.eol.org/. Yeah, how dumb is that? Could be a bug in their firefox support though.

  5. an unfortunate domainname by wereHamster · · Score: 4, Funny

    eol.org, all I can see in it is 'end of life'

    1. Re:an unfortunate domainname by traveller.ct · · Score: 5, Funny

      For a moment I actually read that as "end of line".org. Maybe I should go get a life?

      --
      For the lack of a better sig.
  6. Download and license by oever · · Score: 5, Interesting

    So where can we download this data and what is the license?

    The data from tolweb.org are downloadable under a Creative Commons license.

    --
    DNA is the ultimate spaghetti code.
  7. Re:Wikipedia, anyone? by Rakshasa+Taisab · · Score: 4, Funny

    Wouldn't it be better if citizen-scientists concentrated in improving and expanding wikipedia articles on animals? Because the elephant population has, in fact, _NOT_ tripled the past few years.
    --
    - These characters were randomly selected.
  8. Re:Wikipedia, anyone? by owlnation · · Score: 2, Insightful

    Because the elephant population has, in fact, _NOT_ tripled the past few years.
    Exactly, and in all seriousness there is so much sleaze, agenda-ism, corruption and mismanagement in Wikipedia (already well documented, and proven here), that it is far better to start a new project that has a chance of not making the same mistakes. One that has a chance of maintaining a good reputation and high standards, something Wikipedia has completely failed to do.

    This project sounds like a great idea -- and if nothing else it is ALWAYS good to have competition.
  9. Great effort by Psychotria · · Score: 4, Insightful

    My love of the "natural" sciences is not something I hide. My respect for E.O.Wilson is also something I do not hide. Wilson frequently mentions his wish for this project to become true, and I can understand his reasons for doing so. Wilson, I admit, is not without critics (but who of us are?). I only mention Wilson because this is a project he has often spoken of. Despite varying opinions on him, he DOES believe in biological information (and, yes, probably data) for the masses. Not to mention that he has a writing style to die for...

    Anyway, back on topic. This project is grand in its scope and bold in its objectives. Whether it fails or succeeds is beside the point really... the project is a challenge to all of science and is quite like open-source software. The more shoulders (of giants) we can sit on, the better the end result will be.

    Great project. Worthwhile project. I take my hat off to all involved. Thank-you.

  10. Re:Elitest Wikipedia? by wonnage · · Score: 4, Informative

    Way to beat on that straw-man... Besides, if you bothered to read the article: "There are also tens of thousands of additional species pages not authenticated by scientists but still containing a wealth of information. Later this year the public will be able to contribute text, videos, images, and other information about a species and the best of it will be incorporated into the authenticated pages." By the way, it's spelled "elitist".

  11. Badly designed... by red+star+hardkore · · Score: 5, Informative

    It's slow, only has demonstration pages and is extremely badly designed.

    As somebody has already mentioned, images don't have alt tags, but also there are tables used for layout (with many empty rows/cols for no apparent reason) and there are image maps. The site uses an XHTML doctype, but isn't valid XHTML. There are missing slashes for closing single tags. The divs for the popups are contained outside the body tags, that's NOT ALLOWED!

    That's all I see, what about anybody else?

    1. Re:Badly designed... by sjaguar · · Score: 2, Informative

      Yeah, since everything is an image, it is a PITA to copy (quote) text. And, with a 30 second+ load time, it is unusable.

      --
      If at first you don't succeed, call it version 1.0.
    2. Re:Badly designed... by Psychotria · · Score: 4, Insightful

      You're correct of course. But look beyond the HTML/XHTML... This project isn't about that, it's about sharing of biological information and data.

      That's all I see, what about anybody else?

      Well, actually, I see much more. I see a project that seeks to gather every single scrap of data or information about every single taxon on Earth; a database of LIFE, of everything that we know about organisms that share this planet with us. At this point I can gloss over the malformed pages etc etc... that will sort itself out in time. The important thing is that the information and data is available.

    3. Re:Badly designed... by Stooshie · · Score: 2, Informative

      If you look at the site they are currently looking for programmers to work with them.

      --
      America, Home of the Brave. ... .and the Squaw.
    4. Re:Badly designed... by juhaz · · Score: 3, Insightful

      You're correct of course. But look beyond the HTML/XHTML... This project isn't about that, it's about sharing of biological information and data. If someone criticized building a skyscraper on mud would you dismiss them as irrelevant and tell it isn't about that, it's about building the tallest building in the world?

      You can't "look beyond" the foundations of something. The data is useless if it's so bad it can't be easily worked on, and the information might as well not exist if it's hidden in the bad data.
  12. oh, flash-tastic! by dwater · · Score: 5, Insightful

    More flash crap.

    "Oh good, the page has finished loading. Bollocks, there's still some flash left to load."

    Will we ever be free of this crap?
    It's made a sort of 'two-stage' internet - load the html, then load the flash baggage.

    --
    Max.
  13. Re:Wikipedia, anyone? by Anonymous Coward · · Score: 2, Insightful

    sleaze, agenda-ism, corruption and mismanagement in Wikipedia (already well documented, and proven here), that it is far better to start a new project that has a chance of not making the same mistakes. Those are the hallmarks of people. So where are you planning on finding the aliens or AIs to run your new fairy tale project, because that would be only way to start one that will not make them? (not just _chance_, mind you, it's inevitable)
  14. citizen-scientists? by sm62704 · · Score: 2, Interesting

    WTF is a "citizen-scientist"? Isn't this encyclopedia on the internet? Then what country are these citizen-scientists citizens of? Aren't all scientists citizens of some country or another?

    Do you mean amateur scientists? Some people refuse to call a spade a spade, referring to it as a "pointy shovel", but you're calling it a "bonk-digger".

    --
    mcgrew's razor: Never attribute to stupidity that which can be explained by greedy self-interest