Review of Discovery Institute's Evolution Textbook
Darwinned writes "Intelligent Design is still a hot topic, as evidenced by recent legislation mandating that it be taught in school. Pro-ID group Discovery Institute has released an evolution textbook for use in schools, but a review shows it to be chock full of bad science and questionable reasoning. 'The book doesn't only promote stupidity, it demands it. In every way except its use of the actual term, this is a creationist book, but its authors are expecting that legislators and the courts will be too stupid to notice that, or to remember that the Supreme Court has declared teaching creationism an unconstitutional imposition of religion.'"
The grandparent was probably referring to Edwards v. Aguillard.
I read the internet for the articles.
Darwin's Black Box was shown to be wrong in the Dover trial. Behe's central premise that things are irreducibly complex was proven wrong both with hard scientific data (about the flagella being irreduceably complex, but the bacterial Type III secretory system has a subset of the parts, though they serve a different function) and logically (Behe says a mousetrap is irreducibly complex, but it is useful as a tie clip if you remove two key parts).
The judge in the Dover trial summed it up by saying:
WTF are you talking about? ... ? Random number generators? Do you have an alternate explanation for Polymerase Chain Reaction? Well then, if you agree with DNA sequencing, how do you explain that everything we sequence fits just right with evolutionary theory?
Why do you think Evolution is on less solid grounds than, say, quantum theory or heliocentrism?
For heliocentrism, we have probes and satellites taking nice pictures.
For evolution, we have fossils backed by geology, chemistry, atomic physics and so on; we also have ****DNA*** fucking SEQUENCING. Where do you think biologist get those ATTAACGGGCGTGTAAGGCGTGAAA
Evolution is much more obvious than most of quantum physics or relativity. Do you also have an opinion about frame dragging or black body radiation? What about tunnel effect?
What does your bible (or whatever source of superstition is it you use) say about the wave-particle duality? Isn't THAT weirder than natural selection? C'm'on, genes mutate and unfit individuals don't get to reproduce. That's straightforward. But Hawking's radiation? The Standard Model? Is more or less problematic to you than the evolution of species by the means of natural selection?
And we both agree that alchemy shouldn't be taught in the classroom, are you going to ask that chemistry, too, be withheld? What about astrology and astronomy?
The Riddle of Epicurus
~~~~~~~~~~~~~
If God is willing to prevent evil, but is not able to
Then He is not omnipotent.
If He is able, but not willing
Then He is malevolent.
If He is both able and willing
Then whence cometh evil?
If He is neither able nor willing
Then why call Him God?
~~~~~~~~~~~~~~
Back on topic, the Discovery institute is dedicated solely to enriching its members, any other claim is nonsense.
A learning experience is one of those things that say, 'You know that thing you just did? Don't do that.' - D. Adams
About halfway down the page fyi.
I don't live in the US, but have read heaps about this topic. My real question is why the subject is even being considered being added to the US school curriculum.
Money.
Seriously, televangelists have made bucketloads of cash by making people feel like they are persecuted or like "those people" are trying to force them to change. Politicians get elected using the same. They use that money to market misinformation and undermine education. It's just a way to make money and gain power.
In most countries there is not a lot of profit in misinforming citizens in that way, so no one does it and said misinformation is less intentional. Marketing works if it is well funded which is why the US is slightly less educated than Latvia on the topic of evolution. The same phenomenon can be seen in both the US and (to a lesser extent) the UK on the topic of global warming. There isn't a lot of serious scientific debate on the fundamentals of either issue, but due to huge marketing expenditures, there's a lot of debate and disagreement among the average people, who don't read scientific journals or critically assess facts, but who do watch TV and believe some of what they see.
Just like gravity
False
Citation needed
What's unconstitutional is putting it into the science curriculum at public schools (violating the establishment clause of the first amendment). As far as "forcing people to teach ____," all public school curriculum is "forced" on teachers in the sense that it is established at the state and local government level.
"... as evidenced by recent legislation mandating that it be taught in school. ..."
And I said "WHAT?"
So I clicked on the link... and it says "The US state of Louisiana has passed the 'Science Education Act,' a piece of legislation that could allow Intelligent design to be taught in schools."
And this is why we will never get anywhere trying to intelligently discuss anything; either about education, politics, any contentious issue... because I honestly believe that this is how "ScuttleMonkey" sees it; when people disagree with something, they paint it as the most extreme, worst exaggeration... it's not that I agree with it, this book, or ID, it's that people become blinded when they get "religious" about a topic (no pun intended).
Stupid sexy Flanders.
Piyush Jinda, Governor of Louisiana (George Bush with a funny name, if you ask me) is trying to sneak this shit right back in.
Louisiana: Last on the good lists, first on the bad lists, and determined to keep it that way.
I can say that because I'm a rare escapee from that temple to ignorance. Still, it's a lot of fun to visit the Bayou State.
From the summary:
It's only a hot topic here in the United States. In the rest of the civilized world, ID is dismissed as the nonsense it is.
This ain't rocket surgery.
I'm not sure how best to explain it so I'll try with a simple example.
Let's say the structure you're trying to evolve can be represented as ABC. The letters are different parts. Together, ABC performs some useful function. Maybe it senses light, or moves the organism, or converts energy. Doesn't matter.
Now imagine that AB and BC are both useless constructs. The stance of the IDers is that ABC would have to evolve from constituent parts, by starting with one letter and adding more until ABC is achieved. But, they claim, since both AB and BC are useless, they would never evolve, and so ABC could never come to be. Therefore, the existence of ABC in an organism is, essentially, proof that God Did It.
However, imagine if C is some sort of useful construct all by itself. The actual function of C could be completely different from the function of ABC, it just has to be useful in some fashion. Then we add D, another part which is not part of ABC, to form CD. Imagine that CD is also useful in some manner, potentially related to C, potentially not. Then B is added which gives it more of a useful function, so organisms have the useful construct BCD. Then A is added to give the final functionality in the more complex form of ABCD. Then D, being redundant, is eventually dropped from the organism. Therefore you have evolved the useful and "irreducibly complex" construct ABC from parts.
If you mod me Overrated, you are admitting that you have no penis.
It's not falsifiable because it relies on an intelligent designer which, by definition, cannot be proven not to exist.
You've almost got this right, but your argument doesn't work as it stands. Observe:
Quantum mechanics is not falsifiable because it relies on the number 1, which cannot be proven not to exist.
See the problem? There are plenty of reasons why ID is not science, but this is not one of them. Another example:
My theory involves invisible pink elephants, undetectable elves, and other universes which do not interact even indirectly with ours. It unequivocally predicts that the sky is green and not blue.
This theory is science because it makes a falsifiable prediction. It relies on unfalsifiable constructs, but it is still itself falsifiable and therefore science.
SIGSEGV caught, terminating
wait... not that kind of sig.
Serbs with their hateful xtian idealogy
You're wrong here, it was Catholic Croats collaborating with NAZIs who persecuted Orthodox Serbians. More recently the Albanians, especially the KLA, Kosovo Liberation Army, were persecuting Serbians and others. And the KLA deals in opium with an idea of a Greater Albania.
It's not just Serbians who are instigating violence.
Falcon
Should there be a Law?
Possibly Carter's "Crisis of Confidence" speech? http://www.pbs.org/wgbh/amex/carter/filmmore/ps_crisis.html
This is the one that people continue to mock by saying that Carter "told people to wear a sweater" (but he didn't specifically say that at all).
Sigh...
All the YEC apologists I've encountered believe in a deity who is incapable of deception. Their deity didn't make the world appear old even though it was young, they believe the earth IS young and all the science we rely upon is flawed.
The Pastafarians are the ones who claim the earth is young, but the FSM made it appear old.
Learn something new.
Oh goodie! A fundie!
"Evolution is mostly popular because many atheists think it can discount the first two pages of the bible, thereby disproving god forever"
First, we'll start with that... um... mess. Evolution isn't popular because it furthers an agenda for atheists. Atheists are a minority. The majority of people, who believe evolution describes the diversity of life, and who live in the United States are... drumroll... Christians. That's right, you crazy Christians are the majority of proponents of evolution. Also, atheism existed long before Charles Darwin wrote about evolution. The word "atheism" comes from an ancient Greek word meaning "without god".
Or that, chemically and mathematically, life on Earth only has a 1:1,200,000,000,000,000,000 chance of happening the way evolutionists predict?
I'm assuming you're calculating that based on the number of atoms in every molecule in a protein or amino acid or something. Chemistry is not bound by probability. It's governed by the electromagnetic force. There's no chance involved. When you pour vinegar into a bowl filled with baking soda, there's no probability that there's going to be a reaction, the reaction is inevitable.
Is that what they'll want to teach? That science doesn't have all the answers yet ...
The day science has all the answers is the day science is no longer done. When you know EVERYTHING about EVERYTHING, you've got no reason to ask any questions about anything you see, because you already have the answer. Scientists do NOT have the answers. Back when science was used to discover the earth was NOT the center of the universe, the scientists had no preconceived notions about whether or not it would actually be in the center of the universe, they just had to check. When the first scientists discovered the earth was much older than their holy texts told them it was, they were amazed. You think the first person who used science to determine that the earth wasn't made a few thousand years ago had an agenda? He was trying to confirm his faith through science, but the reality of the situation was: his faith was wrong. Sure, it's possible he had an agenda to deconvert everybody into a bunch of raving heathens, but the key with science is evidence, not belief. You're free to believe what you want, but if you want to convince a scientist of your belief, you need EVIDENCE, and a single book written about 1800 years ago is NOT compelling evidence. Science also provides verifiable predictions. It's almost like seeing into the future, with astounding accuracy, because they've already done all the hard work and can calculate how something will be, if their idea has merit.
Learn something new.
> Now think about what happened when they let the conservative religious crazies take control.
Methinks history betrays you.
The Wahabbi extremists (Islamic versions of the US fundamentalist extremists) came to power with ibn Saud, in the 18th century.
Economic power (and scientific luminance) seeped away from the Caliphates and kingdoms of the Levant when the sea routes were broken open, most notably and astoundingly at Lepanto.
There's also:
http://en.wikipedia.org/wiki/Kitzmiller_v._Dover_Area_School_District
ID is creationism and creationism being taught in schools is a clear violation of the separation of church and state. That, so called, broad statement is law in many a county including the US.
If memory serves me correct, Behe's books were completely and utterly shredded in the recent Kansas court case.
I doubt you will, but you can start your reading here:
http://www.talkorigins.org/faqs/behe.html
.there is enough of everything for everyone.
I know this is off topic, but it is a personal pet peeve. Just for the sake of accuracy, Persians (Iranians preferred name) Teach Evolution heavily. The purely religious institutions don't, but they also don't teach against it. Except the "hillbillies" of the country, a very small percentage of the population. Basically, the areas comparable to the back woods of Arkansas with no electricity.
They think that Evolution is fact.
In fact, I cannot tell you how many times the evolution debate in this country has made a Persians ask me about it, assuming I, being American, must be creationist. When they find out I am not, they ask me why Americans are so stupid. My Wife (A Beautiful Persian woman) laughs and makes fun of my Uncle, a fundamentalist Christian. Though they are careful to try to avoid me hearing so as to not give offense, they actually make fun of the US over these things. This came up as a topic of conversation each and every time I was over there. They actually wanted to know if it was true, or just more propaganda from their government to make us look bad.
This idea that Iran is backwards, just because their president is divisive and they are on some "Axis of Evil" list created primarily for political "Us vs. Them" games is really frustrating. Remember, they have a ruling class that uses the uneducated violent minority to enforce its lust for power. But it is a minority, less than 10%. We have a larger ultra-religious group of zealots in this country. Their president makes those crazy statements because it appeals to the minority powerbase, and it gets attention on a world stage.
I have never met a Persian who did not believe that the holocaust happened and was terrible. Oh, they don't like Isreal's POLITICS, but they have no problem with jews. They equally don't like Palestinian Politics. (though are less likely to like Palestinians)
Iran is actually quite "western". Our allies (Saudi Arabia, Kuwait, Etc...) in the middle east are actually much closer to the stereotypes that are applied to Iran. Iran was fighting the Taliban before most Americans even know Afghanistan continued to exist after the russian left. They were demonstrating and providing support for Afghan women before we knew there was a problem. A woman with out a college degree in Iran is looked at with disdain, "why didn't she go to college and make herself better and educated?" The same applies to men by the way.
I'd love to know your statistical source of information on that, as most of the people I know who have studied evolution are either religious, or agnostic (with a few atheists in there for luck).
In the Europe, where evolution is taught as science, and creationism/ID fits squarely in Religious Education lessons, there is a high percentage of the population that are religious. Which squarely debunks your argument that teaching evolution promotes atheism.
Now, atheism is not strictly speaking a religion, as it has no firm set of beliefs, or common practices. It is just the belief that there is no deity. And before you start ranting away that science just promotes this, that is entirely incorrect.
The most scientifically correct approach would be agnosticism, where you're not sure if there is a god or not.
Atheism is a belief, in the same sense that a religion is a belief. There is no evidence for it, and it can neither be proved nor disproved. In other words, it is just plain NOT science.
Agnosticism covers the inability to know if there is a god. It is the absence of belief in either direction.
So, I'm not against creationism, or ID. I'm just entirely against them being treated as science. I firmly think that if people keep trying to get ID put in science classes (where it really does NOT belong, as it really is NOT science), then legally, religious studies classes and churches must be obligated to put the belief of the 'creation event' to scientific scrutiny, and widely spread the word.
In other words, the process that has allowed us to progress, and build a society that spans the globe, has enabled us to leap into space, and look farther away into the universe would be turned on a belief, and would give the answer "There is no evidence for this". And with science, you can choose to ignore the conclusions (ignoring it is just willful ignorance), or attempt to disprove it (if you can absolutely prove something with evidence based on experimentation, then you win, and get to amend the theories so that they take this evidence into account. Congratulations, your view is science!). Belief is not science. Science does not care what anyone believes, it only considers what can be shown to occur time after time, observably and reliably.
Evolution meets these criteria, ID and creationism don't.