Slashdot Mirror

← Back to Stories (view on slashdot.org)

Fluorescent Protein Research Lands Scientists Nobel Prize

Posted by timothy on from the also-will-change-dinner-forever dept.

Iddo Genuth writes "The Royal Swedish Academy of Sciences has announced three recipients of the Nobel Prize in Chemistry award for 2008: jointly given to Osamu Shimomura, Martin Chalfie and Roger Y. Tsien 'for the discovery and development of the green fluorescent protein, GFP' — a remarkable brightly glowing green fluorescent protein first observed in the beautiful jellyfish, Aequorea victoria, in 1962."

79 comments

  1. Good for them! by Anonymous Coward · · Score: 0

    They made glowing jellyfish! The next prize they will receive will probably be the Ig Nobel Prize in Biology!

    1. Re:Good for them! by virtualXTC · · Score: 3, Interesting

      ...The next prize they will receive will probably be the Ig Nobel Prize in Biology!

      Well, actually considering one of it's uses, I wouldn't be suprised: glowing cats

    2. Re:Good for them! by Anonymous Coward · · Score: 2, Informative
      Some info posted from the Nobel webpage so that those who won't RTFA can have some idea what they're talking about:

      The remarkable brightly glowing green fluorescent protein, GFP, was first observed in the beautiful jellyfish, Aequorea victoria in 1962. Since then, this protein has become one of the most important tools used in contemporary bioscience. With the aid of GFP, researchers have developed ways to watch processes that were previously invisible, such as the development of nerve cells in the brain or how cancer cells spread.

      Tens of thousands of different proteins reside in a living organism, controlling important chemical processes in minute detail. If this protein machinery malfunctions, illness and disease often follow. That is why it has been imperative for bioscience to map the role of different proteins in the body.

      This year's Nobel Prize in Chemistry rewards the initial discovery of GFP and a series of important developments which have led to its use as a tagging tool in bioscience. By using DNA technology, researchers can now connect GFP to other interesting, but otherwise invisible, proteins. This glowing marker allows them to watch the movements, positions and interactions of the tagged proteins.

      Researchers can also follow the fate of various cells with the help of GFP: nerve cell damage during Alzheimer's disease or how insulin-producing beta cells are created in the pancreas of a growing embryo. In one spectacular experiment, researchers succeeded in tagging different nerve cells in the brain of a mouse with a kaleidoscope of colours.

    3. Re:Good for them! by ceoyoyo · · Score: 1

      Considering the other uses underlie much of modern genetics and molecular medical research, maybe not.

    4. Re:Good for them! by Wiarumas · · Score: 2, Interesting

      I would also like to add that they can use different colors (other than green) so they can observe several processes at once. Pretty neat stuff.

      --
      I will bend like a reed in the wind.
    5. Re:Good for them! by Anonymous Coward · · Score: 5, Informative

      GFP is without a doubt the most commonly used fluorescent tag. It's the workhorse of biological fluorescence microscopy. Given the tens of thousands of publications that have used it, the Nobel prize is certainly deserved.

      One of the great things about GFP is that it is a protein. So you can engineer an organism to express GFP. In fact you can engineer the fluorescent protein to be bound to whatever protein you want, just by splicing it into the correct place in the genome. So you can basically make any protein glow. So you can track proteins implicated in cell mobility, or vision, or signaling, or cancer, or some other disease, or whatever.

      With modern fluorescent microscopes, you can actually imagine GFP at the single-molecule level. So you can build movies where quite literally you can track individual protein molecules as they move inside a cell. This obviously gives a whole new insight into cellular machinery, and hence everything based on cells (e.g. life and death).

    6. Re:Good for them! by ceoyoyo · · Score: 1

      Have you seen a confocal microscopy image of a bunch of neurons, each producing a different colour? The fluorescent proteins migrate down the dendrites and mix. You get a rainbow that indicates connectivity. And it's pretty.

    7. Re:Good for them! by philspear · · Score: 1

      They made glowing jellyfish! The next prize they will receive will probably be the Ig Nobel Prize in Biology!

      They who?!? God? The jellyfish was where the protein was discovered, then they cloned it and co-opted it for use in other things. You have it 100% backwards.

    8. Re:Good for them! by Hatta · · Score: 5, Informative

      It sounds silly, but this is one of the great success stories of pure research. GFP has proved to be an absolutely astounding tool for biologists, one that we'd never have if there weren't people curious enough to ask "why does that jellyfish glow?" and people willing to fund them.

      I'll cite just one example of this protein being used in a completely novel and extremely powerful way. Fluorescent proteins absorb at one wavelength and emit at another longer wavelength. They've fiddled with the GFP sequence to make yellow and red versions that have overlapping spectra. So now you can tag any two proteins of interest in a cell with GFP and YFP. Next you expose them to light that excites GFP. If the two proteins of interest are closely associated there will be an efficient transfer of energy, and you'll see lots of yellow light emitted. If the proteins of interest are not associated, you'll get mostly green light.

      That's right, you can measure the average distance between two proteins with nothing more than 2 fluorescent proteins, a laser and a spectrophotometer. Not only that, but you can do it in a living cell culture, apply pharmaceuticals to the cells and track the change in real time. That's just one of the more amazing uses of GFP, and a great example of why it's so important to fund research with no obvious practical value.

      --
      Give me Classic Slashdot or give me death!
    9. Re:Good for them! by philspear · · Score: 4, Interesting

      There was a project with the goal to make a mouse that expressed a variety of different fluorophores in it's neurons so that you could tell one neuron from another, watch active processes, and so on.

      The best part is the name: the brainbow mouse

      http://www.wired.com/science/discoveries/multimedia/2007/10/gallery_fluorescentneurons

      http://bioephemera.com/2007/11/13/the-brainbow-mouse/

      http://www.boston.com/news/globe/health_science/articles/2006/11/06/microscope_renaissance/

      I think some of Tsien's work is more interesting, I believe he's made some fluorophores that you can turn on and off, or convert to different colors to identify specific cells, in addition to some dyes which fluoresce only in the presence of calcium.

    10. Re:Good for them! by philspear · · Score: 1

      Of course, the south koreans who made those cats were not the people awarded the prize, nor were they the people who discovered or developed GFP, so if anyone's getting an ignoble out of it, it won't be the three who got the prize. Someone else who uses your discovery to stupid ends doesn't make your discovery ridiculous. There are plenty of very valuable studies that have used GFP which make up for it 1000 to 1.

    11. Re:Good for them! by camperdave · · Score: 4, Funny

      The questions remaining: Can they get blue as well as green and red? Can they be injected into skin cells? Can the glow be controlled by the nervous system? Which tattoo parlour can give me my glow in the dark thought controlled, full color tattoo?

      --
      When our name is on the back of your car, we're behind you all the way!
    12. Re:Good for them! by Fast+Thick+Pants · · Score: 2, Funny

      I can't help wondering what form of currency I'll be slipping into the straps of fluorescent Korean strippers in 20 years.

    13. Re:Good for them! by Anonymous Coward · · Score: 0

      "That's right, you can measure the average distance between two proteins with nothing more than 2 fluorescent proteins, a laser and a spectrophotometer. Not only that, but you can do it in a living cell culture, apply pharmaceuticals to the cells and track the change in real time. That's just one of the more amazing uses of GFP, and a great example of why it's so important to fund research with no obvious practical value"

      No obvious practical value? Dear god, what'll the MBA's, the gatekeepers of the universe do?

    14. Re:Good for them! by 6th+time+lucky · · Score: 1

      Can they get blue as well as green and red?

      yes yes yes

      Can they be injected into skin cells?

      Yes, but you may not want to... and it may not last long

      Can the glow be controlled by the nervous system?

      I'll say 'not yet' rather than a flat out 'no'.

      Which tattoo parlour can give me my glow in the dark thought controlled, full color tattoo?

      The tools arent that hard to make but getting your hands on the (G)/(R)/(B)/FP is slightly harder... I have them in my lab ;-)

      Just give me...
      1) these (check),
      2) a template mask -one for each colour (easy enough)
      3) And the GFP in the appropriate DNA vector,
      4) ???
      5) profit
      6) and i can paint with 1" dots a tattoo...

      I am ***SO*** doing this on the next plant I shoot (not my pic), I only use G(reen)FP on tobacco mainly, so they will have to be monochrome. oh well. just have to put up with green glowing smiley faces on some leaf! No i wont be doing myself (a. I dont have a human vector and b. im not *that* stupid)

      p.s. Yes, doing a PhD does make you look for entertainment in odd places.

      I looked high and low for GFP tattooed mice (just green dots), which i know i've seen, but google is not my friend.

    15. Re:Good for them! by Maximum+Prophet · · Score: 1

      It sounds silly, but this is one of the great success stories of pure research. GFP has proved to be an absolutely astounding tool for biologists, one that we'd never have if there weren't people curious enough to ask "why does that jellyfish glow?" and people willing to fund them.

      Not really. There was a piece on NPR this morning on the guy, Douglas Prasher, who actually discovered the gene that makes this protein. (The winners came up with a way to use his gene) His funding was cut and he's now driving a courtesy car for a car dealership in Alabama.

      --
      All ideas^H^H^H^H^Hprocesses in this post are Patent Pending. (as well as the process of patenting all postings)
    16. Re:Good for them! by camperdave · · Score: 1

      I am ***SO*** doing this on the next plant I shoot (not my pic)

      Oh no! I've created a monster!

      --
      When our name is on the back of your car, we're behind you all the way!
  2. Well.... by morgan_greywolf · · Score: 0, Redundant

    Well, I for one welcome our new fluorescent-green overlords!

    --
    My blog
    1. Re:Well.... by Zatacka · · Score: 0, Redundant

      Their competitors are probably green with envy!

    2. Re:Well.... by Anonymous Coward · · Score: 0

      You're not even trying, are you?

    3. Re:Well.... by MyLongNickName · · Score: 3, Funny

      You're not even trying, are you?

      Actually, he is very trying.

      --
      See my journal for slashdot ID's by year. Mine created in 2005. http://slashdot.org/journal/289875/slashdot-ids-by-year
    4. Re:Well.... by morgan_greywolf · · Score: 1

      Thanks! :-P

      --
      My blog
    5. Re:Well.... by MyLongNickName · · Score: 0

      Us old timers gotta keep you newbies in line :)

      --
      See my journal for slashdot ID's by year. Mine created in 2005. http://slashdot.org/journal/289875/slashdot-ids-by-year
    6. Re:Well.... by morgan_greywolf · · Score: 1, Funny

      Whose a 'newbie'? I remember Slashdot before it even had moderation. Or user accounts.

      Now get off my lawn.

      --
      My blog
    7. Re:Well.... by Anonymous Coward · · Score: 0

      Us old timers gotta keep you newbies in line :)

      Oh god, do you realize what you've just done?

  3. Damn! by $RANDOMLUSER · · Score: 1

    I thought my BBQ sauce was going to win the Nobel Prize for Chemistry :(

    --
    No folly is more costly than the folly of intolerant idealism. - Winston Churchill
    1. Re:Damn! by megamerican · · Score: 3, Funny

      I thought my BBQ sauce was going to win the Nobel Prize for Chemistry :(

      Everyone knows that BBQ sauce goes under the peace category.

      --
      If you have something that you dont want anyone to know, maybe you shouldnt be doing it in the first place -Eric Schmidt
    2. Re:Damn! by morgan_greywolf · · Score: 1

      Everyone knows that BBQ sauce goes under the peace category.

      That greatly depends on how spicy said BBQ actually is ...

      --
      My blog
    3. Re:Damn! by $RANDOMLUSER · · Score: 2, Funny

      I think you're wrong. BBQ sauce has started almost as many wars as Perl.

      --
      No folly is more costly than the folly of intolerant idealism. - Winston Churchill
    4. Re:Damn! by Starteck81 · · Score: 1

      I thought my BBQ sauce was going to win the Nobel Prize for Chemistry :(

      Well if your BBQ sauce glowed green, in a nontoxic way, then you would have won. ;-)

      --
      "There are four boxes to be used in defense of liberty: soap, ballot, jury, and ammo. Please use in that order." -Ed H
  4. Well.... by cptdondo · · Score: 0

    The committee gave them a glowing recommendation....

    They must be glowing with happiness.... .....

  5. It's peanut butter jelly time! by Anonymous Coward · · Score: 0

    Nothing of value was present

  6. Green Eggs and Ham by frankie · · Score: 1

    These guys gave us the frabjous green pigs, for which all Dr Seuss fans should be quite thankful.

    But more seriously, the GFP gene is amazingly useful in genetic research. Personally I would have given them the Nobel in Biology rather than Chemistry.

    1. Re:Green Eggs and Ham by Markspark · · Score: 2, Interesting

      yeah.. me too, so i started looking, and a lot of the guys who received nobel prices in physics, got it for discoveries i for one consider chemistry.. such as Rayleigh, Pauli, and some others.
      so i guess it evens out, and besides, there's no price for biologists. and as some wise cartoonist once put it, Biology is just applied physics http://xkcd.com/435/

      --
      i find your lack of faith in science disturbing!
    2. Re:Green Eggs and Ham by Anonymous Coward · · Score: 1, Insightful

      First, there is no Nobel Prize for biology. The closest related fields are "chemistry" and "physiology or medicine."

      Second, it is truly sad that a relatively trivial technique, rather than a grand idea or discovery is awarded the Nobel Prize. The Prize should be given to those who actually advance the knowledge of the field and provide a breakthrough that leaves us all gaping in amazement, not the engineers that build the tools to do the investigations. It is an unfortunate commentary on how trivial research is these days.

    3. Re:Green Eggs and Ham by reverseengineer · · Score: 3, Informative

      The issue is that there is no Nobel in Biology- there are Nobels in Chemistry and in Physiology or Medicine. While there have been some fascinating experiments using GFP to illuminate (sorry) processes in human cells, what these three did probably is not best categorized as a medical advance. It's been pretty common practice, especially in the last couple decades, to consider advances in biochemistry/molecular biology as eligible for the Nobel in Chemistry.

      --
      "FDA staff reviewers expressed concern about the number of patients who were left out of the study because they died."
    4. Re:Green Eggs and Ham by ceoyoyo · · Score: 2, Insightful

      When Nobel was creating the prizes biology had more in common with being a librarian than it did with what we think of as biology today.

    5. Re:Green Eggs and Ham by Anonymous Coward · · Score: 0

      I would too, but there is no Nobel prize for Biology because when they created the damned things (Nobel prizes), the field either non-existent or part of chemistry.

      So chemist and biologist have to duke it out for the prize.

    6. Re:Green Eggs and Ham by morgan_greywolf · · Score: 2, Funny

      so i guess it evens out, and besides, there's no price for biologists

      Cool! Biologists are free as in beer! Can I have 10, please? Oh, and can you make them female? And cute, too.

      --
      My blog
    7. Re:Green Eggs and Ham by Hatta · · Score: 1

      It's been pretty common practice, especially in the last couple decades, to consider advances in biochemistry/molecular biology as eligible for the Nobel in Chemistry.

      Which is a good way to approach it, considering that chemistry is mostly solved anyway. Pretty much anything that would be worthy of a Nobel in chemistry would be equally or better suited for a Nobel in physics.

      --
      Give me Classic Slashdot or give me death!
    8. Re:Green Eggs and Ham by reverseengineer · · Score: 2, Informative

      I wouldn't go quite that far, at least not yet. Looking at the last ten Chemistry Nobels, it's about 50-50 between molecular biology and the rest of chemistry. Last year's prize went for work in surface catalysis, 2005 went to the olefin metathesis guys, 2001 was for chiral syntheses, 2000 was for conductive polymers, 1999 was for femtosecond kinetics, and 1998 was for quantum chemistry.

      I'll grant that chemistry doesn't have the big questions to solve like physics does, but there are still substantial discoveries out there to be made. Synthesis and catalysis can always be improved, as can analytical techniques. There's been a big push in modern chemistry to make industrial chemistry more enviromentally friendly, which I'm sure will lead to at least one prize specifically for this.

      --
      "FDA staff reviewers expressed concern about the number of patients who were left out of the study because they died."
    9. Re:Green Eggs and Ham by Anonymous Coward · · Score: 1, Informative

      Relatively trivial? Tsien's work on expanding the spectra at which fluorescent proteins emit has been anything but. He and his lab pretty much figured out the chemistry by which normally non-fluorescent amino acids are modified post-translationally (after the protein has been made inside the cell) to create a chain of conjugated Pi electrons (ie several double bonds one after the other). This had never been seen in other proteins. Then he took the backbone of the protein and modified the amino acid sequence to emit at different wavelengths (by changing the composition of the Pi electron chain). This was neither obvious nor trivial, given that even single amino acid changes to a protein can completely destabilize it (and Tsien has created at least 10 variants with fluorescent ranges of over 400nm; from blue all the way to deep red).

      Even taking away the immense benefit that this 'tool' has had on molecular biology, the work done to understand the nature by which GFP (and other naturally occuring fluorescent proteins that have been discovered since then) is created and how it works is still immensely useful to organic chemistry and molecular biology.

  7. Cool by Prikolist · · Score: 1

    any green glowing food coming for halloween?

    --
    I think Linux isn't better than Windows hence in the slashdot realm I'm a troll
    1. Re:Cool by HTH+NE1 · · Score: 1

      any green glowing food coming for halloween?

      Gummy Bears under blacklights?

      --
      Oh, say does that Star-Spangled Banner entwine / The myrtle of Venus with Bacchus's vine?
    2. Re:Cool by philspear · · Score: 1

      GFP is a protein, gummy bears on the other hand are completely inorganic goo.

    3. Re:Cool by HTH+NE1 · · Score: 1

      GFP is a protein, gummy bears on the other hand are completely inorganic goo.

      They're a gelatinous suspension of sugar. As you saying sugar is inorganic?

      (Actually, in most US states they're probably high fructose corn syrup.)

      --
      Oh, say does that Star-Spangled Banner entwine / The myrtle of Venus with Bacchus's vine?
    4. Re:Cool by idontgno · · Score: 2, Interesting
      More to the point, they're gelatinous because they're made of gelatin. Which is protein.

      So substitute GFP for boiled animal joints et voila phosphorescent gummis.

      --
      Welcome to the Panopticon. Used to be a prison, now it's your home.
    5. Re:Cool by philspear · · Score: 1

      woooooosh. Didn't realize there were so many fans of gummy bears!

      Gellatin is used probably because when you boil it it becomes denatured and can bind with other mollecules to make a net, similar to albumin from eggs. GFP can denature too, but that destroys it's structure and fluroescence. I'm not sure it would congeal the same, but it wouldn't still glow.

    6. Re:Cool by 6th+time+lucky · · Score: 1

      any green glowing food coming for halloween?

      maybe not... but you could be putting a GFP fish under a glowing Xmas tree (not GFP, but still cool)

    7. Re:Cool by Maximum+Prophet · · Score: 1

      Tried that, nix. So far I haven't found a brand of candy that glows under UV.

      --
      All ideas^H^H^H^H^Hprocesses in this post are Patent Pending. (as well as the process of patenting all postings)
    8. Re:Cool by HTH+NE1 · · Score: 1

      Tried that, nix. So far I haven't found a brand of candy that glows under UV.

      Darn. Would have been good, especially for Gummy Worms.

      Have you checked SweetTarts Sours or other sour candies? That outer sour coating might twinkle.

      I guess for glowing under UV you'll need something with a UV-reactive wrapper.

      --
      Oh, say does that Star-Spangled Banner entwine / The myrtle of Venus with Bacchus's vine?
    9. Re:Cool by Maximum+Prophet · · Score: 1

      One way to make Jello glow is to embed glow sticks or glow bracelets into to. You do have to be careful that drunk party goers don't eat the glowing part though...

      --
      All ideas^H^H^H^H^Hprocesses in this post are Patent Pending. (as well as the process of patenting all postings)
  8. I know who should really get the peace prize. by Anonymous Coward · · Score: 0, Funny

    The guy who made dynamite, sure on the surface it doesn't sound all the peaceful, but just hang in there. If he hadn't invented dynamite we would have no way to measure explosive's power. We would have all died in the cold war:

    Mr President guy: Our Nuclear weapons are very strong.

    Advisor: How strong are they?

    Mr President guy: I don't know, if only we had a way to measure the power of explosives. Oh well I guess the only way to check is to use them.

    Advisor: Test them eh? But where?

    Mr President guy: I know! Lets test them on Moscow!

    Boom we're all dead.

    1. Re:I know who should really get the peace prize. by Jester6641 · · Score: 1

      I think he'd be disqualified and all, what with establishing the prize and everything. Might a conflict of interest.

      --
      Jester

      Warning: This sig may be legally binding in England.
    2. Re:I know who should really get the peace prize. by morgan_greywolf · · Score: 1

      No, no. The Nobel Prize wasn't actually established by Alfred Nobel, it was actually established by his brother Ig. Everyone knows that.

      --
      My blog
    3. Re:I know who should really get the peace prize. by Anonymous Coward · · Score: 0

      Nobel actually thought that dynamite would make war too dangerous...

  9. Nobel for Slurm!! by oldhack · · Score: 1

    Um... tasty.

    --
    Fuck systemd. Fuck Redhat. Fuck Soylent, too. Wait, scratch the last one.
  10. IT"S PEOPLE!!!1!!! by Anonymous Coward · · Score: 0

    i'm scared now

  11. Prior Art! by cadience · · Score: 1

    there was obviously prior art - even sited. And they still got the prize. I kid...though sounds familiar.

    1. Re:Prior Art! by philspear · · Score: 1

      Well, they didn't patent the GFP mollecule. I think Tsien may have patented some derivatives that he developed which aren't found in nature, but the original GFP is not.

    2. Re:Prior Art! by Anonymous Coward · · Score: 0

      You're correct, he has made some derivatives entitled mCherry, mGrape, etc. I've seen images from his lab where people 'drew' (cultured) bacteria to make multi-colored images on a petrie dish.

  12. don't give them the money by sgt+scrub · · Score: 4, Funny

    Hold onto the cash until they successfully splice it into the mosquito's DNA. Glowing mosquito == dead mosquito!

    --
    Having to work for a living is the root of all evil.
  13. Don't look at the light by No2Gates · · Score: 0

    Oh, glowing protein. THERE'S a good reason to award someone a bunch of money. This will do what for me?

    --
    Every time you call tech support, a little kitten dies.
  14. Glofish by PoitNarf · · Score: 2, Interesting

    I think this is the same protein used in Glofish:
    http://en.wikipedia.org/wiki/GloFish

    Got some here in our tank at work, they're pretty cool to look at.

    --

    "0101100101? It's just jibberish. *looks in mirror, gasps* 1010011010@!? AHHHHHH!!"
    1. Re:Glofish by Anonymous Coward · · Score: 0

      GFP's are awesome. Most new varieties come from corals. Many of which i grow. Watch me rap about corals and GFP's

      http://www.youtube.com/watch?v=jgbH04g6mXs

  15. interesting protein by gordona · · Score: 1

    Some 36 years ago, in another life as a physiologist, I used this protein, also known as Aquorin as an means to monitor the rise and fall of the intracellular calcium ion concentrations in invertebrate muscle. Aquorin fluoresces in the presence of very low levels of calcium ions and was used as one of the means to show that these ions were responsible for triggering muscle contraction. However, the experiments were very difficult to do, Aquorin was very expensive and the success rate of the experiments was not very high.

    --
    "Gentlemen, you can't fight in here! This is the War Room!" -- Dr. Strangelove
  16. Awesome by Fredbo · · Score: 1

    Now let's see them insert the gene into a chameleon and see what it'll do...

  17. Lesbians wrestle in BBQ sauce more than Perl code by Anonymous Coward · · Score: 0

    If someone comments on GNU/Lesbian about lesbians struggling with Perl, that is a damn lie! Lesbians conquered the Perl anal beads when they first went to their 13 yearold girlfriends houses for sleepovers! OMG Yes. yeh-eh-eh-eh-ahhhhh!

  18. Another use is as a trace statement by NotSoHeavyD · · Score: 0, Redundant

    I mean you really could think of this as being the functional equivalent to a trace statement used by a programmer.(Yes, really.) So for example suppose there was a piece of genetic code you were interested in. You might want to know where and when the code was executed. So you slip in the code to generate this glowing protein right next to the code you're interested in. (Just like putting a trace statement in a piece of C++ code you might be interested in.) Then you let the organism live for awhile, in effect running the code and possibly hitting the interesting part. Then bring over the light and look for a glow.(And if you see a glow the code was run and you can even tell where.) We had fruit fly maggots in a cell bio lab where they showed us this. The trace was next to a protein involved with the nervous system. You could tell that because when we looked for the glow their brain and spinal code glowed.) But pretty much any reason you'd put a trace statement in a piece of computer code you can do the same thing with this stuff.

  19. They left one guy out. by Anonymous Coward · · Score: 0

    His name is Douglas Prasher. He worked had at Woods Hold to clone it. He eventually got it done, but ran out of money and didn't get tenure. He now works for the US Agricultural service.

    Shimomura isolated the protein.
    Prasher cloned it, and gave it to Chalfie. Chalfie expressed it in a living cell.
    Tsien popularized it and produced many variants.

    Prasher got screwed.

  20. So, Fluorescent Proteine You Say. by paniq · · Score: 1

    Can I swallow GFP to get glow-in-the-dark jizz?

    --
    Do not trust this signature.
  21. Poor link choice? by Prune · · Score: 2, Insightful

    Why was "beautiful jellyfish" selected as the portion of the text hyperlinking to the article? I clicked on it expecting to see a beautiful jellyfish, and instead saw three humans that are not quite beautiful...

    --
    "Politicians and diapers must be changed often, and for the same reason."
  22. GFP Sequence by Joe+Torres · · Score: 1

    In case anyone wants the GFP sequence: atggtgagcaagggcgaggagctgttcaccggggtgg tgcccatcctggtcgagctggacggcgacgtgaacgg ccacaagttcagcgtgtccggcgagggcgagggcgat gccacctacggcaagctgaccctgaagttcatctgca ccaccggcaagctgcccgtgccctggcccaccctcgt gaccaccctgacctacggcgtgcagtgcttcagccgc taccccgaccacatgaagcagcacgacttcttcaagt ccgccatgcccgaaggctacgtccaggagcgcaccat cttcttcaaggacgacggcaactacaagacccgcgcc gaggtgaagttcgagggcgacaccctggtgaaccgca tcgagctgaagggcatcgacttcaaggaggacggcaa catcctggggcacaagctggagtacaactacaacagc cacaacgtctatatcatggccgacaagcagaagaacg gcatcaaggtgaacttcaagatccgccacaacatcga ggacggcagcgtgcagctcgccgaccactaccagcag aacacccccatcggcgacggccccgtgctgctgcccg acaaccactacctgagcacccagtccgccctgagcaa agaccccaacgagaagcgcgatcacatggtcctgctg gagttcgtgaccgccgccgggatcactcacggcatgg acgagctgtacaagtaa

    1. Re:GFP Sequence by hellop2 · · Score: 1

      Thank you. Now, please explain how I can use this to make my cat glow in the dark.

      --
      How many more years will slashdot have an off-by-one error on your Score in your profile?
    2. Re:GFP Sequence by OolimPhon · · Score: 1

      That's the number of the lock on my luggage!

    3. Re:GFP Sequence by thompson.ash · · Score: 1

      That sounds like the sort of code an idiot would have on his luggage!

      --
      I didn't say it was your fault, I said I was going blame you for it!
  23. Additional colors available, by csubi · · Score: 1

    image from the website of the Tsien Lab

  24. The guy who discovered the gene by Maximum+Prophet · · Score: 2, Interesting

    There was a piece on NPR this morning on the guy, Douglas Prasher, who actually discovered the gene that makes this protein. (The winners came up with a way to use his gene) His funding was cut and he's now driving a courtesy car for a car dealership in Alabama.

    --
    All ideas^H^H^H^H^Hprocesses in this post are Patent Pending. (as well as the process of patenting all postings)
  25. Glowing food by Maximum+Prophet · · Score: 1

    I've been on a hunt for fluorescent food for several years now. So far, beer is the only edible substance that I've found that even weakly glows. There are dyes that are listed as fluorescent and non-toxic, but it's a stretch from non-toxic to edible. B.T.W. I theorized the it was the Vitamin B in beer that made it glow, but I tried several brands of vitamin B (multi and single versions like B12) and non of them glowed under UV.

    --
    All ideas^H^H^H^H^Hprocesses in this post are Patent Pending. (as well as the process of patenting all postings)