Slashdot Mirror
Fluorescent Protein Research Lands Scientists Nobel Prize
Iddo Genuth writes "The Royal Swedish Academy of Sciences has announced three recipients of the Nobel Prize in Chemistry award for 2008: jointly given to Osamu Shimomura, Martin Chalfie and Roger Y. Tsien 'for the discovery and development of the green fluorescent protein, GFP' — a remarkable brightly glowing green fluorescent protein first observed in the beautiful jellyfish, Aequorea victoria, in 1962."
I thought my BBQ sauce was going to win the Nobel Prize for Chemistry :(
No folly is more costly than the folly of intolerant idealism. - Winston Churchill
...The next prize they will receive will probably be the Ig Nobel Prize in Biology!
Well, actually considering one of it's uses, I wouldn't be suprised: glowing cats
The remarkable brightly glowing green fluorescent protein, GFP, was first observed in the beautiful jellyfish, Aequorea victoria in 1962. Since then, this protein has become one of the most important tools used in contemporary bioscience. With the aid of GFP, researchers have developed ways to watch processes that were previously invisible, such as the development of nerve cells in the brain or how cancer cells spread.
Tens of thousands of different proteins reside in a living organism, controlling important chemical processes in minute detail. If this protein machinery malfunctions, illness and disease often follow. That is why it has been imperative for bioscience to map the role of different proteins in the body.
This year's Nobel Prize in Chemistry rewards the initial discovery of GFP and a series of important developments which have led to its use as a tagging tool in bioscience. By using DNA technology, researchers can now connect GFP to other interesting, but otherwise invisible, proteins. This glowing marker allows them to watch the movements, positions and interactions of the tagged proteins.
Researchers can also follow the fate of various cells with the help of GFP: nerve cell damage during Alzheimer's disease or how insulin-producing beta cells are created in the pancreas of a growing embryo. In one spectacular experiment, researchers succeeded in tagging different nerve cells in the brain of a mouse with a kaleidoscope of colours.
These guys gave us the frabjous green pigs, for which all Dr Seuss fans should be quite thankful.
But more seriously, the GFP gene is amazingly useful in genetic research. Personally I would have given them the Nobel in Biology rather than Chemistry.
Considering the other uses underlie much of modern genetics and molecular medical research, maybe not.
any green glowing food coming for halloween?
I think Linux isn't better than Windows hence in the slashdot realm I'm a troll
I would also like to add that they can use different colors (other than green) so they can observe several processes at once. Pretty neat stuff.
I will bend like a reed in the wind.
Um... tasty.
Fuck systemd. Fuck Redhat. Fuck Soylent, too. Wait, scratch the last one.
You're not even trying, are you?
Actually, he is very trying.
See my journal for slashdot ID's by year. Mine created in 2005. http://slashdot.org/journal/289875/slashdot-ids-by-year
I think he'd be disqualified and all, what with establishing the prize and everything. Might a conflict of interest.
Jester
Warning: This sig may be legally binding in England.
GFP is without a doubt the most commonly used fluorescent tag. It's the workhorse of biological fluorescence microscopy. Given the tens of thousands of publications that have used it, the Nobel prize is certainly deserved.
One of the great things about GFP is that it is a protein. So you can engineer an organism to express GFP. In fact you can engineer the fluorescent protein to be bound to whatever protein you want, just by splicing it into the correct place in the genome. So you can basically make any protein glow. So you can track proteins implicated in cell mobility, or vision, or signaling, or cancer, or some other disease, or whatever.
With modern fluorescent microscopes, you can actually imagine GFP at the single-molecule level. So you can build movies where quite literally you can track individual protein molecules as they move inside a cell. This obviously gives a whole new insight into cellular machinery, and hence everything based on cells (e.g. life and death).
Have you seen a confocal microscopy image of a bunch of neurons, each producing a different colour? The fluorescent proteins migrate down the dendrites and mix. You get a rainbow that indicates connectivity. And it's pretty.
Thanks! :-P
My blog
No, no. The Nobel Prize wasn't actually established by Alfred Nobel, it was actually established by his brother Ig. Everyone knows that.
My blog
They made glowing jellyfish! The next prize they will receive will probably be the Ig Nobel Prize in Biology!
They who?!? God? The jellyfish was where the protein was discovered, then they cloned it and co-opted it for use in other things. You have it 100% backwards.
Whose a 'newbie'? I remember Slashdot before it even had moderation. Or user accounts.
Now get off my lawn.
My blog
It sounds silly, but this is one of the great success stories of pure research. GFP has proved to be an absolutely astounding tool for biologists, one that we'd never have if there weren't people curious enough to ask "why does that jellyfish glow?" and people willing to fund them.
I'll cite just one example of this protein being used in a completely novel and extremely powerful way. Fluorescent proteins absorb at one wavelength and emit at another longer wavelength. They've fiddled with the GFP sequence to make yellow and red versions that have overlapping spectra. So now you can tag any two proteins of interest in a cell with GFP and YFP. Next you expose them to light that excites GFP. If the two proteins of interest are closely associated there will be an efficient transfer of energy, and you'll see lots of yellow light emitted. If the proteins of interest are not associated, you'll get mostly green light.
That's right, you can measure the average distance between two proteins with nothing more than 2 fluorescent proteins, a laser and a spectrophotometer. Not only that, but you can do it in a living cell culture, apply pharmaceuticals to the cells and track the change in real time. That's just one of the more amazing uses of GFP, and a great example of why it's so important to fund research with no obvious practical value.
Give me Classic Slashdot or give me death!
There was a project with the goal to make a mouse that expressed a variety of different fluorophores in it's neurons so that you could tell one neuron from another, watch active processes, and so on.
The best part is the name: the brainbow mouse
http://www.wired.com/science/discoveries/multimedia/2007/10/gallery_fluorescentneurons
http://bioephemera.com/2007/11/13/the-brainbow-mouse/
http://www.boston.com/news/globe/health_science/articles/2006/11/06/microscope_renaissance/
I think some of Tsien's work is more interesting, I believe he's made some fluorophores that you can turn on and off, or convert to different colors to identify specific cells, in addition to some dyes which fluoresce only in the presence of calcium.
there was obviously prior art - even sited. And they still got the prize. I kid...though sounds familiar.
Hold onto the cash until they successfully splice it into the mosquito's DNA. Glowing mosquito == dead mosquito!
Having to work for a living is the root of all evil.
Of course, the south koreans who made those cats were not the people awarded the prize, nor were they the people who discovered or developed GFP, so if anyone's getting an ignoble out of it, it won't be the three who got the prize. Someone else who uses your discovery to stupid ends doesn't make your discovery ridiculous. There are plenty of very valuable studies that have used GFP which make up for it 1000 to 1.
I think this is the same protein used in Glofish:
http://en.wikipedia.org/wiki/GloFish
Got some here in our tank at work, they're pretty cool to look at.
"0101100101? It's just jibberish. *looks in mirror, gasps* 1010011010@!? AHHHHHH!!"
The questions remaining: Can they get blue as well as green and red? Can they be injected into skin cells? Can the glow be controlled by the nervous system? Which tattoo parlour can give me my glow in the dark thought controlled, full color tattoo?
When our name is on the back of your car, we're behind you all the way!
Some 36 years ago, in another life as a physiologist, I used this protein, also known as Aquorin as an means to monitor the rise and fall of the intracellular calcium ion concentrations in invertebrate muscle. Aquorin fluoresces in the presence of very low levels of calcium ions and was used as one of the means to show that these ions were responsible for triggering muscle contraction. However, the experiments were very difficult to do, Aquorin was very expensive and the success rate of the experiments was not very high.
"Gentlemen, you can't fight in here! This is the War Room!" -- Dr. Strangelove
I can't help wondering what form of currency I'll be slipping into the straps of fluorescent Korean strippers in 20 years.
Now let's see them insert the gene into a chameleon and see what it'll do...
Can I swallow GFP to get glow-in-the-dark jizz?
Do not trust this signature.
Why was "beautiful jellyfish" selected as the portion of the text hyperlinking to the article? I clicked on it expecting to see a beautiful jellyfish, and instead saw three humans that are not quite beautiful...
"Politicians and diapers must be changed often, and for the same reason."
Can they get blue as well as green and red?
yes yes yes
Can they be injected into skin cells?
Yes, but you may not want to... and it may not last long
Can the glow be controlled by the nervous system?
I'll say 'not yet' rather than a flat out 'no'.
Which tattoo parlour can give me my glow in the dark thought controlled, full color tattoo?
The tools arent that hard to make but getting your hands on the (G)/(R)/(B)/FP is slightly harder... I have them in my lab ;-)
Just give me...
1) these (check),
2) a template mask -one for each colour (easy enough)
3) And the GFP in the appropriate DNA vector,
4) ???
5) profit
6) and i can paint with 1" dots a tattoo...
I am ***SO*** doing this on the next plant I shoot (not my pic), I only use G(reen)FP on tobacco mainly, so they will have to be monochrome. oh well. just have to put up with green glowing smiley faces on some leaf! No i wont be doing myself (a. I dont have a human vector and b. im not *that* stupid)
p.s. Yes, doing a PhD does make you look for entertainment in odd places.
I looked high and low for GFP tattooed mice (just green dots), which i know i've seen, but google is not my friend.
In case anyone wants the GFP sequence: atggtgagcaagggcgaggagctgttcaccggggtgg tgcccatcctggtcgagctggacggcgacgtgaacgg ccacaagttcagcgtgtccggcgagggcgagggcgat gccacctacggcaagctgaccctgaagttcatctgca ccaccggcaagctgcccgtgccctggcccaccctcgt gaccaccctgacctacggcgtgcagtgcttcagccgc taccccgaccacatgaagcagcacgacttcttcaagt ccgccatgcccgaaggctacgtccaggagcgcaccat cttcttcaaggacgacggcaactacaagacccgcgcc gaggtgaagttcgagggcgacaccctggtgaaccgca tcgagctgaagggcatcgacttcaaggaggacggcaa catcctggggcacaagctggagtacaactacaacagc cacaacgtctatatcatggccgacaagcagaagaacg gcatcaaggtgaacttcaagatccgccacaacatcga ggacggcagcgtgcagctcgccgaccactaccagcag aacacccccatcggcgacggccccgtgctgctgcccg acaaccactacctgagcacccagtccgccctgagcaa agaccccaacgagaagcgcgatcacatggtcctgctg gagttcgtgaccgccgccgggatcactcacggcatgg acgagctgtacaagtaa
image from the website of the Tsien Lab
Not really. There was a piece on NPR this morning on the guy, Douglas Prasher, who actually discovered the gene that makes this protein. (The winners came up with a way to use his gene) His funding was cut and he's now driving a courtesy car for a car dealership in Alabama.
All ideas^H^H^H^H^Hprocesses in this post are Patent Pending. (as well as the process of patenting all postings)
I am ***SO*** doing this on the next plant I shoot (not my pic)
Oh no! I've created a monster!
When our name is on the back of your car, we're behind you all the way!
There was a piece on NPR this morning on the guy, Douglas Prasher, who actually discovered the gene that makes this protein. (The winners came up with a way to use his gene) His funding was cut and he's now driving a courtesy car for a car dealership in Alabama.
All ideas^H^H^H^H^Hprocesses in this post are Patent Pending. (as well as the process of patenting all postings)
I've been on a hunt for fluorescent food for several years now. So far, beer is the only edible substance that I've found that even weakly glows. There are dyes that are listed as fluorescent and non-toxic, but it's a stretch from non-toxic to edible. B.T.W. I theorized the it was the Vitamin B in beer that made it glow, but I tried several brands of vitamin B (multi and single versions like B12) and non of them glowed under UV.
All ideas^H^H^H^H^Hprocesses in this post are Patent Pending. (as well as the process of patenting all postings)