DNA-Radio, Tune In To Your Chromosomes
An anonymous reader writes "The folks behind the DNA-Rainbow project (discussed on Slashdot before) apparently have some time to play around with genome data. After creating amazing pictures from the human DNA code they are now transforming all chromosomes to audio and streaming them to the Internet. Every base is read and broadcasted instead converting it to a color. Seemingly this artistic project will last a while. After some math they found out that it will take them more than 23.5 years to air the whole human genome sequence."
I for one welcome our robotic chromosome reader overlord. Cause it's going to know everything about our DNA, so it's important to n... CCCCCCAAGGCCCCAACCCAAAACCCCGGCCGGTCCATTCAA
Just me
Hence - all your base are belong to us!
They sentenced me to twenty years of boredom
Bring the 14.4 modem out of the closet and demodulate the audio sequence data.
Then, when you've got the entire code backed up locally, sue them for releasing
sensitive medical data over the internet without authorization.
Step 4: profit.
It is actually just some kid with a broken Speak & Spell.
This sounded great on my guitar until I came to the T chord.